A marker of endometrial receptivity in patients with unexplained recurrent implantation failure

Abstract

The present invention provides the use of KIAA1429 gene or protein as a biomarker in the preparation of a reagent for evaluating endometrial receptivity in a subject, wherein the subject is an in vitro fertilization-embryo transfer patient or further a patient with unexplained recurrent embryo implantation failure (RIF). Conveniently and quickly detecting the expression level of KIAA1429 in the endometrium of in vitro fertilization-embryo transfer patients will be able to reflect the state of endometrial receptivity and provide a new basis and means for evaluating whether a patient is suitable for embryo transfer.

Description

Technical Field

[0001] The invention belongs to the field of obstetrics and gynecology, and in particular relates to an endometrial receptivity marker in recurrent embryo implantation failure disease. Background Art

[0002] Reproductive technology has developed rapidly in recent years, and in vitro fertilization-embryo transfer technology has gradually developed into an important method for treating infertility. The successful implantation of the embryo is the key to pregnancy. The basic event of successful pregnancy requires the implantation of qualified blastocysts into the receptive endometrium. However, a considerable number of patients have experienced multiple qualified blastocyst implantations and still cannot achieve successful pregnancy. Among them, the known uterine factors mainly include congenital uterine structural abnormalities, submucosal uterine fibroids, endometrial polyps, intrauterine adhesions and adenomyosis, etc., but about 40%-50% of patients have repeated embryo implantation failures for unknown reasons.

[0003] Endometrial receptivity is a complex process that provides opportunities for embryo attachment, invasion, and development, ultimately forming a new individual and the continuation of the species. During this period, the endometrium undergoes characteristic morphological and molecular changes that enable embryo attachment and invasion, including an increase in epithelial cell microvilli and the formation of cytoplasmic feet, as well as changes in adhesion molecules and cytokines. Abnormalities in their molecular structure and expression often hinder the development of uterine receptivity, leading to reproductive disorders.

[0004] Studies have shown that transcription factor HOXA10 and leukemia inhibitory factor LIF are key genes for regulating endometrial receptivity, play an important role in the process of embryo implantation, and can be used as markers of embryo implantation. Endometrial LIF expression is high in fertile women before and after implantation, but low in infertile women. LIF deficiency can lead to implantation failure in mice. LIF binds to its receptor LIFR, which cooperates with co-receptor GP130 to activate downstream signals through signal transducers and transcription activators. Uterine deficiency of coding genes GP130 or STAT3 can also lead to embryo implantation failure. In women, HOXA10 is upregulated in receptive endometrium, and HOXA10- / - mice fail to decidualize, resulting in inability to become pregnant normally, indicating that HOXA10 plays an important role in the decidualization process. However, the current clinical diagnostic indicators for whether the endometrium has good receptivity still cannot be accurately, conveniently, and efficiently predicted.

[0005] N6-methyladenosine (m6A) has been identified as the most abundant internal modification of eukaryotic RNA, present in messenger RNA, repetitive RNA and long non-coding RNA. m6A modification plays an important role in the reproductive system, regulating gametogenesis, zygotic transformation, etc. KIAA1429 (virus-like m6A methyltransferase) has been shown to be a member of RNA methyltransferases and is abundantly expressed in endometrial tissue.

[0006] In summary, it is of great significance to develop a simple, convenient and accurate way to predict the patient's endometrial status and reduce the occurrence of unexplained recurrent embryo implantation failure. Summary of the invention

[0007] In response to the above problems, the present application has found through multi-angle research that reduced KIAA1429 expression levels lead to decreased endometrial receptivity. KIAA1429 can be used as a biomarker of endometrial receptivity to predict and prevent unexplained recurrent embryo implantation failure.

[0008] Specifically, the first aspect of the present invention provides the use of the KIAA1429 gene or protein as a biomarker in the preparation of a reagent for assessing endometrial receptivity in a subject.

[0009] In certain embodiments, the subject is an in vitro fertilization-embryo transfer patient.

[0010] In certain embodiments, the subject is a patient with recurrent implantation failure (RIF).

[0011] In certain embodiments, the subject is a patient with unexplained recurrent implantation failure (RIF).

