A rice grain-type QTL InDel molecular marker GL6-InDel, reagents, kits and their applications

Abstract

This invention relates to the field of rice breeding, and particularly to an InDel molecular marker GL6-InDel for rice grain shape QTLs, reagents, kits, and their applications. This invention is the first to discover a novel allelic variant of GL6, located on rice chromosome 6, which controls grain length, and to obtain the insertion / deletion (InDel) molecular marker GL6-InDel, which can be used to distinguish between wild-type and mutant varieties. This molecular marker not only allows for the differentiation of genotypes of rice varieties / lines / individual plants at the seedling stage, but also enables convenient, rapid, and direct identification of target genes in rice germplasm resources and bred offspring. It significantly reduces labor costs, saves time, and is unaffected by environmental and human factors, providing theoretical and practical support for further elucidating the genetic mechanisms and regulatory networks of rice grain shape and for the improvement of high-yield, widely adaptable rice varieties.

Description

Technical Field

[0001] This invention relates to the field of rice breeding, and in particular to an InDel molecular marker GL6-InDel for rice grain type QTL, reagents, kits and their applications. Background Technology

[0002] Rice is one of the world's most important cereal crops and a primary food source for about half the world's population. The steady increase in rice yield is of great significance to food production and stability in my country and globally. Grain shape is a crucial trait directly related to yield and also closely related to rice quality. Grain shape includes three main traits: grain length, grain width, and thousand-grain weight, all of which are important for high-yield and high-quality rice breeding. Therefore, discovering and utilizing new allelic variations in grain length genes can provide genetic resources for rice breeding improvement and production practices.

[0003] To date, more than 400 grain shape-related genes and QTLs have been reported. However, most QTLs have only been discovered and located in specific genetic contexts, and allelic variations existing in other varieties have not been fully discovered, and there is little related research, resulting in an incomplete understanding of the gene distribution and function of these QTLs.

[0004] Currently, research groups primarily use molecular sequencing of their self-bred varieties to detect and analyze these QTLs in specific germplasm. Through gene sequence analysis, they aim to uncover novel allelic variations of cloned QTLs, with the goal of elucidating the distribution and function of these QTLs in different materials.

[0005] As research into the function of rice grain shape genes deepens, the relationships between genes become clearer, providing more scientific evidence for the genetic improvement of rice. As one of the important traits affecting rice yield, grain shape genes, when combined with other advantageous genes for breeding, have become a crucial topic in breeding research. Therefore, discovering allelic variations at new rice grain shape QTL loci can provide theoretical and practical support for further elucidating the genetic mechanisms and regulatory networks of rice grain shape, and for improving high-yielding, widely adaptable rice varieties. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel molecular marker GL6-InDel for rice grain type QTLs, reagents, kits, and their applications. The InDel molecular marker GL6-InDel described in this invention is a novel allelic variant of a rice grain type QTL locus, which can provide theoretical and practical support for further elucidating the genetic mechanisms and regulatory networks of rice grain type and for improving high-yielding, widely adaptable rice varieties.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] This invention provides an InDel molecular marker GL6-InDel for rice grain-type QTLs. The nucleotide sequence of the InDel molecular marker GL6-InDel is shown in SEQ ID NO.1. In SEQ ID NO.1, there are one or three consecutive repeating sequences. The repeating sequence is CGCCGG.

[0009] The present invention also provides a reagent for detecting the InDel molecular marker GL6-InDel described in the above technical solution, characterized in that the reagent comprises a primer pair; the primer pair comprises GL6-InDel-F and GL6-InDel-R;

[0010] The nucleotide sequence of the GL6-InDel-F is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the GL6-InDel-R is shown in SEQ ID NO.3.

[0012] The present invention also provides a kit for detecting rice grain shape, the kit comprising the reagents described in the above technical solution.

[0013] Preferably, the kit further includes dNTPs, Taq DNA polymerase, and a magnesium-containing 10×Taq buffer.

[0014] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above technical solutions, or the reagents or kits described in the above technical solutions, in the detection and / or auxiliary detection of rice grain shape.

[0015] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above-mentioned technical solutions, or the reagents or kits described in the above-mentioned technical solutions, in rice grain shape improvement.

