Luminescent RNA aptamer combined with amplification and transcription system and DNA methylase activity detection method
Through the binding of luminescent RNA aptamer and a transcription system, combined with rolling loop amplification and RNA transcription, a high sensitivity detection of DNA methylase activity is achieved, solving the problems of high background and low sensitivity of the existing methods, and is suitable for DNA methylase activity detection in biomedical science.
Patent Information
- Application Number
- CN202211102140.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-09
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2042-09-09
AI Technical Summary
The existing DNA methylase activity detection methods have problems such as high background, unstable signal, complex pre-processing of markers or sample, making it difficult to achieve low background and high sensitivity detection.
The luminescent RNA aptamer binding amplification and transcription system is used to convert the DNA methylase activity signal into fluorescent signals through the cascade process of rolling loop amplification and RNA transcription. The binding of RNA fluorescent aptamer to dye molecules is used to achieve signal amplification, and the rolling loop amplification and RNA transcription triggered by magnetic beads/DNA surfaces can be combined to achieve specific and high-sensitivity detection.
It realizes high sensitivity detection of DNA methylase activity, with a linear range of 0.02-100U/mL, and the detection limit is as low as 0.0016U/mL. It is suitable for detection of trace DNA methyltransferase in complex systems and has important biomedical application value.
Smart Images

Figure CN116287150B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a luminescent RNA aptamer combined amplification and transcription system and a DNA methylase activity detection method. Background Art
[0002] DNA methylation is an epigenetic process involved in the regulation of gene expression in many important biological processes. It is selectively catalyzed by DNA methyltransferase (MTase), an enzyme that methylates the C-5 position of s-adenosyl-l-methionine (SAM) in cells. Most DNA methylation occurs in the trans-promoter region of cytosine-guanine dinucleotides (CpG), leading to transcriptional silencing of gene expression. Studies have shown that abnormal DNA methyltransferase activity is closely related to the occurrence and progression of major cancers. Therefore, inhibiting DNA methyltransferase activity can be used to block DNA methylation at an early stage to control the disease. Therefore, achieving highly sensitive detection of DNA methyltransferase activity is of great significance for biomedical research, clinical diagnosis, and cancer treatment.
[0003] Traditional DNA analysis methods are not suitable for monitoring DNA methyltransferase activity because they remove methylation signals. Currently, the commonly used methods for detecting DNA methyltransferases include radioisotope labeling, high-performance liquid chromatography (HPLC), surface-enhanced Raman spectroscopy (SERS), methylation-targeted polymerase chain reaction (PCR), electrochemistry, and fluorescence. However, the widespread use of these methods still has certain problems. Radiolabeling requires hazardous chemicals, electrochemistry and SERS methods have high background and unstable signals, HPLC requires complex sample pretreatment processes, PCR requires strict heating and cooling cycles, and fluorescence methods require fluorescent probe labeling. Due to the important role of methylation in biological systems, it is urgent to explore a low-background, label-free, and ultrasensitive method to evaluate DNA methyltransferase activity.
[0004] In 2011, S. Jaffrey's research group at Cornell University identified an RNA aptamer that specifically binds to the non-luminescent GFP chromophore, a small molecule called 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), emitting a GFP-like green fluorescence. This aptamer, ultimately named "Spanish" after the vegetable, opened the door to the development of fluorescent aptamers. Since then, RNA fluorescent aptamers have attracted widespread attention due to their high brightness, excellent programmability, low background, and small size. These aptamers consist of two components: an in vitro-selected RNA sequence and a corresponding binding dye. This aptamer-dye system has three key advantages. First, the dye is non-fluorescent in the free state; its fluorescence increases exponentially only upon binding to the RNA aptamer, resulting in high specificity and low background. Second, the fluorescence enhancement is based on the interaction between the RNA aptamer-dye pair and does not rely on complex genetic engineering of the target RNA or modification of DNA or RNA with the fluorescent dye. Third, RNA aptamers are highly programmable and retain their properties even after fusion with other aptamers or promoters, making them highly selective and complex systems. For example, Fan Chunhai's research project achieved live-cell mRNA imaging based on this fluorescent aptamer, enabling qualitative analysis and in situ imaging of intracellular β-actin mRNA, with potential applications in in vivo visualization of mRNA. Meier et al. designed a functional nucleoprotein switch and proposed several principles for designing luminescent RNA aptamer sensors. Xu Jingjuan's research group, leveraging the small size, biocompatibility, and excellent photostability of Corn-DFHO, developed a novel target-induced precise self-assembly method for RNA probes targeting tumor-associated microRNAs in living cells, directly applying this method to in situ monitoring of endogenous microRNAs at the single-cell level. However, these sensing approaches based on the "one-to-one" triggering model of light-emitting RNA aptamers are not suitable for analyzing or imaging low-concentration targets. Therefore, it is necessary to develop new RNA aptamer-based detection strategies to detect trace amounts of targets. Summary of the Invention
[0005] To address the above technical problems, the present invention provides a method for constructing a luminescent RNA aptamer-based amplification and transcription system. Based on this system, a method for detecting DNA methylase activity and a method for screening substances that affect DNA methylation activity have been established. This method provides a practical method for quantifying trace amounts of DNA methyltransferase in complex systems. The DNA methylase detection method developed by the present invention, with its high specificity and sensitivity, plays an important role in the early diagnosis and precision treatment of tumors.
