Metarhizium levis and granules thereof and application thereof in the prevention and treatment of spodoptera frugiperda

Abstract

The application discloses Metarhizium rileyi and a granule thereof and application of the Metarhizium rileyi in prevention and treatment of Spodoptera frugiperda. The Metarhizium rileyi strain is numbered as GZUMr46, and the preservation number is CCTCC M 2023161. The granule is a fermentation product of the Metarhizium rileyi GZUMr46 and grains. The Metarhizium rileyi GZUMr46 has good production performance, strong sporulation capacity and high insecticidal efficiency. The Metarhizium rileyi GZUMr46 granule has good growth and germination adhesion capacity in a field environment, has good insecticidal effect on the Spodoptera frugiperda, and effectively controls the population and quantity of the Spodoptera frugiperda by applying the granule.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural pest control, and in particular to a Metarhizium anisopliae and granules thereof and application thereof in the control of Spodoptera frugiperda. BACKGROUND

[0002] Spodoptera frugiperda (J.E. Smith), belonging to Lepidoptera, Noctuida, Spodoptera, is also known as fall armyworm, and is a major agricultural pest of omnivorous origin in the tropical and subtropical regions of America. In early 2019, it invaded Yunnan, China, and then rapidly spread to the southwest, south China, the Yangtze River region and north China, with corn as the main infected crop, seriously threatening corn production and food security in China.

[0003] In order to ensure corn yield and food security, pesticides are usually used to control Spodoptera frugiperda, and conventional pesticides include chemical pesticides and biological pesticides. At present, the main control technology for Spodoptera frugiperda in China is mainly chemical pesticides. However, long-term and large-scale use of chemical pesticides leads to the generation of pest resistance, the resurgence of pests, pesticide residues, and harm to human health and the ecological environment. Therefore, it has become a research hotspot to construct an effective and low-risk green control method to achieve sustainable management of Spodoptera frugiperda. Biological pesticides are preparations that use living organisms (fungi, bacteria, insect viruses, genetically modified organisms, natural enemies, etc.) or their metabolites (pheromones, auxins, naphthalene acetic acid, 2, 4-D, etc.) to kill or inhibit agricultural pests, and are one of the most effective control methods for Spodoptera frugiperda. Compared with chemical pesticides, biological pesticides are safer, more effective, environmentally friendly, and pests are less likely to develop resistance to them.

[0004] Insect pathogenic fungi are the largest group of insect pathogenic microorganisms, and more than 60% of insects in nature die from fungal diseases. Metarhizium is one of the most widely studied and applied insect pathogenic fungi. Metarhizium has a wide host range, can parasitize more than 200 species of pests in 8 orders and 30 families, is harmless to humans and animals, safe to natural enemy insects, and does not pollute the environment, and is a good substitute for chemical pesticides, and has been widely used in pest control. At present, the most common dosage form of Metarhizium insecticide is dispersible oil suspension and wettable powder. These dosage forms mainly use spray and powder application. However, Spodoptera frugiperda has the characteristics of hidden damage, that is, larvae of Spodoptera frugiperda above the second instar usually drill into the corn heart leaf or enter the fruiting area to damage corn, and it is difficult for spray and powder to directly contact the pests in the heart leaf, thereby seriously affecting the stability of the insecticidal effect of fungal insecticides and the control effect. In addition, under general natural conditions, the survival population level of insect pathogenic fungi in the field is very low under the conditions of low humidity and high temperature, and most spores can be quickly decomposed and disappeared in the environment, and the spore germination is restricted by environmental parameters such as temperature, humidity, time and space, and the insecticidal activity is not high, and the invasion and control effect of Metarhizium on pests is affected. Therefore, it is urgent to develop a new type of Metarhizium biological preparation, which has good insecticidal effect on Spodoptera frugiperda, can be applied to any part of the plant, including the relatively hidden parts such as the core of the seedling, the heart leaf and the bell mouth, and at the same time, due to the self-growth, germination, adhesion and invasion ability of the Metarhizium preparation in the field, it can be applied to any other part with pests, including the soil or the surrounding of the plant roots. SUMMARY

[0005] In view of this, one of the purposes of the present application is to provide a Metarhizium rileyi, which is characterized in that the strain number is GZUMr46, and the preservation number is CCTCC M 2023161.