[0012] The second aspect of the present invention provides use of a detection reagent for the KIAA1429 gene or protein in the preparation of a kit for assessing endometrial receptivity of a subject.

[0013] In certain embodiments, the subject is an in vitro fertilization-embryo transfer patient.

[0014] In certain embodiments, the subject is a patient with recurrent implantation failure (RIF).

[0015] In certain embodiments, the subject is a patient with unexplained recurrent implantation failure (RIF).

[0016] In certain embodiments, the reagent detects the transcription level of the gene by one or a combination of several methods including quantitative PCR and high-throughput sequencing.

[0017] In certain embodiments, the detection reagent for the KIAA1429 gene includes primers and / or probes for quantitative PCR detection of KIAA1429;

[0018] In certain embodiments, the forward primer and reverse primer for quantitative PCR detection of KIAA1429 are shown as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0019] In certain embodiments, the reagent detects the level of the protein by one or a combination of methods selected from the group consisting of BCA protein quantification, immunohistochemistry, western blotting, and ELISA.

[0020] In certain embodiments, the detection reagent for the KIAA1429 protein comprises a KIAA1429-specific antibody.

[0021] In certain embodiments, the test sample of the kit is endometrial tissue of a subject.

[0022] A third aspect of the present invention provides a test subject's endometrial receptivity assessment kit, the kit comprising: a reagent for detecting KIAA1429 gene transcription level and / or a reagent for detecting KIAA1429 protein level.

[0023] In certain embodiments, the subject is an in vitro fertilization-embryo transfer patient.

[0024] In certain embodiments, the subject is a patient with recurrent implantation failure (RIF).

[0025] In certain embodiments, the subject is a patient with unexplained recurrent implantation failure (RIF).

[0026] The fourth aspect of the present invention provides a method for evaluating endometrial receptivity in endometrial tissue samples for non-disease diagnosis and treatment purposes, the method comprising detecting the KIAA1429 gene transcription level and / or KIAA1429 protein level in the tissue; using the KIAA1429 transcription level or KIAA1429 protein level value of patients with repeated implantation failure or embryonic bed failure as a control; a KIAA1429 gene transcription level or KIAA1429 protein level lower than the control indicates that the endometrial receptivity of the endometrial tissue is poor.

[0027] The fifth aspect of the present invention provides a system for evaluating endometrial receptivity of a subject, comprising: 1) a reagent for detecting the transcription level of KIAA1429 and / or the protein level of KIAA1429; 2) a device comprising a data input module, a data comparison module and a conclusion output module.

[0028] In certain embodiments, the subject is an in vitro fertilization-embryo transfer patient.

[0029] In certain embodiments, the subject is a patient with recurrent implantation failure (RIF).

[0030] In certain embodiments, the subject is a patient with unexplained recurrent implantation failure (RIF).

[0031] In certain embodiments, the data input module is used to input the transcription level value of KIAA1429 in the sample to be tested; the data comparison module is used to compare the transcription level value of KIAA1429 in the sample to be tested with a control value; the control value is the transcription level of KIAA1429 or the protein level of KIAA1429 in patients with repeated implantation failure or embryonic bed failure; the conclusion output module is used to output the conclusion according to the following standards: if the transcription level of KIAA1429 or the protein level of KIAA1429 in the sample of the subject to be tested is lower than the control value, the endometrial receptivity of the subject to be tested is poor.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention performs MeRIP-seq on the endometrial tissue of patients with unexplained recurrent embryo implantation failure, confirming that the m6A level in RIF patients is significantly decreased, and the distribution of modification sites on mRNA is significantly increased in the 3'UTR and Exon regions; the dot blot hybridization technique is used to further confirm the decreased m6A level in the endometrial tissue of RIF patients; the protein expression level in the endometrium of patients with unexplained recurrent embryo implantation failure is detected, confirming that the expression of RNA methyltransferase KIAA1429 in the endometrium of RIF patients is significantly decreased; and the dot blot hybridization technique is used to further detect the m6A level in the endometrium of patients with unexplained recurrent embryo implantation failure. It was confirmed that the level of m6A in endometrial cells decreased after KIAA1429 knockdown; further in vitro simulated embryo adhesion experiments confirmed that the decreased expression of KIAA1429 led to a decrease in embryo adhesion rate and a decrease in endometrial receptivity; KIAA1429 was knocked down by plasmid transfection, and RT-qPCR experiments confirmed that the decreased expression of KIAA1429 led to a decrease in the mRNA expression levels of HOXA10 and LIF, marker molecules of endometrial receptivity; Tunel immunofluorescence experiments further confirmed that the level of apoptosis of endometrial cells with decreased KIAA1429 expression was significantly increased, thereby reducing endometrial receptivity.

