A novel method for preparing and applying CTLA-4 secreted nanobody-targeted FAP-based CAR T cells
By preparing chimeric antigen receptor CAR T cells that secrete CTLA-4 nanobodies to target FAP, the problem of poor efficacy of CAR T cells in the treatment of solid tumors has been solved, achieving highly efficient killing and immune enhancement of FAP-positive tumors.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUANGXI MEDICAL UNIVERSITY
- Filing Date
- 2021-12-07
- Publication Date
- 2026-06-19
AI Technical Summary
Existing CAR T-cell therapies have poor efficacy in treating solid tumors, mainly due to the immunosuppressive effects of the tumor microenvironment and the decreased affinity caused by mismatch of single-chain antibodies, making it difficult to effectively target and kill solid tumors.
Chimeric antigen receptor CAR T cells that secrete CTLA-4 nanobodies to target FAP were prepared by combining FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP modified T cells with lentiviral infection technology. This process enhanced the killing activity of T cells and immune checkpoint blockade therapy.
It enhanced the specific targeting and killing ability of CAR T cells to solid tumors, increased tumor infiltration and T cell survival, reduced T cell exhaustion, and improved the killing efficiency against FAP-positive tumors.
Smart Images

Figure CN116286656B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor biopharmaceuticals and relates to a method for preparing CAR T cells (FAP-CTLA-4 / Nb CAR T cells) that secrete CTLA-4 nanobody and target FAP in adoptive immunotherapy and its application. Background Technology
[0002] T cells can target tumor cells by expressing CARs. Chimeric antigen receptors (CARs) are prepared by artificially fusing single-chain antibodies that specifically recognize tumor antigens with the receptor's intracellular domain, the "immunoreceptor tyrosine activation motif," which can activate T cells, into a recombinant gene. CAR-T cell therapy is currently the most popular and research-worthy treatment method in tumor immunotherapy. While CAR T therapy has made significant progress in hematological malignancies, its killing effect on solid tumors is limited due to the complex tumor microenvironment. Therefore, new methods need to be explored to improve the activity of CAR T therapy in solid tumors.
[0003] The basic design of CARs includes tumor-associated antigen-binding regions, intracellular signaling regions, transmembrane regions, and extracellular hinge regions. CAR T cells have now reached the fourth generation and have made significant progress in hematological malignancies. However, for solid tumors, CAR T cell therapy has consistently been less effective, largely due to the difficulty for tumor-specific T cells to overcome the immunosuppressive effects of the tumor microenvironment. Furthermore, most CARs currently use single-chain antibodies for antigen recognition. Mismatches between the VL and VH of different single-chain antibodies can reduce the affinity of the expressed single-chain antibodies, further contributing to the poor efficacy of CAR T therapy. Therefore, it is necessary to explore new methods to improve the activity of CAR T cells in treating solid tumors and further research the construction of FAP-CTLA-4 / Nb CAR T cells that can specifically recognize tumor antigens and produce highly effective anti-cancer effects.
[0004] Nanobodies are currently the smallest functional antigen-specific binding natural fragments, composed of approximately 120 amino acids, with a length of 4 nm and a diameter of 2.5 nm. This is significantly smaller than traditional monoclonal antibodies and Fab fragments (55 × 10⁻⁶). 3 ) or scFv(28×10 3 Nanobodies, with their smaller molecular weight, possess stronger and faster tissue penetration capabilities, enabling them to reach dense tissues such as solid tumors to exert their effects. Furthermore, nanobodies exhibit good stability, high affinity, low immunogenicity, and ease of genetic modification, avoiding the mispairing issues and heavy / light chain linking sequence optimization problems common with traditional antibodies. These advantages have demonstrated broad application prospects in areas such as tumor immunotherapy.
[0005] Fibroblasts are the most abundant stromal cells in the tumor microenvironment. Through interaction with tumor cells, they become activated, forming a special cell population—cancer-associated fibroblasts (CAFs). CAFs support tumor growth by secreting large amounts of growth factors and also increase tumor cell invasiveness through intercellular interactions and paracrine signals, secreting various pro-invasive factors, chemokines, and inflammatory mediators. CAFs highly express fibroblast activation protein (FAP). FAP is highly expressed in tumor-associated fibroblasts and some tumor cells, but rarely appears in normal tissues. It is a type II serine protease involved in various pathological processes and is expressed in over 90% of human epithelial carcinoma tissues. Therefore, exploring FAP-CTLA-4 / Nb CAR T therapy targeting the FAP antigen is of great significance for improving the immunosuppressive environment of solid tumors and generating a highly effective anti-tumor effect.