[0006] The first object of the present invention is to provide a method for constructing a luminescent RNA aptamer combined with an amplification and transcription system, comprising the following steps:
[0007] S1. Incubating a first primer and a second primer together; the first primer includes a first sequence and a second sequence connected thereto, and the first sequence is complementary to the second primer;
[0008] S2. Adding a circular padlock probe to the system of step S1 to perform rolling circle amplification to form single-stranded DNA; a partial sequence of the circular padlock probe is complementary to the second sequence; the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1;
[0009] S3, adding a third primer to the system amplified in step S2, wherein the third primer uses the single-stranded DNA obtained by rolling circle amplification as a template to form a DNA double strand;
[0010] S4. The double-stranded DNA obtained in step S3 is transcribed in vitro, and 3,5-difluoro-4-hydroxybenzyl imidazolidinone (DFHBI) is added to the transcribed system to obtain the luminescent RNA aptamer-binding amplification and transcription system.
[0011] Furthermore, the sequence shown in SEQ ID NO. 1 is as follows, wherein the underlined portion is the portion of the circular padlock probe in step S2 that is complementary to the second sequence:
[0012] CTACTATCTCAGG GAGCTCACACTCTACTCAACAGCGCGAACGCTGGACCCGTCCTTCTCCCGCCCTATAGTGAGTCGTAT TAAACTAAACAAC .
[0013] Furthermore, the nucleotide sequence of the first primer is shown in SEQ ID NO. 2. Specifically, the underlined portion is the second sequence complementary to a portion of the circular lock probe, and the bold portion is the first sequence complementary to the second primer:
[0014]
[0015] Furthermore, the nucleotide sequence of the second primer is shown in SEQ ID NO. 3. The specific sequence is as follows:
[0016]
[0017] Furthermore, the nucleotide sequence of the third primer is shown in SEQ ID NO. 4. The specific sequence is as follows:
[0018] TAAACTAAACAACCTACTATCTCA.
[0019] Furthermore, in step S3, the single-stranded DNA obtained by rolling circle amplification contains a sequence encoding a luminescent RNA aptamer, which can combine with a dye molecule (such as DFHBI) to generate fluorescence.
[0020] Furthermore, in step S2, the rolling circle amplification system includes, in addition to the circular padlock probe, dNTPs and phi29 DNA polymerase.
[0021] Furthermore, in steps S3 and S4, when the single-stranded DNA obtained by rolling circle amplification is used as a template to form a DNA double-strand, a third primer is first added, extended and filled with Klenow enzyme, and then RNA is formed under the action of RNA polymerase. After in vitro transcription, a protein that specifically binds to DFHBI and produces fluorescence is obtained.
[0022] In the amplification and transcription system of the present invention, the first primer is completely complementary to the second primer and contains an extension (i.e., a second sequence). This extension is complementary to a portion of the circular template and can serve as a DNA primer for RCA rolling circle amplification. Under the catalysis of phi29 DNA polymerase, dNTPs are converted into single-stranded DNA. This single-stranded DNA contains hundreds or thousands of repeated template-complementary fragments. The sequences commonly contained in the single-stranded DNA can bind to dye molecules and emit fluorescence after in vitro transcription. The dye molecules do not fluoresce before binding, so the detection of fluorescence intensity can achieve amplification of small signals. In addition, the reason why the present invention can achieve such excellent results is due to the circular lock probe. The inventors designed a unique circular template that can only trigger the rolling circle amplification reaction after complementing the extension, and then proceed to the subsequent steps.
