Construction of a method for detecting sulfate-reducing bacteria metabolic enzyme function genes

Abstract

The present application relates to a kind of functional gene detection method, specifically sulfate-reducing bacteria metabolic enzyme functional gene detection method.The specific sequence of three different hairpin DNA chains is designed according to the specificity of sulfate-reducing bacteria metabolic enzyme, after mixing three different hairpin DNA chains, incubation is carried out by adding the sample to be detected, after incubation, hemin, TMB and H2O2 are added to the system to react, and the key metabolic enzyme DNA of sulfate-reducing bacteria in the sample to be measured is qualitatively / quantitatively detected by color reaction.The preparation method of the present application is simple to operate, and the reaction is rapid, and visible to naked eye.The construction of sulfate-reducing bacteria metabolic enzyme functional gene detection method has potential application value in the research fields of molecular biology, biological analytical chemistry and medical detection.

Description

TECHNICAL FIELD

[0001] The present application relates to a functional gene detection method, in particular a sulfate-reducing bacteria metabolic enzyme functional gene detection method. BACKGROUND

[0002] Sulfate-reducing bacteria are the most widely studied bacteria in marine corrosive microorganisms. Under anaerobic conditions, the main process is dissimilatory sulfate reduction (forming H2S) or assimilatory reduction (forming organic sulfides).

[0003] The dissimilatory sulfate reduction process is a complex biochemical reaction, and its essence is an electron transfer process catalyzed and mediated by various protein components of microorganisms (such as Dsr, Qmo, Hmc, Tmc, Qrc, Nuo, and Rnf). As a stable chemical component, SO4 2- First, under the action of ATP sulfurylase and APS reductase (Apr), electrons are converted into SO3 2- , and then under the catalysis of dissimilatory sulfite reductase (Dsr), a series of electron transfer processes are carried out to finally reduce S 2- [1]. Dissimilatory sulfite reductase (Dsr) is one of the most critical functional proteins in the sulfate reduction process, composed of α2β2 structure, and the two subunits are respectively encoded by adjacent dsrA and dsrB genes. The dsr operon contains various coding genes, i.e. dsrABEFHCMKLJOPNRS, which can characterize different functional protein components. Among these gene products, the DsrAB protein complex is an indispensable functional substance in the sulfur cycle metabolic pathway, not only a key enzyme catalyzing the dissimilatory sulfite reduction process, but also an important participant in the sulfide oxidation process [7]. Other protein substances, such as DsrC, can act as redox centers to regulate the sulfur metabolism process, assist DsrAB to play a related role, and mediate the DsrMKJOP protein complex to perform similar functional characteristics to DsrAB [6, 8]. The dsr gene is quite conservative in the same group of sulfate-reducing bacteria, but there are great differences in different groups of sulfate-reducing bacteria [2-4]. NERETIN et al. [5] found through pure culture experiments that the mRNA level of dsrAB gene in sulfate-reducing microorganisms increases with the increase of sulfate reduction rate, which indicates that the sulfate reduction rate in the environment can be evaluated from the dsr transcription level. Therefore, as the most widely used key molecular marker for tracking functional microorganisms involved in regulating the sulfur cycle, the dsr gene plays an important role in studying the microbial community structure and functional characteristics of sulfate-reducing bacteria.

[0004] Therefore, it is extremely important to construct a method that can detect functional genes, which will have a good application prospect in medical detection, microbial community analysis and biochemical analysis.

[0005] [1] M, L, KUBE M, et al. Genome and catabolic subproteomes of the marine, nutritionally versatile, sulfate-reducing bacterium Desulfococcus multivorans DSM 2059. BMC Genomics, 2016, 17: 918.

[0006] [2] J R, YOUNG L Y, KERKHOF L J. Molecular characterization of sulfate-reducing bacteria in anaerobic hydrocarbon-degrading consortia and pure cultures using the dissimilatory sulfite reductase (dsrAB) genes. FEMS Microbiology Ecology, 2001, 35(2): 145-150.

[0007] [3] WAGNER M, ROGER A J, FLAX J L, et al. Phylogeny of dissimilatory sulfite reductases supports, an early origin of sulfate respiration. Journal of Bacteriology, 1998, 180(11): 2975-2982.