[0006] Cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) is a leukocyte differentiation antigen primarily expressed on the surface of activated T lymphocytes. In the early stages of tumorigenesis, it inhibits T cell proliferation and activation, participates in the negative regulation of the immune response, thereby protecting tumor cells from T cell attack and increasing tumor susceptibility. CTLA-4 antibodies can promote T cell proliferation and cytokine expression. Checkpoint blockade therapy utilizes checkpoint antibodies to block the interactions between inhibitory receptors on T cells and their inhibitory ligands on tumor cells. Research on these checkpoints has shown effective clinical efficacy in a range of solid tumors and hematologic malignancies. Therefore, we propose a method for preparing FAP-CTLA-4 / Nb CAR T cells and their application in tumor treatment, combining FAP-targeted CAR T cells with checkpoint blockade therapy. This method allows the cells to target FAP while simultaneously secreting immune checkpoint blockade nanobodies, thereby enhancing T cell survival and increasing the killing activity of CAR T cells against solid tumor cells. Summary of the Invention
[0007] The purpose of this invention is to provide a method for preparing engineered CAR T cells that secrete CTLA-4 nanobodies and target FAP, and another purpose is to provide the application of engineered CAR T cells that secrete CTLA-4 nanobodies and target FAP in the preparation of agents for treating tumors.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] A type of engineered CAR T cell that secretes CTLA-4 nanobody targeting FAP is described. This cell is a T cell modified with chimeric antigen receptor FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP. The chimeric antigen receptor is composed of an extracellular antigen recognition domain FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4VHH, and GFP fluorescent protein tandemly.
[0010] The CTLA-4 nanobody that secretes and targets FAP in CAR T cells is described in the following: the nucleotide sequence of the extracellular antigen recognition region FAPVHH is shown in SEQ ID NO.2, the nucleotide sequence of CTLA-4VHH is shown in SEQ ID NO.3, and the tag protein HIS-tag is shown in SEQ ID NO.4.
[0011] The CTLA-4 nanobody that secretes CAR T cells targeting FAP contains a modified chimeric antigen receptor FAPVHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP whose nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.
[0012] A method for preparing CAR T cells includes the following steps: designing a CAR target sequence and obtaining the CAR target sequence fragment FAP / Nb-HIStag-CD8-CD137(4-1BB)-CD3ζ-2A-CTLA-4 Nb-IRES-GFP by PCR. Recombining the enzyme-digested lentiviral vector GV400 with the CAR target sequence obtained by PCR. Transforming the recombinant lentiviral vector into DH5α Escherichia coli and screening for positive clones. Sequencing the positive clones to verify the successful construction of a lentiviral vector containing the FAP-CTLA-4 / Nb CAR sequence. Extracting plasmids from the successfully sequenced recombinant positive clones, transfecting them into 293T cells, and identifying the expression of the FAP-CTLA-4 / Nb CAR sequence in the cells by RT-PCR. After verifying that the recombinant lentiviral vector can express normally, packaging lentivirus using a three-plasmid system and detecting the titer. Constructing CAR T cells using lentiviral infection technology to express the chimeric antigen receptor in the T cells.
[0013] A method for preparing CAR T cells as described above, the method comprising the following steps:
[0014] (1) Construction of recombinant lentiviral vector containing the target CAR sequence: The CAR fragment of FAP / Nb-HIStag-CD8-CD137(4-1BB)-CD3ζ-2A-CTLA-4Nb-IRES-GFP was obtained by PCR, and the synthesized fragment was subcloned into the lentiviral vector GV400 after double digestion with BamHI / EcoRI. The recombinant lentiviral vector was transformed into DH5α Escherichia coli. The colonies screened by ampicillin were identified by PCR using primers on the lentiviral vector and primers on the target gene. The successfully identified bacterial cultures were sequenced. Plasmid extraction was performed using the Plasmid Mini Kit after successful sequencing.