[0023] The second object of the present invention is to provide a luminescent RNA aptamer combined with amplification and transcription system constructed by the above construction method.
[0024] The present invention also claims to protect the application of the above system in substance detection, especially in the preparation of disease diagnostic reagents, which provides a new way to quantify trace amounts of test substances in complex systems.
[0025] A third object of the present invention is to provide a method for detecting DNA methylase activity, comprising the following steps:
[0026] S1. Incubating a first primer and a second primer together to form a primer complex; the first primer includes a first sequence and a second sequence connected thereto, and the first sequence is complementary to the second primer;
[0027] S2, adding the DNA methylase to be tested to the system of step S1 for incubation, and then adding a restriction endonuclease for incubation; the restriction endonuclease specifically cuts the primer complex that is not methylated by the DNA methylase, and cannot cut the primer complex that is methylated by the DNA methylase;
[0028] S3. Adding a circular padlock probe to the system of step S2 to perform rolling circle amplification to form single-stranded DNA; a partial sequence of the circular padlock probe is complementary to the second sequence; the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1;
[0029] S4, adding a third primer to the system amplified in step S3, wherein the third primer forms a double-stranded DNA using the single-stranded DNA obtained by rolling circle amplification as a template;
[0030] S5. The double-stranded DNA obtained in step S4 is transcribed in vitro, 3,5-difluoro-4-hydroxybenzyl imidazolidinone (DFHBI) is added to the transcribed system, and the activity of the DNA methylase to be tested is detected based on the fluorescence intensity.
[0031] Furthermore, the nucleotide sequence of the first primer is shown as SEQ ID NO.2.
[0032] Furthermore, the nucleotide sequence of the second primer is shown as SEQ ID NO.3.
[0033] Furthermore, the nucleotide sequence of the third primer is shown as SEQ ID NO.4.
[0034] Furthermore, in step S1, the first primer or the second primer is modified with avidin.
[0035] Furthermore, in step S2, streptomycin-modified magnetic beads are added to the incubated system for incubation.
[0036] Furthermore, in step S2, in one embodiment of the present invention, the DNA methylase to be tested is CpG methyltransferase (M.SssI), and the restriction endonuclease is HpaII.
[0037] Furthermore, in step S3, the rolling circle amplification system includes, in addition to the circular padlock probe, dNTPs and phi29 DNA polymerase.
[0038] Furthermore, in steps S4 and S5, when the single-stranded DNA obtained by rolling circle amplification is used as a template to form a DNA double-strand, a third primer is first added, extended and filled with Klenow enzyme, and then RNA is formed under the action of RNA polymerase. After in vitro transcription, a protein that specifically binds to DFHBI and produces fluorescence is obtained.
[0039] In the detection method of the present invention, if the activity of the DNA methylase is sufficient to methylate the primer complex formed by the first primer and the second primer, the restriction endonuclease cannot perform enzymatic cleavage after the addition of the restriction endonuclease (i.e., the DNA methylase protects the primer complex from digestion by the restriction endonuclease). Then, after the addition of the circular padlock probe, RCA rolling circle amplification can be performed normally, and the formed luminescent RNA aptamer can bind to the dye molecule to emit fluorescence. If the activity of the DNA methylase is insufficient to methylate the primer complex, the restriction endonuclease specifically cleaves the unmethylated primer complex, and after the addition of the restriction endonuclease, the primer complex will be cut off with uneven ends, and rolling circle amplification cannot be performed, and the corresponding fluorescence intensity also disappears. Therefore, the activity of the DNA methylase can be obtained by establishing a linear model of enzyme activity and fluorescence intensity.