[0008] [4] CHIN K J, SHARMA M L, RUSSELL L A, et al. Quantifying expression of a dissimilatory (bi)sulfite reductase gene in petroleum-contaminated marine harbor sediments. Microbial Ecology, 2008, 55(3): 489-499.

[0009] [5] NERETIN LN, SCHIPPERS A, PERNTHALER A, et al. Quantification of dissimilatory (bi)sulphite reductase gene expression in Desulfobacterium autotrophicum using real-time RT-PCR. Environmental Microbiology, 2003, 5(8): 660-671.

[0010] [6] GHOSH S, BAGCHI A. Comparative analysis of the mechanisms of sulfuranion oxidation and reduction by dsr operon to maintain environmental sulfur balance. Computational Biology and Chemistry, 2015, 59: 177-184.

[0011] [7] LOY A, DULLER S, BARANYI C, et al. Reverse dissimilatory sulfite reductase as phylogenetic marker for a subgroup of sulfur-oxidizing prokaryotes. Environmental Microbiology, 2009, 11(2): 289-299.

[0012] [8] VENCESLAU SS, STOCKDREHER Y, DAHL C, et al. The "bacterial heterodisulfide" DsrC is a key protein in dissimilatory sulfur metabolism. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 2014, 1837(7): 1148-1164. SUMMARY

[0013] The present application aims to provide a sulfate-reducing bacteria metabolic enzyme function gene detection method.

[0014] To achieve the above object, the technical scheme adopted by the present application is:

[0015] A construction method for detecting sulfate-reducing bacteria metabolic enzyme function genes, three different hairpin DNA chains are designed according to the specificity sequence of the metabolic enzyme of sulfate-reducing bacteria, the three different hairpin DNA chains are mixed and then added to the sample to be detected for incubation, after incubation, hemin, TMB and H2O2 are added to the system for reaction, and the key metabolic enzyme DNA of sulfate-reducing bacteria in the sample to be detected is qualitatively / quantitatively detected through color reaction.

[0016] The key metabolic enzyme DNA of sulfate-reducing bacteria in the sample to be detected can open the three different hairpin DNA chains (hairpin probe P1, hairpin probe P2, and hairpin probe P3) at the same time, form a rigid DNA triangular structure probe, and perform color reaction under the action of hemin, TMB and H2O2.

[0017] The final concentration of hemin in the system is 2.5 μM, the final concentration of TMB is 0.5% (w / v), and the final concentration of H2O2 is 30% (w / v).

[0018] The concentration of the three hairpin probes P1, P2 and P3 is 1×10 -5 M; the volume ratio of the sample to be detected and the three hairpin probes P1, P2 and P3 in the reaction incubation system is 1:2:2:2.

[0019] After incubation, a buffer system containing hemin is added, the buffer system is a 20 mM Tris-HCl buffer solution (pH=8.0, 2.5 μM hemin, 50 mM NaCl, 25 mM KCl, 10 mM MgCl2, 0.03% Triton X-100, and 1% DMSO), and the mixture is reacted at room temperature for 30-45 min.

[0020] The sequence of the hairpin probe P1 is:

[0021] TGGGTAGGGCGGGTCGTTGAACCCATAGTGAGTGGGTGCAATTCCGTTTTTCTCATAGTAGCTCACTATGGGT;

[0022] The sequence of the hairpin probe P2 is:

[0023] TGGGTAGGGCGGGTAGTGAGACCCATGTCTTGTCCTGAAGAACGTTAACCACTTTCCAGTGCAAGACATGGGT;

[0024] The sequence of the hairpin probe P3 is:

[0025] TGGGTAGGGCGGGTGTCTTGACCCATCGTTGACTCGTAGTTCATCTCATCGATGCCTTCTTTCAACGATGGGT.