[0015] (2) Lentiviral Packaging: A three-plasmid system was used to co-transfect 293T cells with a recombinant lentiviral vector containing the CAR sequence using two helper vector plasmids, Helper 1.0 and Helper 2.0 (please confirm the meaning is correct). After 48 hours, the expression of green fluorescence (GFP) in the cells was observed under a fluorescence microscope. Successful fluorescence expression was confirmed. The supernatant of the 293T cells was collected, concentrated, purified, and the viral concentration was determined using a fluorescence dilution method. The number of GFP-positive cells was counted, and the viral titer was calculated using the formula: Virus concentration = Number of fluorescent cells / Volume of original virus solution in the well.
[0016] (3) T cell preparation: Mononuclear cells from peripheral blood are isolated and cultured to obtain T cells.
[0017] (4) Preparation of FAP-CTLA-4 / Nb CAR T cells: T cells were cultured for 24 hours in a dedicated T cell culture medium containing human CD3 monoclonal antibody, human CD28 monoclonal antibody, and human IL-2 cytokine. The next day, lentiviral solution was added to the stimulated T cells according to the MOI of 20, and the cells were cultured in a CO2 incubator at 37°C. After 48 hours, the CAR T cells were placed under a regular microscope to observe the fluorescence expression (GFP) of the CAR T cells.
[0018] As described in the preparation method above, in step 4), when the number of T cells transfected with lentivirus accounts for 80-90% of the culture flask, the cells are collected and the medium is changed. Complete culture medium with IL-2 at a final concentration of 100 U / mL is added for amplification culture, and the infected cells are identified by flow cytometry.
[0019] The preparation method described above is characterized in that the cells are prepared using a lentiviral method.
[0020] Such as the application of CAR T cells that secrete CTLA-4 nanobodies and target FAP in the preparation of tumor therapeutic agents.
[0021] As described above, preferably, the tumor refers to an FAP-positive tumor.
[0022] A pharmaceutical composition comprising CAR T cells that secrete CTLA-4 nanobody targeting FAP as described in this invention and a pharmaceutically acceptable carrier.
[0023] A nucleotide sequence encoding a chimeric antigen receptor, wherein the chimeric antigen receptor is FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP, and the chimeric antigen receptor is composed of an extracellular antigen recognition region FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4VHH, and a GFP fluorescent protein tandemly. The nucleotide sequence is further shown in SEQ ID NO.1 of the sequence listing. The nucleotide sequence of the extracellular antigen recognition region FAP VHH is shown in SEQ ID NO.2, the nucleotide sequence of CTLA-4VHH is shown in SEQ ID NO.3, and the tag protein HIS-tag is shown in SEQ ID NO.4.
[0024] A chimeric antigen receptor, wherein the chimeric antigen receptor is FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP, the chimeric antigen receptor being composed of an extracellular antigen recognition region FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4VHH, and a GFP fluorescent protein tandemly. The chimeric antigen receptor is further encoded by a nucleotide sequence as shown in SEQ ID NO.1 of the sequence listing. The nucleotide sequence of the extracellular antigen recognition region FAP VHH is shown in SEQ ID NO.2, the nucleotide sequence of CTLA-4VHH is shown in SEQ ID NO.3, and the tag protein HIS-tag is shown in SEQ ID NO.4.
[0025] The researchers of this invention discovered that in immunotherapy for FAP-positive tumors, CAR T cells secreting CTLA-4 nanobodies targeting FAP have the advantage of enhanced specific targeting, namely, enhanced immune cell recognition of tumor antigens. Furthermore, they enhance chimeric antigen receptor-dependent tumor-killing activity and infiltration at the tumor site after infusion, while reducing T cell exhaustion. These characteristics of FAP-CTLA-4 / Nb CAR T cells stem from the functional structure of the chimeric antigen receptor, which mainly includes an antigen recognition region and an intracellular activation region. The intracellular activation region prolongs cell survival time in vivo. In addition, this invention uses lentiviral infection to prepare CAR T cells, providing a highly efficient method for preparing FAP-CTLA-4 / Nb CAR T cells. CAR T cells prepared by this method stably express the chimeric antigen receptor and have promising application prospects. Attached Figure Description
[0026] Figure 1 This is a gel electrophoresis image of the FAP-CTLA-4 / Nb CAR gene sequence synthesized by PCR in Example 2 of the present invention.
[0027] Figure 2 This is a schematic diagram of the recombinant lentivirus vector in Embodiment 3 of the present invention.
[0028] Figure 3 This is a PCR identification diagram of DH5α positive clone colonies in Example 3 of the present invention.
[0029] Figure 4 This demonstrates the RT-PCR method used in Example 4 of the present invention to identify the expression of FAP-CTLA-4 / Nb CAR in cells.