[0040] A fourth object of the present invention is to provide a method for screening substances that affect DNA methylation activity, comprising the following steps:
[0041] S1. Incubating a first primer and a second primer together to form a primer complex; the first primer includes a first sequence and a second sequence connected thereto, and the first sequence is complementary to the second primer;
[0042] S2, adding the DNA methylase to be tested and the substance to be tested to the system of step S1 for incubation, and then adding a restriction endonuclease for incubation; the restriction endonuclease specifically cuts the primer complex that is not methylated by the DNA methylase, and cannot cut the primer complex that is methylated by the DNA methylase;
[0043] S3. Adding a circular padlock probe to the system of step S2 to perform rolling circle amplification to form single-stranded DNA; a partial sequence of the circular padlock probe is complementary to the second sequence; the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1;
[0044] S4, adding a third primer to the system amplified in step S3, wherein the third primer forms a double-stranded DNA using the single-stranded DNA obtained by rolling circle amplification as a template;
[0045] S5. The double-stranded DNA obtained in step S4 is transcribed in vitro, 3,5-difluoro-4-hydroxybenzyl imidazolidinone (DFHBI) is added to the transcribed system, and substances that affect DNA methylation are screened based on the difference in fluorescence intensity compared with the system without the addition of the test substance.
[0046] Furthermore, if the fluorescence intensity of the system with the test substance added increases compared to the system without the test substance added, it indicates that the test substance can enhance DNA methylation; if the fluorescence intensity decreases, it indicates that the test substance can inhibit DNA methylation.
[0047] A fifth object of the present invention is to provide a circular padlock probe for rolling circle amplification, wherein the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1.
[0048] By means of the above solution, the present invention has at least the following advantages:
[0049] The present invention designs a dual amplification and transcription strategy based on RNA aptamers for label-free and ultrasensitive detection of trace CpG methyltransferases. The synergistic cascade rolling circle amplification (RCA) and RNA transcription process is triggered by the magnetic bead / DNA surface to generate tandem spinach sequences of different lengths with high affinity to the dye molecules, resulting in significant fluorescence enhancement. The linear range of this strategy is wide, 0.02-100 U / mL, and the detection limit is reduced to 0.0016 U / mL. More importantly, due to the unique characteristics of this platform, including sensitive restriction endonucleases, padlock-based recognition, and RNA transcription, the specificity of analyzing DNA methylases and their inhibitor activity evaluation in complex systems is ensured.
[0050] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0051] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.
[0052] Figure 1 Schematic diagram of the DNA methylase activity detection method of the present invention.
[0053] Figure 2 Validation of DNA methylation, HpaII cleavage, RCA, and in vitro transcription. (A) Gel electrophoresis analysis of the methylation and HpaII cleavage processes. (B) Gel electrophoresis results of the rolling circle amplification and in vitro transcription processes.
[0054] Figure 3 (A) Fluorescence spectra of the system with or without phi29, T7 RNA polymerase, or DFHBI at a M.SssI concentration of 250 U / mL. (B) Fluorescence intensity changes over time after the addition of M.SssI or Dam. The concentrations of M.SssI and Dam were 10 and 50 U / mL, respectively.
[0055] Figure 4(A) Fluorescence spectra of the sensing platform in the presence of different concentrations of M.SssI. (B) Fluorescence intensity of the sensing system in response to different concentrations of M.SssI. The figure shows a standard curve of system fluorescence intensity at 510 nm versus M.SssI concentration. (C) Selectivity experiment. The concentrations of Dam, M.SssI, AZa-dc, and AZa were 500 U / mL, 150 U / mL, 10 μM, and 5 μM, respectively. (D) Recovery of M.SssI in buffer and human serum samples. DETAILED DESCRIPTION
[0056] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.
[0057] The sequences involved in the following examples are shown in the table below.
[0058]
[0059] Example 1 Construction of detection system
[0060] (1) Preparation of circular locked DNA
[0061] Mix 10 μL of the padlock probe (100 μM) with 10 μL of primer 4 (100 μM), heat to 95°C for 5 minutes, and cool to room temperature for 1 hour. Add 2 μL of 10× T4 DNA ligase buffer (400K units / mL) to 50 μL of T4 DNA ligase, and dilute to 50 μL with RNase-free water. Incubate at 16°C for 12 hours, then heat to 65°C for 10 minutes. Add 1 μL of exonuclease I (20K units / mL) and 1 μL of exonuclease III (100K units / mL) and incubate at 37°C for 2 hours. Synthesize the circular padlock probe (CPP) by heating at 80°C for 20 minutes.
[0062] (2) Methylation and cleavage process
[0063] 100 μM Primer 2 was mixed with 100 μM Biotin-Primer 1, heated to 95°C for 5 minutes, and cooled to room temperature for 1 hour to form a Primer 1 / Primer 2 complex. The dsDNA of Primer 1 / Primer 2 was methylated in 1× methylase reaction buffer consisting of 160 μM SAM and varying concentrations of M.SssI (0.02 to 100 U / mL) at 37°C with shaking for 2 hours. The reaction was then terminated by heating at 65°C for 20 minutes.