[0034] The present invention proves that the changes in endometrial receptivity can be evaluated by the protein and mRNA expression levels of KIAA1429. Convenient and rapid detection of the expression level of KIAA1429 in the endometrium of patients undergoing in vitro fertilization-embryo transfer will be able to reflect the state of endometrial receptivity and provide a new basis and means for evaluating whether patients are suitable for embryo transfer. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0036] Figure 1Shown are MeRIP-seq results for RIF disease endometrial tissue. Figure 1 A shows the correlation analysis of MeRIP-seq sequencing results of normal endometrial tissue (CTRL group) and endometrial tissue with unexplained RIF disease (RIF group). There is a strong correlation within the CTRL group and the RIF group, but a weak correlation between the groups. Figure 1 B shows the comparison of m6A gene numbers and peaks between the CTRL group and the RIF group. The m6A gene numbers and peaks in the RIF group were significantly lower than those in the CTRL group. Figure 1 C shows the distribution analysis of m6A peaks in transcript positions in the CTRL and RIF groups. The m6A peak enrichment in the 3'UTR and exon regions of the RIF group was significantly higher than that in the CTRL group. Figure 1 D shows the analysis of m6A levels in the CTRL and RIF groups. The m6A level in the RIF group was significantly lower than that in the CTRL group.

[0037] Figure 2 Showing the KIAA1429 protein expression and m6A DotBlot results in endometrial tissue of RIF disease. Figure 2 A shows the analysis of m6A methyltransferase KIAA1429 protein expression levels in endometrial tissues of the CTRL and RIF groups. The expression of KIAA1429 in endometrial tissues of the RIF group decreased significantly. Figure 2 B shows the correlation analysis between the expression level of KIAA1429 and the number of m6A sites in the sequencing results, and the two showed a strong positive correlation. Figure 2 C shows DotBlot verification of m6A in endometrial tissues of CTRL and RIF groups. The m6A level in endometrial tissues of RIF group decreased significantly.

[0038] Figure 3 Shows KIAA1429 knockdown endometrial cell m6A Dot Blot, in vitro simulated embryo adhesion and qPCR results. Figure 3 A shows that KIAA1429 was knocked down using Ishikawa cell line in vitro to simulate embryo adhesion in vitro. Compared with the control group (shNC), the in vitro simulated embryo adhesion rate of the KIAA4129 knockdown group (shKIAA1429) was significantly reduced. Figure 3 B shows the knockdown of KIAA4129 in vitro using Ishikawa cell line, and m6ADot Blot verification. The m6A level in the KIAA1429 knockdown group decreased significantly. Figure 3 C shows the knockdown of KIAA1429 in vitro using the Ishikawa cell line, and the endometrial receptivity markers RT-qPCR verification. In the KIAA1429 knockdown group, the endometrial receptivity markers HOXA10 and LIF showed a significant decrease.

[0039] Figure 4 Shown are the immunofluorescence results of KIAA1429 knockdown endometrial cells. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Unless otherwise defined, technical or scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0042] Example 1 MeRIP-seq analysis of endometrial tissue in RIF disease