[0030] Figure 5 This illustrates the packaging and titer detection of the recombinant lentiviral vector in Example 4 of the present invention.
[0031] Figure 6 The T-cell lentivirus transfection in Example 5 of this invention shows the expression of GFP fluorescence.
[0032] Figure 7 This illustrates the expression of CAR after T-cell lentiviral transfection in Example 5 of the present invention.
[0033] Figure 8 This illustrates the secretion of CTLA nanobodies by T cells after lentiviral transfection in Example 5 of the present invention. The bars in the bar chart, from left to right, represent Utd, MOCK, and FAP-CTLA-4 / Nb CAR T.
[0034] Figure 9This invention demonstrates, in Example 6, the specific killing of FAP-CTLA-4 / Nb CAR-T cells by FAP-CTLA-4 / Nb CAR-T, wherein... Figure 9 a. Expression of FAP on the surface of target cells in each group Figure 9 b represents FAP-CTLA-4 / Nb CAR-T specific killing of U87. Figure 9 c represents FAP-CTLA-4 / Nb CAR-T specific killing of HepG2-FAP. Figure 9 d represents FAP-CTLA-4 / Nb CAR-T specific killing of HepG2. Detailed Implementation
[0035] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.
[0036] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0037] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0038] Example 1: Preparation and Activation of T Cells
[0039] (1) Density gradient centrifugation method for separating peripheral blood T lymphocytes
[0040] Fresh peripheral blood was collected from healthy volunteers using blood collection tubes containing anticoagulant. An equal volume of peripheral blood was mixed with PBS at 37°C, and peripheral blood T lymphocytes were separated using density gradient centrifugation. 4 ml of sterile lymphocyte separation medium at 37°C was transferred to a 15 ml centrifuge tube, and 8 ml of diluted peripheral blood was slowly added along the tube wall to the surface of the separation medium. The tube was centrifuged at 2000 rpm for 20 min. After centrifugation, four layers were observed in the tube. The cloud-like white membrane layer of cells (PBMCs) was carefully aspirated from the edge of the centrifuge tube using a Pasteur tube, and the cell suspension was collected into a sterile 50 ml centrifuge tube. Four volumes of PBS were added, and the cells were washed twice. The collected PBMCs were resuspended in complete cell culture medium RIPM 1640 and transferred to cell culture dishes. The cells were cultured at 37°C for 2 h. The suspended cells were then transferred to another culture dish for further culture; these suspended cells were T lymphocytes. T lymphocytes were cultured in complete RIPM 1640 medium containing 100 U / ml rhIL-2.
[0041] (2) Culture of T cells
[0042] T cells were cultured for 24 hours in a special T cell culture medium containing human CD3, human CD28 monoclonal antibodies, and human IL-2 cytokine.
[0043] Example 2: Synthesis of FAP-CTLA-4 / Nb CAR gene sequence by PCR
[0044] After preparing the reaction system as follows, gently mix the mixture by pipetting and centrifuging for 35 seconds. Then, place the mixture in a PCR instrument for reaction to obtain the band of the target fragment. Figure 1 As shown.
[0045] Table 1 Primers
[0046] Primers Sequence 5'-3' CART(43241-22)-P1 AGGTCGACTCTAGAGGATCCCGCCACC CART(43241-22)-P2 ATAAGCTTGATATCGAATTCTTACTTGTACAGCTCGTCCATGCCGAG
[0047] The nucleotide sequence of primer CART(43241-22)-P1 is shown in SEQ ID NO.5, and the nucleotide sequence of primer CART(43241-22)-P2 is shown in SEQ ID NO.6.
[0048] Table 2 Reaction System
[0049]
[0050]
[0051] Table 3 Reaction conditions
[0052]
[0053] Example 3 Construction of recombinant lentiviral vector
[0054] The GV400 vector was digested using a double enzyme digestion method. Agarose gel electrophoresis after digestion showed that the molecular weight of the lentiviral vector plasmid was approximately 8 kDa, with clear bands. The digested lentiviral vector was then recombined with the CAR target sequence obtained by PCR in Example 2 to obtain a recombinant lentiviral vector, as shown below. Figure 2 As shown. The recombinant lentiviral vector was transformed into DH5α Escherichia coli. Colonies screened with ampicillin were identified by PCR using primers from the lentiviral vector and the target gene. The PCR products were electrophoresed as shown in the figure. Figure 3 The groups are represented as follows: ddH2O: double-distilled water; empty vector self-ligation: empty vector without the target sequence; GAPDH: internal reference; P1: plasmid containing the target sequence; P2: plasmid containing the target sequence.