[0026] The above hairpin DNA strand is added to ultrapure water to form a DNA solution, heated at 95℃ for 10min, and gradually cooled to room temperature; the DNA solution of P1, P2 and P3 of the treated hairpin DNA strand is taken respectively, and the sample solution to be detected is added, and incubated at room temperature for 90min; after incubation, 10μL of 20mM Tris-HCl buffer solution (pH=8.0, 2.5μM hemin, 50mM NaCl, 25mM KCl, 10mM MgCl2, 0.03% Triton X-100, and 1% DMSO) is added to the incubation system, and mixed at room temperature for 30-45min to form hemin / G-quadruplex; then 950μL of TMB-H2O2 solution (10μL of 0.5% (w / v) TMB, 20μL of 30% (w / v) H2O2, and 920μL of substrate buffer solution) is added, and mixed at room temperature for 10-20min to qualitatively / quantitatively detect (then the colorimetric response of the sensor is observed by naked eye, and a mobile phone is used to take a picture. At the same time, the absorbance of the solution in the wavelength range of 500-800nm is recorded by an enzyme marker).

[0027] The present application has the following advantages:

[0028] The present application has the following advantages: BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 The present application has the following advantages:

[0030] Figure 2 The present application has the following advantages:

[0031] Figure 3 The present application has the following advantages:

[0032] Figure 4The method for detecting sulfate-reducing bacteria metabolic enzyme function gene provided by the embodiment of the application further optimizes the experimental conditions.

[0033] Figure 5 The specific effect diagram of the method for detecting sulfate-reducing bacteria metabolic enzyme function gene provided by the embodiment of the application. DETAILED DESCRIPTION

[0034] The application is further described below through examples.

[0035] Example 1

[0036] Reference Figure 1 The construction method of the sulfate-reducing bacteria metabolic enzyme function gene detection is as follows:

[0037] 1) According to the sulfate-reducing bacteria metabolic enzyme

[0038] The target sequence is synthesized by Shanghai Shengong through gene bank screening and subsequent design of fragments, and then three hairpin probes are designed to be partially paired with the target and carry a sequence capable of forming a G-quadruplex with hemin at the tail, and then synthesized by Shanghai Shengong.

[0039] The target sequence is a single-stranded structure with a length of 87p.

[0040] The card-shaped DNA fragment is three hairpin probes P1, P2 and P3, and the lengths of P1, P2 and P3 are 73bp, 73bp and 73bp respectively (see Figure 2 ).

[0041] The target (sulfate-reducing bacteria metabolic enzyme function gene contained in the sample to be detected) can simultaneously open the hairpin probes P1, P2 and P3 to form a DNA triangular structure.

[0042] The target and the three hairpin probes P1, P2 and P3 have the following specific sequences:

[0043] The sequence of the target is as follows:

[0044] AAGAAGGCATCGATGAGATGAACGACGAGCACTGGAAAGTGGTTAACGTTCTTCAGGACTACTATGAGAAAAACGGAATTGCACCCA;

[0045] The sequence of the hairpin probe P1 is as follows:

[0046] TGGGTAGGGCGGGTCGTTGAACCCATAGTGAGTGGGTGCAATTCCGTTTTTCTCATAGTAGCTCACTATGGGT;

[0047] The sequence of the hairpin probe P2 is:

[0048] TGGGTAGGGCGGGTAGTGAGACCCATGTCTTGTCCTGAAGAACGTTAACCACTTTCCAGTGCAAGACATGGGT;

[0049] The sequence of the hairpin probe P3 is:

[0050] TGGGTAGGGCGGGTGTCTTGACCCATCGTTGACTCGTAGTTCATCTCATCGATGCCTTCTTTCAACGATGGGT.