[0006] The second purpose of the present application is to provide a Metarhizium granule, and the Metarhizium used in the granule is the preserved GZUMr46 strain, and the granule is the fermentation product of GZUMr46 and grains. The grains can be wheat, corn, sorghum, rice and the like. Any method that can ferment Metarhizium GZUMr46 and grains is feasible, and after fermentation is completed, Metarhizium adheres to the grains, that is, the granule, which does not need to be crushed and can be directly applied, and can be placed in any part of the plant to control Spodoptera frugiperda, especially can be conveniently placed in relatively hidden positions such as the core of the seedling, the heart leaf and the bell mouth, and has good overall insecticidal effect and plant protection effect. Of course, in order to facilitate the preservation of the granule, the fermented granule can be dried in a forced air drying oven at 30-35°C for 24h to reduce the moisture content, and then vacuum bag sealed and stored at 4-25°C

[0007] Further, the preparation method of the fermentation product comprises: GZUMr46 Metarhizium anisopliae is expandedly cultured in SMAY liquid medium, and the culture product is a liquid seed; grains are soaked in clean water for 24-48h, and the sterilized grains after soaking are taken as a solid culture medium; the liquid seed is inoculated into the solid culture medium at a volume-mass ratio of 10-20mL / 100g, and then solid fermentation is carried out.

[0008] Further,

[0009] The preparation method of the liquid seed comprises:

[0010] (1) SMAY solid culture medium is prepared, high-pressure steam sterilization is carried out, and then the SMAY plate is obtained by pouring into a sterile culture dish;

[0011] (2) SMAY liquid medium is configured, high-pressure steam sterilization is carried out, and then the SMAY liquid medium is reserved;

[0012] (3) GZUMr46 Metarhizium anisopliae is inoculated on the SMAY plate of step (1), and cultured at 25-30℃, light cycle 14L:10D for 7-25 days;

[0013] (4) spores on the plate after culture in step (3) are scraped to prepare a spore suspension of 1×10 8 Spores / mL, and the spore suspension is inoculated into the SMAY liquid medium of step (2) at a volume ratio of 1:(1000-2000), and expandedly cultured at 25-30℃ and 180-250r / min for 4-6 days, and the culture product is a liquid seed;

[0014] The solid culture medium is high-pressure sterilized and cooled after being divided into inoculation bags, and then the liquid seed is inoculated, the specification of the inoculation bag is (20-50cm)×(30-100)cm, and the filling amount of each inoculation bag accounts for 20-70% of the volume of the inoculation bag;

[0015] The fermentation condition of the solid fermentation is 28℃, humidity (70±5)%, light cycle L:D=16:8, and the culture is carried out for 15-30 days.

[0016] The third object of the application is to provide the application of Metarhizium anisopliae GZUMr46 in the prevention and treatment of Spodoptera frugiperda.

[0017] Further, Metarhizium anisopliae GZUMr46 is combined with emamectin benzoate or Bt preparation to prevent and treat Spodoptera frugiperda. GZUMr46 has a synergistic effect with emamectin benzoate or Bt preparation, and the virulence to Spodoptera frugiperda is improved.

[0018] The fourth object of the application is to provide the application of Metarhizium anisopliae GZUMr46 granules in the prevention and treatment of Spodoptera frugiperda.

[0019] Further, the Metarhizium granules can be applied to any part of the plant, including the trumpet, seed core or heart leaf, or directly to the roots or surrounding soil of the plant to control Spodoptera exigua. Spodoptera exigua has the characteristic of hidden damage, usually causing harm by drilling into the heart leaf, seed core, and trumpet. The granules of the present application can be applied to any part of the plant for all-round protection of the plant.

[0020] Further, the GZUMr46 Metarhizium granules are used in combination with one or more of sex pheromone, emamectin benzoate, Bt preparation and noctuid black egg wasp. The GZUMr46 Metarhizium granules have a synergistic effect when used in combination with one or more of sex pheromone, emamectin benzoate, Bt preparation and noctuid black egg wasp, thereby improving the control effect.

[0021] The present application directly isolates and screens a high-efficiency insecticidal Metarhizium strain GZUMr46 with good production performance and strong sporulation capacity from naturally infected Spodoptera exigua pupae. The strain GZUMr46 is obtained in the form of Metarhizium fungal granules through grain solid-state fermentation. The strain GZUMr46 has good insecticidal effect on Spodoptera exigua. The Metarhizium fungal granules of the present application have good growth, germination and adhesion capacity in the field environment, and can be applied to any part of the plant, including hidden locations in the plant, thereby having good insecticidal effect on Spodoptera exigua. The application of the Metarhizium granules effectively controls the population and quantity of Spodoptera exigua.