[0055] As shown, the lentiviral recombinant vector plasmid containing the target CAR sequence was successfully constructed. Sequencing of the positive clones confirmed that the sequence was completely identical to the target sequence.
[0056] Example 4 Lentiviral Packaging
[0057] The successfully sequenced recombinant positive clones were used to extract plasmids using the Plasmid Mini Kit and transfected into 293T cells. The expression of the FAP-CTLA-4 / Nb CAR gene sequence in 293T cells was quantitatively analyzed using a Real-time Quantitative PCR Detecting System. Figure 4 As shown, the expression level of the CAR gene sequence in the transfected group was 219332.857 times that in the untransfected group, indicating that the FAP-CTLA-4 / Nb CAR gene sequence was normally expressed in cells. Using a three-plasmid system, the recombinant lentiviral vector containing the CAR sequence was co-transfected into 293T cells using two helper vector plasmids (Helper 1.0 and Helper 2.0). After 48 hours, obvious green fluorescence (GFP) was observed in the cells under a fluorescence microscope. The supernatant of the 293T cells was collected, concentrated, purified, and the viral concentration was determined using a fluorescent dilution method. The number of GFP-positive cells was counted, and the viral titer was calculated using the formula: Virus concentration = Number of fluorescent cells / Volume of original virus solution in the well. Figure 5 As shown.
[0058] Example 5: Construction of CAR T cells secreting CTLA-4 nanobody targeting FAP (FAP-CTLA-4 / Nb CAR T)
[0059] (1) Lentiviral method for infecting T lymphocytes: T cells were seeded into 24-well plates, and the cell density in each well was adjusted to 1×10⁶ cells / well. 7 T cells were cultured for 24 hours in a medium containing 10% FBS, human CD3 monoclonal antibody, human CD28 monoclonal antibody, and human IL-2 cytokine. Lentiviral virus was then added to the stimulated T cells at an MOI of 20. GFP expression was observed under a fluorescence microscope after 48 hours. Figure 6 As shown. These include lentivirally transfected FAP-CTLA-4 / Nb CAR T cells, CAR T cells without extracellular recognition receptors (Mock), and untransfected T cells (Utd as a negative control).
[0060] (2) Flow cytometry detection of CAR expression of secreted CTLA-4 nanobody targeting FAP in T cells
[0061] Collect 1×10 6 Lentivirally transfected FAP-CTLA-4 / Nb CAR T cells, CAR T cells without extracellular recognition receptors (Mock), and untransfected T cells (Utd as a negative control) were treated with PE-anti-6X His. The antibody was incubated in the dark, washed three times with PBS, and the expression of HIS-TAG and GFP fluorescent proteins on the surface of CAR T cells in each group was simultaneously detected by flow cytometry. The results showed that the chimeric antigen receptor was expressed in T cells, such as... Figure 7 As shown.
[0062] (3) ELISA detection of CTLA-4 nanobody secretion by CAR targeting FAP.
[0063] The CTLA-4 nanobodies secreted by FAP-CTLA-4 / Nb CAR T cells were labeled with HIS-TAG. The HIS-TAG content in the culture supernatant of CAR T cells from each group was detected by ELISA to determine the secretion of the CTLA-4 nanobodies. 1×10⁻⁶ cells were collected from each group. 6 The following steps were taken to transfect FAP-CTLA-4 / Nb CAR T cells and CAR T cells without extracellular recognition receptors (Mock) with lentiviral transfection and transfected T cells Utd as a negative control:
[0064] a. Prepare standard products as required, with a maximum concentration of 200 pg / mL.
[0065] b. Soaking the microplate: Take out the strips to be used, add 300 μL of washing buffer to each well, let it stand for 30 seconds, and pat it dry on absorbent paper.
[0066] c. Sample addition: Add 200 μL of standard to the standard wells and 100 μL of cell culture medium to the blank wells. Add 100 μL of cell supernatant to each sample well.
[0067] d. Add detection antibody: Add 50 μL of diluted antibody to each well, and try to ensure that the sample and detection antibody are added within 15 minutes.
[0068] e. Incubation: After sealing with a sealing film, incubate at room temperature with shaking at 300 rpm for 2 hours.