[0051] 2) The hairpin DNA and target sequence were added to ultrapure water to form a DNA solution, heated at 95℃ for 10 min (the concentration of P1, P2 and P3 in the DNA solution was 1×10 -5 M, and the target sequence solution was 1×10 -9 M), and gradually cooled to room temperature. Then 10 μL of each of the hairpin DNA (P1, P2 and P3) was taken, and 5 μL of the target sequence was added, and incubated at room temperature for 90 min. After incubation, 10 μL of 20 mM Tris-HCl buffer solution (pH = 8.0, 2.5 μM hemin, 50 mM NaCl, 25 mM KCl, 10 mM MgCl2, 0.03% Triton X-100, and 1% DMSO) was added to the system, and the reaction was mixed at room temperature for 40 min to form hemin / G-quadruplex. Then 950 μL of TMB-H2O2 solution was added (10 μL of 0.5% (w / v) TMB, 20 μL of 30% (w / v) H2O2, and 920 μL of substrate buffer solution (ultrapure water added with 26.6 mM citric acid, 51.4 mM disodium hydrogen phosphate, and 25 mM potassium chloride, pH = 5.0)). The reaction was carried out at room temperature for 15 min, after which the colorimetric response of the sensor was observed with the naked eye, and a photograph was taken with a mobile phone. At the same time, the absorbance of the solution was recorded in the wavelength range of 500-800 nm with an enzyme marker.

[0052] Example 2

[0053] 5 μL of each of the above-obtained hairpin probes P1, P2 and P3 with a concentration of 1×10 -5 M and 10 μL of target sequence solutions with different concentrations (5×10 -9 M, 1×10 -9 M, 5×10 -10 M, 1×10 -10 M, 5×10 -11 M, 1×10-11 M,5x10 - 12 M,1x10 -12 M,5x10 -13 M,1x10 -13 M,1x10

[0054] After adding 10 μL of 20 mM Tris-HCl buffer solution (pH = 8.0, 2.5 μM hemin, 50 mM NaCl, 25 mM KCl, 10 mM MgCl2, 0.03% Triton X-100, and 1% DMSO) and mixing at room temperature for 40 min, 950 μL of TMB-H2O2 solution (10 μL of 0.5% (w / v) TMB, 20 μL of 30% (w / v) H2O2, and 920 μL of substrate buffer solution (containing 26.6 mM citric acid, 51.4 mM disodium hydrogen phosphate, and 25 mM potassium chloride in ultrapure water, pH = 5.0) was added. After 15 min of reaction, the absorbance of each system was detected, and the results were used as the corresponding standard curve. The detection results are shown in Figure 3

[0055] With the increase of the concentration of the signal probe, the absorbance intensity of the system gradually increased, and the signal probe had good linearity and sensitivity with the hairpin probe.

[0056] Example 3

[0057] In order to improve the sensitivity and accuracy of the experiment, the amount of the hairpin system and the reaction time of the hairpin system were optimized, specifically:

[0058] (1) First, 1.0 x 10 -9 M target DNA was detected under the conditions of hairpin doses of 2 μL (a), 5 μL (b), 10 μL (c), and 12 μL (d). The trend is shown in the figure. However, after 10 μL, the fluorescence signal intensity of the sample began to decrease slightly. Therefore, 10 μL was selected as the optimal amount of the system.

[0059] (2) With 10 μL as the optimal amount of the hairpin system, the absorbance of 1.0 x 10 -9 M target DNA was detected under the conditions of reaction times of 30 min, 60 min, 90 min, 120 min, and 150 min. The results are shown in the figure. Figure 4 ​The absorbance of the sample increased gradually with time. But after 90 minutes, the absorbance of the sample began to decrease slightly. Therefore, 90 minutes was chosen as the optimal reaction time of the system.

[0060] Example 4

[0061] In order to verify the specificity of different metabolic functional genes in SRB, five different functional gene fragments were selected for absorbance detection.

[0062] According to the detection method for preparing the standard curve in Example 2, different targets were replaced by five different functional gene fragments (dissimilatory sulfite reductase alpha subunit (dsrA), dissimilatory adenosine phosphate reductase alpha subunit (aprA), dissimilatory sulfite reductase beta subunit (dsrB), dissimilatory adenosine sulfate reductase beta subunit (aprB), and dissimilatory adenosine phosphate reductase delta subunit (dsrD)) (see Figure 5 )

[0063] The experimental results are shown in the following figure. The absorbance values of dissimilatory sulfite reductase alpha subunit (dsrA), dissimilatory adenosine phosphate reductase alpha subunit (aprA), dissimilatory sulfite reductase beta subunit (dsrB), dissimilatory adenosine sulfate reductase beta subunit (aprB), and dissimilatory adenosine phosphate reductase delta subunit (dsrD) are roughly the same, which is 1 / 3 of the target absorbance value. Therefore, through the study of several different sequences, it is shown that the experiment has good selectivity for target DNA.