[0016] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above technical solutions, or the reagents or kits described in the above technical solutions, in the breeding and / or assisted breeding of slender-grained rice varieties.

[0017] The present invention also provides a method for detecting rice grain shape, comprising the following steps:

[0018] Using the DNA of the rice to be tested as a template, PCR amplification was performed using the reagents described in the above technical solution to obtain the amplification product;

[0019] The grain shape of the rice being tested can be determined based on the length of the amplified product.

[0020] When the length of the amplification product is 160 bp, the genotype of the rice to be tested is GL6 and the grain type is short grain.

[0021] When the length of the amplification product is 148 bp, the genotype of the rice to be tested is GL6-Nip, and the grain type is slender.

[0022] When the amplification products are 148bp and 160bp, the genotype of the rice being tested is heterozygous, and the grain type is between short grain and slender grain.

[0023] Preferably, the PCR amplification reaction system is 10 μL, comprising 1 μL of rice DNA to be tested, 0.5 μL GL6-InDel-F, 0.5 μL GL6-InDel-F, 1 μL 10×Taq buffer, 0.2 μL dNTPs, 0.2 μL Taq DNA polymerase, and the balance ddH2O.

[0024] Preferably, the PCR amplification reaction program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 32 cycles; and 72℃ extension for 10 min.

[0025] Beneficial effects:

[0026] This invention provides an InDel molecular marker GL6-InDel for rice grain shape QTLs. The nucleotide sequence of GL6-InDel is shown in SEQ ID NO.1; SEQ ID NO.1 contains one or three consecutive repeat sequences; the repeat sequences are CGCCGG. Using the Nipponbare genome as a control and indica rice BG1 and the high-quality restorer line Huazhan as experimental materials, this invention performed sequencing analysis on the promoter region, genome sequence, and coding sequence of the grain length gene GL6. For the first time, a novel allelic variant of GL6 controlling grain length, located on rice chromosome 6, was discovered, and the insertion / deletion (InDel) molecular marker GL6-InDel, which can be used to distinguish between wild-type and mutant types, was obtained. By simply detecting the amplification band characteristics of the molecular marker GL6-InDel, it is possible to determine whether the GL6 site in the target material is the novel allelic variant GL6-Nip, which can be used to guide grain shape genetic improvement in rice breeding. This molecular marker not only allows for the differentiation of genotypes of rice varieties / lines / single plants at the seedling stage, but also enables the convenient, rapid, and direct identification of target genes in rice germplasm resources and breeding offspring. It greatly reduces labor costs, saves time, and is unaffected by environmental and human factors. It can provide theoretical and practical support for further elucidating the genetic mechanism and regulatory network of rice grain type and improving high-yield and widely adaptable rice varieties. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0028] Figure 1 The results of identifying grain types of different rice varieties using the molecular marker GL6-Indel provided by this invention are shown below; where 1 to 15 represent: 1, Nanjing 11; 2, Nanjing 46; 3, Huanghuazhan; 4, Longjing 46; 5, Jing 65B; 6, Yuzhenxiang; 7, 19xiang; 8, Zhonghui 9308; 9, IR24; 10, IR246; 11, Zhonghui 8015; 12, Huazhan; 13, BG1; 14, 9311; 15, Nipponbare. Detailed Implementation

[0029] This invention provides an InDel molecular marker GL6-InDel for rice grain-type QTLs. The nucleotide sequence of the InDel molecular marker GL6-InDel is shown in SEQ ID NO.1, specifically as follows: ACATCT TCTGCCTCGGCTGCTGCGCCAGCATCTGCCCCCACTGCGCCCCCTCCCACC GCCACCACCCTCTCCTCCAGGTAATCAATCCGCCGTCTTCGT(CGCCGG) n CGACCCAATTGCCATGCCATGCATGTCCTCGATACACTGCATA; where n = 1 or 3; there are 1 or 3 consecutive repeating sequences in SEQ ID NO.1; the repeating sequence is CGCCGG.