[0069] f. Washing: Discard the liquid in the well, add 300 μL of 1× washing solution, let stand for 1 min, and discard the liquid in the well. Then pat dry thoroughly on absorbent paper. Wash 6 times.
[0070] g. Add horseradish peroxidase: Add 100 μL of horseradish peroxidase-labeled streptavidin working solution to each well.
[0071] h. Incubation: Seal the plate using a new sealing film. Incubate at room temperature with shaking at 300 rpm for 45 min.
[0072] i. Add substrate for color development: Add 100 μL of TMB working solution as a color development substrate to each well and incubate in the dark for 30 min.
[0073] j. Add stop solution: Add 100 μL of stop solution to each well. At this point, the liquid in the well will change from blue to yellow; mix thoroughly.
[0074] k. Result Detection: Within 30 minutes, a dual-wavelength detection was performed using a microplate reader to measure the maximum absorption wavelength at 450 nm and analyze the data. The results are as follows: Figure 8 As shown.
[0075] Example 6: Cytotoxicity analysis of the killing effect of FAP-CTLA-4 / Nb CAR T cells on human tumor cells
[0076] HepG-FAP, HepG2, and U87 liver cancer cells were stained with PKH26. FAP-CTLA-4 / Nb CAR T cells prepared in Example 5 and T cells cultured in Example 1 were added to 24-well plates at effector-to-target ratios (E:T) of 1:1, 5:1, and 10:1, respectively. After culturing for 16 hours, the cells were collected, PI staining solution was added, and the cells were incubated at 4°C in the dark for 30 minutes. The cells were then centrifuged at 1200 rpm for 6 minutes, the supernatant was discarded, and 500 μl of PBS was added to resuspend the cells. PKH26+PI+ cells were considered dead cells. The proportion of PKH26+PI+ cells was detected by flow cytometry, and the killing efficiency of CAR T cells against different cell types was calculated using the formula: Killing rate = 100% × (experimental well apoptosis rate - spontaneous release well apoptosis rate) / (100 - spontaneous release well apoptosis rate). Spontaneous release wells represent target cells without effector cells. Figure 9 As shown, FAP-CTLA-4 / Nb CAR T cells have specific killing activity against tumor cells that highly express FAP.
[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. SEQUENCE LISTING <110> Guangxi Medical University <120> A novel method for preparing and applying CTLA-4 secreted nanobody-targeted FAP-based CAR T cells <130> GY21100730 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 3034 <212> DNA <213> Artificial sequence <400> 1 gaagcttggg ctgcaggtcg actctagagg atcccgccac catggcctta ccagtgaccg 60 ccttgctcct gccgctggcc ttgctgctcc acgccgccag gccgcaggtg cagctgcagg 120 agtctggagg aggcttggag gagcctgggg ggtctctgag actctcctgt gcagcctctg 180 gattcgcctt cagtagcacc atcatgacct gggtccgcca ggctccaggg aaggggctcg 240 agtgggtctc atatatatat cctgatggta ctgtcgtagg ttatgcagac tccgtgaagg 300 ggcgcttcac cattttcaga gacaacgcca agaaaacgct gtatctacaa atgaacatgc 360 tgaaaactga ggacactgcc gtgtattact gcgccacagg gaccccccct ttggctttac 420 gtgaggacgg ctcaaggggc caggggaccc aggtcaccgt ctcctcacat catcaccatc 480 accataccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc gcgtcgcagc 540 ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg cacacgaggg 600 ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact tgtggggtcc 660 ttctcctgtc actggttatc accctttact gcaaacgggg cagaaagaaa ctcctgtata 720 tattcaaaca accatttatg agaccagtac aaactactca agaggaagat ggctgtagct 780 gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc agcaggagcg 840 cagacgcccc cgcgtacaag cagggccaga accagctcta taacgagctc aatctaggac 900 gaagagagga gtacgatgtt ttggacaaga gacgtggccg ggaccctgag atggggggaa 960 agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa gataagatgg 1020 cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag gggcacgatg 1080 gccttacca gggtctcagt acagccacca aggacaccta cgacgccctt cacatgcagg 1140 ccctgccccc tcgcggcagc ggcgccacca acttcagcct gctgaagcag