Claims

1. A method for constructing functional genes for detecting sulfate-reducing bacterial metabolic enzymes, characterized in that: Three different hairpin DNA strands were designed based on the specific sequences of sulfate-reducing bacteria metabolic enzymes. The three different hairpin DNA strands were mixed and added to the sample to be tested for incubation. After incubation, heme, TMB, and H2O2 were added to the system to carry out the reaction. The key metabolic enzyme DNA of sulfate-reducing bacteria in the sample was qualitatively / quantitatively detected by colorimetric reaction. The sequences of sulfate-reducing bacteria metabolic enzymes are as follows: AAGAAGGCATCGATGAGATGAACGACGAGCACTGGAAAGTGGTTTAACGTTCTTCAGGACTACTATGAGAAAAACGGAATTGCACCCA; The three different hairpin-shaped DNA strands are hairpin probe P1, hairpin probe P2, and hairpin probe P3; The sequence of the hairpin probe P1 is as follows: TGGGTAGGGCGGGTCGTTGAACCCATAGTGAGTGGGTGCAATTCCGTTTTTCTCATAGTAGCTCACTATGGGT; The sequence of hairpin probe P2 is as follows: TGGGTAGGGCGGGTAGTGAGACCCATGTCTTGTCCTGAAGAACGTTAACCACTTTCCAGTGCAAGACATGGGT; The sequence of hairpin probe P3 is as follows: TGGGTAGGGCGGGTGTCTTGACCCATCGTTGACTCGTAGTTCATCTCATCGATGCCTTCTTCAACGATGGGT.

2. The method for constructing functional genes for detecting sulfate-reducing bacterial metabolic enzymes according to claim 1, characterized in that: The sample to be tested contains the key metabolic enzyme DNA of sulfate-reducing bacteria, which can simultaneously open three different hairpin-shaped DNA strands to form a rigid DNA triangular structure probe, and undergo a colorimetric reaction under the action of heme, TMB, and H2O2.

3. The method for constructing functional genes for detecting sulfate-reducing bacterial metabolic enzymes according to claim 1 or 2, characterized in that: The concentrations of the three hairpin probes P1, P2, and P3 are all 1×10⁻⁶. -5 M; The volume ratio of the sample to be tested and the three hairpin probes P1, P2, and P3 in the reaction incubation system is 1:2:2:

2.

4. The method for constructing functional genes for detecting sulfate-reducing bacterial metabolic enzymes according to claim 1, characterized in that: After incubation, a buffer system containing heme was added. The buffer system consisted of 20 mM Tris-HCl buffer solution, pH 8.0, 2.5 µM hemin, 50 mM NaCl, 25 mM KCl, 10 mM MgCl2, 0.03% Triton X-100, and 1% DMSO. The mixture was then reacted at room temperature for 30-45 min.

5. The method for constructing functional genes for detecting sulfate-reducing bacterial metabolic enzymes according to claim 1, characterized in that: Hairpin-shaped DNA strands were added to ultrapure water to form a DNA solution, which was then heated at 95°C for 10 min and gradually cooled to room temperature. DNA solutions of the treated hairpin-shaped DNA strands (P1, P2, and P3) were taken separately and added to the sample solution to be tested. The solutions were incubated at room temperature for 90 min. After incubation, 10 µL of 20 mM Tris-HCl buffer solution (pH 8.0, 2.5 µM hemin, 50 mM NaCl, 25 mM KCl, 10 mM MgCl2, 0.03% Triton X-100, and 1% DMSO) was added to the incubation system. The mixture was reacted at room temperature for 30-45 min to form heme / G-tetramer. Subsequently, 950 µL of TMB-H2O2 solution was added, along with 10 µL of 0.5% w / v TMB and 20 µL of 30% w / v TMB. H2O2 and 920µL substrate buffer solution are mixed and reacted at room temperature for 10-20 min for qualitative / quantitative detection.

Images