[0030] This invention targets the functional region of the GL6 gene. Using next-generation sequencing technology, with the Nipponbare genome as a control and indica rice BG1 and the high-quality restorer line Huazhan as experimental materials, the promoter region, genome sequence, and coding sequence of the grain length gene GL6 were sequenced and analyzed. The nucleotide sequence of the Nipponbare GL6 gene is shown in SEQ ID NO.4, as follows:

[0031]

[0032]

[0033] The nucleotide sequences of the BG1 and Huazhan GL6 genes are shown in SEQ ID NO.5, as follows:

[0034]

[0035]

[0036]

[0037] The bolded bases in sequences 4 and 5 are newly discovered allelic variations;

[0038] Comparison of the nucleotide sequences of the Nipponbare GL6 gene with those of BG1 and Huazhan GL6 genes reveals that the BG1 and Huazhan GL6 genes, compared to Nipponbare, have a 12bp deletion of a CGCCGG repeat sequence in the first intron. Based on this allelic variation, a GL6-specific functional marker, GL6-InDel, was developed. This marker site was amplified using PCR technology, and the number and size of the PCR product fragments were detected by electrophoresis to determine whether the tested rice sample contained the GL6 gene and, if so, its genotype. Specifically, when the length of the amplified product was 16... If the amplification product is 0 bp, the genotype of the rice to be tested is GL6, and the grain type is short grain; if the length of the amplification product is 148 bp, the genotype of the rice to be tested is GL6-Nip, and the grain type is slender grain; if the length of the amplification product is 148 bp and 160 bp, the genotype of the rice to be tested is heterozygous, and the grain type is between short grain and slender grain. This enables assisted breeding of the GL6 gene, rapid identification of homozygotes and heterozygotes of the GL6 gene, and genetic improvement of grain type in rice breeding work. It can greatly improve the identification and breeding efficiency of the rice grain type gene GL6 and accelerate the breeding progress.

[0039] The present invention also provides a reagent for detecting the InDel molecular marker GL6-InDel described in the above technical solution, the reagent comprising a primer pair; the primer pair comprising GL6-InDel-F and GL6-InDel-R;

[0040] The nucleotide sequence of GL6-InDel-F is shown in SEQ ID NO.2, specifically: ACATCTTCTGCCTCGGCTG;

[0041] The nucleotide sequence of the GL6-InDel-R is shown in SEQ ID NO.3, specifically: TATGCAGTGTATCGAGGACATG.

[0042] The primer pair provided by this invention can specifically amplify the InDel molecular marker GL6-InDel described in the above technical solution.

[0043] The present invention also provides a kit for detecting rice grain shape, the kit comprising the reagents described in the above technical solution.

[0044] In this invention, the kit preferably further includes dNTPs, Taq DNA polymerase, and a magnesium-containing 10×Taq buffer.

[0045] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above technical solutions, or the reagents or kits described in the above technical solutions, in the detection and / or auxiliary detection of rice grain shape.

[0046] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above-mentioned technical solutions, or the reagents or kits described in the above-mentioned technical solutions, in rice grain shape improvement.

[0047] This invention also provides the application of the InDel molecular marker GL6-InDel described in the above technical solutions, or the reagents or kits described in the above technical solutions, in the breeding and / or assisted breeding of slender-grained rice varieties.

[0048] The present invention also provides a method for detecting rice grain shape, comprising the following steps:

[0049] Using the DNA of the rice to be tested as a template, PCR amplification was performed using the reagents described in the above technical solution to obtain the amplification product;

[0050] The grain shape of the rice being tested can be determined based on the length of the amplified product.

[0051] When the length of the amplification product is 160 bp, the genotype of the rice to be tested is GL6 and the grain type is short grain.

[0052] When the length of the amplification product is 148 bp, the genotype of the rice to be tested is GL6-Nip, and the grain type is slender.

[0053] When the amplification products are 148bp and 160bp, the genotype of the rice being tested is heterozygous, and the grain type is between short grain and slender grain.