gccggtgacg 1200 tggaggagaa tcccggccct atggccttac cagtgaccgc cttgctcctg ccgctggcct 1260 tgctgctcca cgccgccagg ccgcaggtgc agctgcagga gtctggggga ggctcggtgc 1320 aggctgggg gtctctaaga ctctcctgta cagcctctgg attcggtgtt gatggcactg 1380 acatgggctg gtaccgccag gctccaggga atgagtgcga gttggtctca agtattagca 1440 gtattggtat tggatactat tcagagtccg tgaagggccg attcaccatc tcccgagaca 1500 acgccaagaa cacggtgtat ctgcaaatga acagcctgag acctgacgac acggccgtgt 1560 attactgcgg tagacgatgg attgggtacc gatgtggtaa ctggggccgg gggacccagg 1620 tcaccgtctc ctcacatcat caccatcacc attaaagcgg ccgcgactct agaattcgcc 1680 cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg 1740 cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga 1800 aacctggccc tgtcttcttg akgagcattc ctaggggtct ttcccctctc gccaaaggaa 1860 tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa 1920 caacgtctgt agcgaccctt tgcaggcagc ggaacccccc acctggcgac aggtgcctct 1980 gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg 2040 ttgtgagttg gatagttgtg gaagagtca aatggctctc ctcaagcgta ttcaacaagg 2100 ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtaca 2160 catgctttac atgtgtttag tcgaggttaa aaaaacgtct aggccccccg aaccacgggg 2220 acgtggtttt cctttgaaaa acacgatgat aatatggcca cagttaacat ggtgagcaag 2280 ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg agctggacgg cgacgtaaac 2340 ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg ccacctacgg caagctgacc 2400 ctgaagttca tctgcaccac cggcaagctg cccgtgccct ggcccaccct cgtgaccacc 2460 ctgacctacg gcgtgcagtg cttcagccgc taccccgacc acatgaagca gcacgacttc 2520 ttcaagtccg ccatgcccga aggctacgtc caggagcgca ccatcttctt caaggacgacgac 2580 ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg acaccctggt gaaccgcatc 2640 gagctgaagg gcatcgactt caaggagcac ggcaacatcc tggggcacaa gctggagtac 2700 2760 aacttcaaga tccgccacaa catcgaggac ggcagcgtgc agctcgccga ccactaccag 2820 cagaacaccc ccatcggcga cggccccgtg ctgctgcccg acaaccacta cctgagcacc 2880 cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc acatggtcct gctggagttc 2940 gtgaccgccg ccgggatcac tctcggcatg gacgagctgt acaagtaaga attcgatatc 3000 aagcttatcg ataatcaacc tctggattac aaaa 3034 <210> 2 <211> 363 <212> DNA <213> Artificial sequence <400> 2 caggtgcagc tgcaggagtc tggaggaggc ttggaggagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggatt cgccttcagt agcaccatca tgacctgggt ccgccaggct 120 ccagggaagg ggctcgagtg ggtctcatat atatatcctg atggtactgt cgtaggttat 180 gcagactccg tgaaggggcg cttcaccatt ttcagagaca acgccaagaa aacgctgtat 240 ctacaaatga acatgctgaa aactgaggac actgccgtgt attactgcgc cacagggacc 300 ccccctttgg ctttacgtga ggacggctca aggggccagg ggacccaggt caccgtctcc 360 tca 363 <210> 3 <211> 369 <212> DNA <213> Artificial sequence <400> 3 caggtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggggggtc tctaagactc 60 tcctgtacag cctctggatt cggtgttgat ggcactgaca tgggctggta ccgccaggct 120 ccagggaatg agtgcgagtt ggtctcaagt attagcagta ttggtattgg atactattca 180 gagtccgtga agggccgatt caccatctcc cgagacaacg ccaagaacac ggtgtatctg 240 caaatgaaca gcctgagacc tgacgacacg gccgtgtatt actgcggtag acgatggatt 300 gggtaccgat gtggtaactg gggccggggg acccaggtca ccgtctcctc acatcatcac 360 catcaccat 369 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <400> 4 catcatcacc atcaccat 18 <210> 5 <211> 27 <212> DNA <213> Artificial sequence <400> 5 aggtcgactc tagaggatcc cgccacc 27 <210> 6 <211> 47 <212> DNA <213> Artificial sequence <400> 6 ataagcttga tatcgaattc ttacttgtac agctcgtcca tgccgag 47
Claims
1. A CAR T cell that secretes CTLA-4 nanobodies to target FAP, characterized in that... The CAR T cells express the chimeric antigen receptor FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4 VHH-GFP. The chimeric antigen receptor is composed of an extracellular antigen recognition region FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4 VHH, and a GFP fluorescent protein tandemly. The nucleotide sequence of the chimeric antigen receptor FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4 VHH-GFP is shown in SEQ ID NO.