[0043] Stranded Total RNA-Seq kit v3-pico Input Mammalian Components (TAKARA) was used to sequence the m6A library of 3 endometrial tissue samples (RIF1, RIF2, RIF3) with unexplained recurrent embryo implantation failure and 3 normal endometrial tissue samples (CTRL1, CTRL2, CTRL3). The sequencing results were analyzed and the results were as follows: Figure 1 shown. Figure 1 A is a correlation analysis of MeRIP-seq sequencing results of normal endometrial tissue (CTRL group) and RIF disease endometrial tissue (RIF group). There is a strong correlation within the CTRL group and the RIF group, but a weak correlation between the groups. Figure 1 B is the comparison of the number of m6A genes and peaks between the CTRL group and the RIF group. The number of m6A genes and peaks in the RIF group were significantly lower than those in the CTRL group. Figure 1 C is the distribution analysis of m6A peaks in transcripts in the CTRL and RIF groups. The m6A peak enrichment in the 3'UTR and exon regions of the RIF group was significantly higher than that in the CTRL group, and there were significant differences in the distribution positions; Figure 1 D is the analysis of m6A levels in the CTRL and RIF groups. The m6A level in the RIF group was significantly lower than that in the CTRL group. Combined with the above sequencing data analysis, the results showed that the m6A modification level in endometrial tissue of RIF disease was significantly reduced, and abnormal m6A methylation modification may be a potential pathogenic factor of RIF disease of unknown cause.

[0044] Example 2 Immunoblotting to detect KIAA1429 protein expression in endometrial tissue of RIF disease

[0045] Three patients with unexplained RIF and three normal endometrial tissues were added to RIPA lysis buffer (with 1% protease inhibitor mixture, beyotime, P1005 and 1% PMSF, beyotime, ST506), ground in a -60℃ precooled grinder for 4 min, and then rotated for lysis at 4℃ for 30 min. The supernatant was collected after centrifugation at 4℃, 15000rpm for 15 min. The protein concentration was determined by BCA method, and 30ug was taken for 10% SDS-PAGE gel electrophoresis separation. The membrane was transferred for 35 min using 20× fast transfer buffer (New Cyme, WB4600), and then transferred to 0.45μm PVDF membrane (Millipore, IPVH00010), and the following corresponding antibodies were added: anti-GAPDH (proteintech, 60004-1-Ig), anti-KIAA1429 (CST,

[0046] #88358), incubated overnight at 4°C, washed on a horizontal shaker with TBST for 10 min, repeated three times, incubated with secondary antibody at room temperature for 1 h, washed on a horizontal shaker with TBST for 10 min, repeated 4 times, and related protein expression was detected by imaging.

[0047] The results are as follows Figure 2 As shown in A, the expression level of m6A methyltransferase KIAA1429 protein in endometrial tissues of the CTRL and RIF groups decreased significantly; Figure 2 B is a correlation analysis of KIAA1429 expression and the number of m6A sites combined with MeRIP-seq sequencing results, and it was found that the two showed a strong positive correlation. KIAA1429 is a known m6A RNA methyltransferase. Reduced KIAA1429 expression will lead to a decrease in m6A modification levels, which is consistent with the sequencing results of endometrial tissue in RIF disease.

[0048] Example 3 Ishikawa cell culture and KIAA1429 knockdown

[0049] 3.1 Ishikawa cell culture

[0050] The human endometrial cancer cell line Ishikawa cells (Punosai, CL-0283) were maintained and cultured in DMEM culture medium (Gibco, C11995500cp) containing 10% FBS (Vivacell, C04001-500) and penicillin-streptomycin and amphotericin B triple antibodies (Sanggong, B540733-0010) at 37°C and 5% CO2. When the cell confluence reached 90%, 0.25% trypsin digestion solution was used for routine digestion and passage.

[0051] 3.2 Knockdown of KIAA1429 in Ishikawa cells

[0052] Iishkawa cells with a cell confluence of 90% were routinely digested with 0.25% trypsin and plated in a six-well plate at a cell number of 2.5 x 10 5 / well, wait for the cells to adhere stably, and transfect within 24 hours. Use shNC (plasmid vector is plko.1-copGFP-PURO-NC, control group sequence is GGTTCTCCGAACGTGTCACGT, SEQ ID NO: 10) or shKIAA1429 (KIAA1429 knockdown plasmid, plasmid vector is plko.1-SH-copGFP-2A-PURO, knockdown sequence is TACGCTCCTTTACACGATAAA, SEQ ID NO: 9) 2ug each, transfection reagent 6μL (Roch, 6366236001), DMEM is supplemented to 600ul, the three are mixed and incubated at room temperature for 15min, then added, and cultured at 37°C, 5% CO2 for 48 to 72h to prepare Ishikawa cells knocked down KIAA1429 and its control.