[0054] In this invention, the PCR amplification reaction system is preferably 10 μL, and preferably includes 1 μL of rice DNA to be tested, 0.5 μL of GL6-InDel-F, 0.5 μL of GL6-InDel-R, 1 μL of 10×Taq buffer, 0.2 μL of dNTPs, 0.2 μL of Taq DNA polymerase, and the balance ddH2O; the concentrations of GL6-InDel-F and GL6-InDel-R are preferably both 10 mM; the 10×Taq buffer preferably contains 20 mM of Mg. 2+The Taq DNA polymerase activity is preferably 2 U / μL; the PCR amplification reaction program preferably includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 32 cycles; 72℃ extension for 10 min.

[0055] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes the InDel molecular marker GL6-InDel for rice grain-type QTLs, reagents, kits, and their applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] This invention performs next-generation sequencing on the genomes of the specific germplasm BG1 and the high-quality restorer line Huazhan, compares them with the genome sequence of the control variety Nipponbare, and designs molecular markers after discovering differences. The specific germplasm BG1 is deposited at the China National Rice Research Institute and is published in [Gong Ke, Xue Pao, Wen Xiaoxia, et al. Study on grain shape genes and development of related functional markers in the extra-large grain rice germplasm BG1 and the high-quality restorer line Huazhan [J]. Chinese Journal of Rice Science, 2021, 35(6): 543-553. DOI: 10.16819 / j.1001-7216.2021.201211.].

[0058] Sequencing results revealed an allelic variant of the first intron of GL6 in both BG1 and Huazhan, which had not been previously discovered and studied. Compared with the GL6 gene from Nipponbare, both Huazhan and BG1 GL6 genes exhibit a 12bp deletion of cgccggcgccgg. InDel molecular marker primer pairs were designed based on this allelic variant; the primer pairs consist of GL6-InDel-F and GL6-InDel-R; the nucleotide sequence of GL6-InDel-F is shown in SEQ ID NO.2; and the nucleotide sequence of GL6-InDel-R is shown in SEQ ID NO.3.

[0059] Example 2

[0060] The primer pairs designed in Example 1 were used to label and identify 15 parental materials: Nanjing 11, Nanjing 46, Huang Huazhan, Longjing 46, Jing 65B, Yuzhenxiang, 19xiang, Zhonghui 9308, IR24, IR246, Zhonghui 8015, Huazhan, BG1, 9311, and Nipponbare. The specific methods are as follows:

[0061] Young leaves were taken from individual plants, and DNA was extracted from the parental materials using the CTAB method.

[0062] Using the DNA of the rice to be tested as a template, PCR amplification was performed on a PCR instrument using the primer pair designed in Example 1 to obtain the amplification product;

[0063] The PCR amplification reaction system consisted of: 1 μL DNA (100 ng), 0.5 μL GL6-InDel-F, 0.5 μL GL6-InDel-R, 1 μL 10×Taq buffer, 0.2 μL dNTPs, 0.2 μL Taq DNA polymerase, and 6.6 μL ddH2O; the concentrations of GL6-InDel-F and GL6-InDel-R were both 10 mM; the 10×Taq buffer contained 20 mM Mg. 2+ The activity of the Taq DNA polymerase is 2 U / μL.

[0064] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 32 cycles; and finally 72℃ extension for 10 min.

[0065] After electrophoresis separation of the amplified products on an 8% polyacrylamide gel, they were stained with 1 wt.% AgNO3 solution, developed with formaldehyde and NaOH, photographed, and the band patterns were counted. The results are shown in the figure. Figure 1 ;

[0066] The genotype of the rice to be tested was determined based on the length of the amplified product: if the target variety can amplify a 160bp fragment, it indicates that the target variety does not have the deletion of the CGCCGG repeat sequence, and its genotype is GL6; if the target variety can amplify a 148bp fragment, it indicates that the target variety has the deletion of the CGCCGG repeat sequence, and its genotype is GL6-Nip; if the target variety can amplify a heterozygous band, it indicates that the genotype of the target variety is GL6 / GL6-Nip. The genotype results are shown in Table 1.

[0067] The thousand-grain weight (TGW), grain length (GL), and grain width (GW) of each parent material were measured using a seed testing instrument, and the length-to-width ratio = grain length / grain width (GL / GW) was calculated. Each variety was tested in three parallel replicates. The measurement and calculation results are shown in Table 1.