[0064] (3) Specific cleavage reaction
[0065] The mixture was added with 0.5 μL HpaII (2000 U / mL), 1 μL (300 mM) DTT and 0.5 μL BSA (100×) at 25°C, reacted for 20 minutes, and then inactivated at 80°C for 20 minutes.
[0066] Streptavidin-modified magnetic beads (40 μL of 10 mg / mL) were mixed with the reaction solution and shaken at 37°C for 2 h, washed 6 times with water to remove the cleaved primer 1 / primer 2 complex, and then redissolved in 1× phi29 DNA polymerase buffer (50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5) in a total volume of 50 μL.
[0067] (4) Amplification and transcription process
[0068] The solution obtained in the above steps was first added with 2 μL of 10 mM dNTPs, 1 μL of 10 mg / mL BSA, 1 μL of phi29 DNA polymerase (10K units / mL), and 10.0 μL of CPP. The solution was incubated at 30°C for 2.5 hours to allow rolling circle amplification (RCA). The solution was then heated to 65°C for 10 minutes to inactivate the reaction. 5 μL of primer 3 (100 μM) was then added and incubated for 1 hour. Furthermore, 0.5 μL of Okazaki fragment (3'→5' exo-) (5 U / μL), 1 μL of a deoxyribonucleoside mix (10 mM), and 0.3 μL of DTT (300 mM) were added and reacted at 37°C for 15 minutes. Double-stranded DNA was synthesized, washed three times, and the buffer was removed before redispersion in 1× transcription buffer. Transcription was then performed by adding 2 μL of a 10 mM ribonucleoside mix and 1 μL of T7 RNA polymerase, followed by incubation at 37°C for 1 hour. This resulted in RCA amplification and in vitro transcription.
[0069] Example 2 Fluorescence response of M.SssI detection
[0070] (1) After initiating RCA amplification and transcription with M.SssI at different concentrations (0-100 U / mL), the cells were mixed with DFHBI solution (20 μM) for 30 minutes and transferred to an ultramicrofluorescence cuvette for fluorescence measurement. The fluorescence emission spectrum was recorded with an excitation wavelength of 445 nm and a slit width of 505 nm.
[0071] The detection system without adding phi29, T7 RNA polymerase or DFHBI was constructed. The remaining steps were the same as above. The fluorescence spectrum results were shown in Figure 3 B, from Figure 3 As can be seen from Figure B, significant fluorescence can only be emitted when all components are present and the DNA methylase has a certain activity. In other cases, the fluorescence is extremely weak and the background is low.
[0072] The fluorescence intensity of the sensing system should be determined by different concentrations of M.SssI. A standard curve of fluorescence intensity at 510 nm and M.SssI concentration was constructed. The results are shown in Figure 4 In A and B, it can be seen that in the concentration range of 0.01-100 U / mL, there is a linear relationship between the fluorescence intensity and the M.SssI concentration, and the linear regression equation is F = 106.56 × Log C + 335.18, R 2 =0.999, where F is the fluorescence intensity and C is the concentration of DNA methylase (U / mL).
[0073] (2) Specificity detection
[0074] M.SssI at a concentration of 10 U / mL or Dam methylase at 50 U / mL was used to initiate RCA amplification and transcription, respectively, and then mixed with DFHBI solution (20 μM) for 30 min, transferred to an ultramicrofluorescence cuvette for fluorescence measurement, and the fluorescence emission spectrum was recorded with an excitation wavelength of 445 nm and a slit width of 505 nm.
[0075] See the results Figure 3 C in Figure 3 shows that the detection system has high specificity. After replacing M.SssI methyltransferase with Dam methylase, the fluorescence did not change significantly compared with the control group.
[0076] (3) Sensitivity detection
[0077] According to the method, the concentration of the test substance corresponding to 3 times the signal / noise level was found, which was defined as the detection limit. Finally, the detection limit of this method was obtained to be 0.0016U / mL.