[0053] Example 4 RIF disease endometrial tissue and Ishikawa cell m6A nucleic acid dot hybridization

[0054] Three patients with unexplained recurrent implantation failure (RIF) and three normal human endometrial tissues or three KIAA1429 knockdown Ishikawa cells (shKIAA1429) and three Ishikawa cells transfected with empty plasmid vectors (shNC) were lysed using 1 mL of Trizol lysis buffer (TAKARA, 9109). After standing for 5 min, the cells were extracted with chloroform on ice for 10 min, centrifuged at 12,000 rpm at 4°C for 10 min, and the top layer of liquid was collected. 500 μL of isopropanol was added to precipitate the cells. RNA was degraded for 10 min, centrifuged at 4°C and 12000 rpm, and the liquid was discarded. The precipitate was washed twice with 75% ethanol, and enzyme-free water was added to dissolve RNA. The RNA concentration was measured using Qubit fluorescence quantitative measurement. Equal amounts of RNA (gradient setting: 150 ng, 100 ng, 50 ng) were diluted to 2 μL / drop, denatured at 95°C for 3 min, and then dropped onto a nitrocellulose membrane. After UV crosslinking and fixation, the membrane was washed with PBST for 10 min, and anti-N6-methylation antibody (CST,

[0055] #56593), incubated at 4°C overnight, washed with PBST for 10 min three times the next day, incubated with the corresponding secondary antibody at room temperature for 1 hour, washed with PBST for 10 min, repeated three times, and then detected the m6A expression level using an imager.

[0056] Results of m6A nucleic acid dot hybridization of endometrial tissue in RIF disease Figure 2 As shown in C, the m6A level in endometrial tissue of RIF disease was significantly decreased, which is consistent with the MeRIP-seq sequencing results.

[0057] In vitro Ishikawa cell line knocked down KIAA1429 (see Example 3.2 for methods), and the results of m6A nucleic acid dot hybridization were as follows Figure 3 As shown in B, MB is nucleic acid dot hybridization after incubation with methylene blue. After KIAA1429 knockdown, the m6A nucleic acid dot hybridization results of the shKIAA1429 group showed a significant decrease in m6A levels at a starting amount of 50 ng RNA.

[0058] Example 5 Human choriocarcinoma cell (BeWo) spheroid adhesion assay

[0059] The human choriocarcinoma Bewo cell line (Pnosai, CL-0500) was used to simulate blastocysts in vitro, and a model of in vitro embryo adhesion to a monolayer of epithelial cells (Ishikawa cells) was established to study the endometrial epithelial cell tolerance to embryo adhesion. The specific steps are as follows:

[0060] a. Dissolve poly-HEMA (sigma, P3932-10G) in anhydrous ethanol to make a solution with a concentration of 10 mg / ml and incubate at 37°C in a constant temperature shaker at 250 rpm overnight;

[0061] b. Add 2 mL of the prepared poly-HEMA solution to a 35 mm culture dish in a 37°C oven, dry the ethanol, and prepare a suspension culture dish;

[0062] c. Trypsinize Bewo cells grown to 90% confluence, count the cells, and dilute the cells to 2x10 5 / mL, inoculated into 35mm suspension culture dishes, and cultured in suspension in a 37℃, 5% CO2 incubator;

[0063] d. On the day of Bewo cell suspension culture, Ishikawa cells were digested and inoculated into 24-well plates, and then KIAA1429 was knocked down by plasmid transfection (see Example 3.2 for methods); 48 hours later, Bewo cell spheres were filtered through a 150-mesh sieve, and about 50 cell spheres were transplanted into the treated monolayer of Ishikawa cells per well, and co-cultured for 2 hours. Rinse twice with preheated PBS, fix with 4% paraformaldehyde at room temperature for 30 minutes, and count the number of Bewo cell spheres adhering.

[0064] The results are as follows Figure 3 As shown in A, the cell adhesion rate of the shKIAA1429 knockdown group decreased by about 20% compared with the shNC group, and it was significantly significant, proving that the reduction of KIAA1429 expression will significantly reduce the receptivity of endometrial epithelial cells.