[0068] Table 1. Grain type and genotype of 115 conventional rice parents

[0069]

[0070]

[0071] Depend on Figure 1As shown in Table 1, varieties with a band of 160 bp do not have the deletion of the CGCCGG repeat sequence; varieties with a band of 148 bp do have the deletion of the CGCCGG repeat sequence; among japonica and indica rice varieties, the aspect ratio of materials with the novel allelic variant GL6-Nip of GL6 is mostly greater than 3, with only 2 varieties less than 3 (these two special cases may be influenced by other grain shape genes), which are typical slender grains (GL / GW≥3.0, [Huang Haixiang, Qian Qian. (2017). Rice grain shape genetics and progress in breeding of long-grained high-quality japonica rice. Chinese Journal of Rice Science (06), 665-672. doi:10.16819 / j.1001-7216.2017.7115]); indicating that rice varieties / materials with this novel allelic variant have the characteristics of slender grains.

[0072] Example 3

[0073] The primer pairs designed in Example 1 were used to identify the grain type of 24 rice varieties. The specific method was the same as in Example 1. The measurement and calculation results are shown in Table 2.

[0074] Table 2. Grain type and GL6 genotype of 224 rice varieties

[0075]

[0076]

[0077] As shown in Table 2, the length-to-width ratio of the materials of the novel allelic variant GL6-Nip is greater than 3, which is typical of slender grains. In contrast, the length-to-width ratio of most materials of the GL6 genotype is less than 3 (only 2 varieties have a length-to-width ratio greater than 3, and these two special cases may be influenced by other grain shape genes), which is typical of short grains.

[0078] The molecular markers and methods provided by this invention are mainly used to identify the presence of a 12bp CGCCGG repeat sequence deletion in the first intron upstream of the rice grain length gene GL6. Through detection and identification, it can be determined whether a novel allelic variant GL6-Nip exists in the target variety, enriching the diversity of the rice grain length gene GL6, improving selection efficiency, and accelerating the breeding process.

[0079] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An InDel molecular marker for rice grain type QTLs GL6 -InDel, characterized in that, The InDel molecular marker GL6 The nucleotide sequence of -InDel is shown in SEQ ID NO.1; in SEQ ID NO.1, there are one or three consecutive repeating sequences at position n; the repeating sequence is CGCCGG.

2. A method for detecting the InDel molecular marker of claim 1 GL6 -InDel reagent, characterized in that, The reagent includes primer pairs; the primer pairs include GL6 -InDel-F and GL6 -InDel-R; The GL6 The nucleotide sequence of -InDel-F is shown in SEQ ID NO.2; The GL6 The nucleotide sequence of -InDel-R is shown in SEQ ID NO.

3.

3. A reagent kit for detecting rice grain shape, characterized in that, The kit includes the reagent as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes dNTPs, Taq DNA polymerase, and a magnesium-containing 10×Taq buffer.

5. The application of the reagent of claim 2 or the kit of claim 3 or 4 in the detection of rice grain shape.

6. The application of the reagent of claim 2 or the kit of claim 3 or 4 in the breeding of slender-grained rice varieties.

7. A method for detecting rice grain shape, characterized in that, Includes the following steps: Using the DNA of the rice to be tested as a template, PCR amplification was performed using the reagent described in claim 2 to obtain the amplification product; The grain shape of the rice being tested can be determined based on the length of the amplified product. When the length of the amplification product is 160 bp, the genotype of the rice to be tested is GL6 and the grain type is short grain. When the length of the amplification product is 148 bp, the genotype of the rice to be tested is GL6-Nip, and the grain type is slender. When the amplification products are 148bp and 160bp, the genotype of the rice being tested is heterozygous, and the grain type is between short grain and slender grain.

8. The method according to claim 7, characterized in that, The PCR amplification reaction system, in 10 μL increments, includes 1 μL of the rice DNA to be tested, 0.5 μL of the [specific reagent / material]... GL6 -InDel-F, 0.5μL GL6 -InDel-R, 1μL 10×Taq buffer, 0.2μL dNTPs, 0.2μL Taq DNA polymerase and the balance ddH2O.

9. The method according to claim 7, characterized in that, The PCR amplification reaction program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 32 cycles; and 72℃ extension for 10 min.

Images