1.
2. A method for preparing CAR T cells as described in claim 1, characterized in that... This method includes the following steps: designing a CAR target sequence; obtaining the CAR target sequence fragment FAP / Nb-HIStag-CD8-CD137(4-1BB)-CD3ζ-2A-CTLA-4Nb-IRES-GFP by PCR; recombining the enzyme-digested lentiviral vector GV400 with the CAR target sequence obtained by PCR; transforming the recombinant lentiviral vector into DH5α Escherichia coli and screening for positive clones; sequencing the positive clones to verify whether a lentiviral vector containing the FAP-CTLA-4 / Nb CAR sequence has been successfully constructed; extracting plasmids from the successfully sequenced recombinant positive clones; transfecting 293T cells; identifying the expression of the FAP-CTLA-4 / Nb CAR sequence in cells by RT-PCR; verifying that the recombinant lentiviral vector can express normally; packaging lentivirus using a three-plasmid system; detecting the titer; and constructing CAR T cells using lentiviral infection technology to express the chimeric antigen receptor.
3. A method for preparing CAR T cells as described in claim 2, characterized in that... The method includes the following steps: (1) Construction of recombinant lentiviral vector containing target CAR sequence: The CAR target sequence fragment of FAP / Nb-HIStag-CD8-CD137(4-1BB)-CD3ζ-2A-CTLA-4Nb-IRES-GFP was obtained by PCR and the synthesized fragment was subcloned into the lentiviral vector GV400 after double digestion with BamHI / EcoRI. The recombinant lentiviral vector was transformed into DH5α Escherichia coli. The colonies screened by ampicillin were identified by PCR using primers on the lentiviral vector and primers on the target gene. The successfully identified bacterial solutions were sequenced. Plasmids were extracted using Plasmid Mini Kit after successful sequencing. (2) Lentiviral packaging: A three-plasmid system was used to co-transfect 293T cells with a recombinant lentiviral vector containing the CAR sequence through two helper vector plasmids Helper 1.0 and Helper 2.
0. After 48 hours, the expression of green fluorescent protein in the cells was observed under a fluorescence microscope. If the cells successfully expressed fluorescence, the supernatant of the 293T cells was collected, concentrated and purified, and the virus concentration was determined by the fluorescence dilution method. The number of green fluorescent protein positive cells was counted, and the virus titer was calculated according to the formula: virus concentration = number of fluorescent cells / volume of the original virus solution in the well. (3) T cell preparation: Isolate peripheral blood mononuclear cells and culture them to obtain T cells; (4) Preparation of FAP-CTLA-4 / Nb CAR T cells: T cells were cultured for 24 hours in a special T cell culture medium containing human CD3 monoclonal antibody, human CD28 monoclonal antibody and human IL-2 cytokine. The next day, lentivirus solution was added to the T cells after stimulation according to MOI 20. The cells were cultured in a CO2 incubator at 37℃ for 48 h. The CAR T cells were placed under a regular microscope to observe the expression of green fluorescent protein in the CAR cells.
4. The use of CAR T cells secreting CTLA-4 nanobody targeting FAP as described in claim 1 in the preparation of a liver cancer treatment agent.
5. A pharmaceutical composition comprising CAR T cells that secrete CTLA-4 nanobody targeting FAP as described in claim 1 and a pharmaceutically acceptable carrier.
6. A nucleic acid encoding a chimeric antigen receptor, wherein the chimeric antigen receptor is FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4 VHH-GFP, wherein the chimeric antigen receptor is composed of an extracellular antigen recognition region FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4 VHH, and a GFP fluorescent protein tandemly, and the nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.
1.
7. A chimeric antigen receptor, wherein the chimeric antigen receptor is FAP VHH-HIStag-CD8-CD137-CD3ζ-CTLA-4VHH-GFP, wherein the chimeric antigen receptor is composed of an extracellular antigen recognition region FAP VHH, a tag protein HIS-tag, a hinge region CD8, a transmembrane region CD8, an intracellular co-stimulatory domain CD137, an intracellular signal transduction domain CD3ζ, CTLA-4 VHH, and a GFP fluorescent protein tandemly, and the nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1.