[0065] RT-qPCR experiments

[0066] Iishkawa cells with a cell confluence of 90% were digested with 0.25% trypsin for 1 min, and digestion was terminated with 2 volumes of DMEM (containing 1% penicillin-streptomycin, amphotericin B triple antibody and 10% FBS), centrifuged at 1000 rpm for 3 min, the supernatant was discarded, and resuspended with 1 mL of DMEM (containing 1% penicillin-streptomycin, amphotericin B triple antibody and 10% FBS), and plated in a six-well plate. The number of cells was 2.5 × 10 5Each well was transfected within 24 hours after the cells were stably attached to the wall. The transfection steps were as follows: the cell medium was replaced with DMEM without FBS and antibiotics. After 1 hour, each well was treated with shNC (plasmid vector is plko.1-copGFP-PURO-NC, the control sequence is GGTTCTCCGAACGTGTCACGT, SEQ ID NO: 10) or shKIAA1429 (KIAA1429 knockdown plasmid, plasmid vector is plko.1-SH-copGFP-2A-PURO, the knockdown sequence is TACGCTCCTTTACACGATAAA, SEQ ID NO:9) 2ug, transfection reagent 6μL (Roch, 6366236001), DMEM supplemented to 600ul, the three were mixed and incubated at room temperature for 15min, then added, cultured at 37℃, 5% CO2 for 48 to 72h, RNA was extracted, and reverse transcription was performed using a reverse transcription reagent (Takara, RR036A) to form cDNA, which was prepared according to the following system: 1μL each of KIAA1429, GAPDH, HOXA10, and LIF front and rear primers, 10μL of SYB Green (Biosharp, BL698A), 6μL of enzyme-free water, and 2μL of cDNA. qPCR was performed and the results were calculated and analyzed. KIAA1429, GAPDH, HOXA10, and LIF primers are as follows in Table 1:

[0067] Table 1 qPCR primers

[0068]

[0069]

[0070] The results are as follows Figure 3 As shown in C, in the Ishikawa cell line with KIAA1429 knockdown, the mRNA levels of endometrial receptivity markers HOXA10 and LIF were significantly reduced. In previous reports, the reduced expression of HOXA10 and LIF indicated a decrease in endometrial receptivity.

[0071] Tunel immunofluorescence assay

[0072] Immunofluorescence detection was performed using TUNEL BrightRed Apoptosis Detection Kit (Novozyme), and the results were analyzed using ImageJ. As shown in the figure, the positive rate of TUNEL staining in the Ishikawa cell line with KIAA1429 knockdown was about 4 times higher than that in normal Ishikawa cells, which was significant, proving that reduced KIAA1429 expression would lead to increased apoptosis levels in endometrial epithelial cells. Previous literature reports have shown that increased endometrial apoptosis levels would lead to decreased endometrial receptivity and decreased embryo adhesion success rate.

[0073] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0074] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This description method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. Use of the KIAA1429 gene or protein as a biomarker in the preparation of a reagent for assessing endometrial receptivity in a subject; the subject is a patient with unexplained recurrent implantation failure (RIF).

2. Use of a detection reagent for KIAA1429 gene or protein in the preparation of a kit for assessing endometrial receptivity in a subject; the subject is a patient with unexplained recurrent implantation failure (RIF).

3. The use according to claim 1 or 2, wherein the reagent detects the transcription level of the KIAA1429 gene by one or a combination of quantitative PCR and high-throughput sequencing.

4. The use according to claim 3, wherein the detection reagent for the KIAA1429 gene comprises primers and / or probes for KIAA1429 quantitative PCR detection.

5. The use according to claim 4, wherein the forward primer and reverse primer for quantitative PCR detection of KIAA1429 are shown as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

6. The use according to claim 1 or 2, wherein the reagent detects the level of the protein by one or a combination of methods selected from the group consisting of BCA protein quantification, immunohistochemistry, protein immunoblotting and ELISA.

7. The use according to claim 6, wherein the detection reagent for KIAA1429 protein comprises a KIAA1429-specific antibody.

8. The use according to claim 2, wherein the test sample of the kit is endometrial tissue of a subject.

Images