[0078] (4) Effect of DNA methylation inhibitors on the fluorescence intensity of the detection system
[0079] DNA methylase inhibitors were added simultaneously with the addition of DNA methylase. The groups were set as follows: (1) 150 U / mL M.SssI, (2) 150 U / mL M.SssI + 10 μM AZa-dc, (3) 150 U / mL M.SssI + 5 μM AZa, (4) 500 U / mL Dam. The remaining steps were the same as above. The system without any substance was used as the blank control. The fluorescence intensity of group (1) was taken as 1. The relative fluorescence intensity results of each group are shown in Figure 2. Figure 3 C. As can be seen, the fluorescence intensity of the interferor Dam group is comparable to that of the blank control group, and the fluorescence intensity of the two groups with the addition of inhibitors is significantly reduced compared to when only M.SssI is added, and the degree of reduction is different, thus enabling the screening of DNA methylation inhibitors.
[0080] Example 3 Detection of M.SssI activity in serum samples
[0081] M.SssI was spiked and recovered in normal human serum diluted 50 times for further practical application. The specific addition amount and detection amount are shown in Table 2. The results are shown in Table 2. Figure 4 In Figure D, it can be seen that the sample recovery rate of this method is between 92% and 107.0, and the relative standard deviation is less than 7%, which proves that the method has high accuracy.
[0082] Table 2 Results of sample recovery experiment
[0083]
[0084] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.
Claims
1. An application of a luminescent RNA aptamer combined with an amplification and transcription system in the preparation of a DNA methylase activity detection product, characterized in that: The construction of the luminescent RNA aptamer combined with amplification and transcription system includes the following steps: S1. Incubating a first primer and a second primer together; the first primer includes a first sequence and a second sequence connected thereto, and the first sequence is complementary to the second primer; S2. Adding a circular padlock probe to the obtained system to perform rolling circle amplification to form single-stranded DNA; a partial sequence of the circular padlock probe is complementary to the second sequence; the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1; S3, adding a third primer to the system amplified in step S2, wherein the third primer uses the single-stranded DNA obtained by rolling circle amplification as a template to form a DNA double strand; S4, performing in vitro transcription on the double-stranded DNA obtained in step S3, adding a dye to the transcribed system to obtain the luminescent RNA aptamer-binding amplification and transcription system; The steps of using the luminescent RNA aptamer combined with the amplification and transcription system to detect DNA methylase activity include: The following steps are added between step S1 and step S2: adding the DNA methylase to be tested to the system of step S1 and incubating, and then adding a restriction endonuclease and incubating; the restriction endonuclease specifically cuts the primer complex that is not methylated by the DNA methylase, and cannot cut the primer complex that is methylated by the DNA methylase; In step S4, after adding the dye, the activity of the DNA methylase to be tested is detected according to the fluorescence intensity; The nucleotide sequence of the first primer is shown as SEQ ID NO.2, the nucleotide sequence of the second primer is shown as SEQ ID NO.3, and the nucleotide sequence of the third primer is shown as SEQ ID NO.
4.
2. The use according to claim 1, characterized in that: The dye is 3,5-difluoro-4-hydroxybenzyl imidazolidinone.
3. A method for screening active substances affecting DNA methylation, characterized in that: The following steps are involved: S1. Incubating a first primer and a second primer together to form a primer complex; the first primer includes a first sequence and a second sequence connected thereto, and the first sequence is complementary to the second primer; S2, adding the DNA methylase to be tested and the substance to be tested to the system of step S1 for incubation, and then adding a restriction endonuclease for incubation; the restriction endonuclease specifically cuts the primer complex that is not methylated by the DNA methylase, and cannot cut the primer complex that is methylated by the DNA methylase; S3. Adding a circular padlock probe to the system of step S2 to perform rolling circle amplification to form single-stranded DNA; a partial sequence of the circular padlock probe is complementary to the second sequence; the nucleotide sequence of the circular padlock probe is shown in SEQ ID NO.1; S4, adding a third primer to the system amplified in step S3, wherein the third primer forms a double-stranded DNA using the single-stranded DNA obtained by rolling circle amplification as a template; S5. Transcribe the double-stranded DNA obtained in step S4 in vitro, add a dye to the transcribed system, and screen out substances that affect DNA methylation based on the difference in fluorescence intensity compared to the system without the test substance added; The nucleotide sequence of the first primer is shown as SEQ ID NO.2, the nucleotide sequence of the second primer is shown as SEQ ID NO.3, and the nucleotide sequence of the third primer is shown as SEQ ID NO.4.