[0022] Biological preservation instructions

[0023] Metarhizium rileyi GZUMr46, Latin name Metarhizium rileyi, is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC M 2023161, the preservation date February 20, 2023, and the preservation address 299 Bajiyilu, Wuchang District, Wuhan City, Hubei Province. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Figure 1 is a graph of the separation and identification of the GZUMr46 strain of the present application and a phylogenetic tree;

[0025] Figure 2 Figure 2 is a graph of the pathogenicity of 1x10 8 spores / mL on 2nd and 4th instar larvae of Spodoptera exigua;

[0026] Figure 3 Figure 3 is a graph of the pathogenicity and half lethal time of 1x10 8 spores / mL combined with emamectin benzoate on 2nd and 4th instar larvae of Spodoptera exigua;

[0027] Figure 4 GZUMr461x10 8 Pathogenicity and half lethal time of spores / mL combined with 6 g / L Bt on 2,4 instar larvae of Spodoptera exigua Hübner;

[0028] Figure 5 Field test results of single agent and synergistic effect of the agent combined with Metarhizium rileyi granules of the present application. DETAILED DESCRIPTION

[0029] The present application will be described in detail below with reference to the embodiments and drawings, which are merely illustrative and are not limited to the scope of the present application. The present application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the present application shall be included in the scope of the present application.

[0030] Experimental Example 1: Strain Identification

[0031] (1) Morphological Identification

[0032] The naturally collected Spodoptera exigua pupae were streaked with a small amount of fresh spores under sterile conditions using an inoculation loop on SMAY plates and incubated at 28°C under a light cycle of 14L:10D. The strain growth was observed after 3-6 days, and the isolated strain was inoculated on SMAY medium and incubated at 28°C under a light cycle of 14L:10D for 15 days. The colony morphology, mycelium, and conidium morphology of the strain were observed using an optical microscope. The results showed that the colonies on the medium were white and short villous, and spores were produced after about 5-7 days, the colonies turned light green, and the spores turned dark green or yellow-green in the later stage, in the form of powder ( Figure 1 C, D, E). The conidia were oval, slightly sharp at one end, and slightly round at the other end ( Figure 1 F). Based on the above characteristics, the isolated strain should be Metarhizium rileyi, and the strain number was GZUMr46.

[0033] (2) Molecular Identification

[0034] According to the Fungal Genomic DNA Extraction Kit instructions, genomic DNA was isolated from mycelium. The isolated strain genomic DNA was used as a template, and fungal universal primers, ITS1, 5'-CCGTAGGTGAACCTGCGG-3', and ITS4, 5' TCCTCCGCTTATTGATATGC were used for ITS-rDNA sequence PCR amplification to identify the fungal strain. The PCR reaction system: Template (genomic DNA 20-50 ng / μl) 0.5 μL, 10x Buffer (with Mg 2+)2.5 μL, dNTP (2.5 mM each) 1 μL, enzyme 0.2 μL, F (10 uM) 0.5 μL, R (10 uM) 0.5 μL, add double distilled H2O to 25 μL; amplification procedure: 94°C pre-denaturation for 4 min, 94°C denaturation for 45 s, 55°C annealing for 45 s, 72°C extension for 1 min, a total of 35 cycles; 72°C extension for 10 min; 4°C storage. The PCR product was detected by 1% agarose gel electrophoresis, and the gel imaging results were recorded. The ITS-PCR amplification product was sequenced by Shengong Bioengineering (Shanghai) Co., Ltd., and the sequencing results are shown in SEQ ID NO. 1. The strain sequencing results were submitted to the NCBI database for BLAST comparison, the highest similarity sequence was selected, the MEGA software (ver 7.0) (Kumar, 2016) was used for multiple comparison by ClustalW and the maximum likelihood method (maximum likelihood, ML) was used to construct a phylogenetic tree.

[0035] The ITS sequences of several entomogenous fungi Metarhizium cylindrosporae (HQ165693.1, GU980047.1), Metarhizium flavoviride (AY646390.1), Pochonia rubescens (AB709860.1), Pochonia suchlasporia (FJ439582.2), Nomuraea rileyi (AF368501.1), Metarhizium rileyi (MH856926, MZ151847.1), Metarhizium anisopliae (FJ609314.1, KY437680.1), Metarhizium acridum (HQ331457.1), Metarhizium guizhouense (JF827150.1), Metarhizium pinghaense (MH249930.1, HM055447.1), Beauveria sungii (HQ880812.1) in GenBank were selected, Beauveria sungii was used as an outgroup, and a phylogenetic tree was constructed using MEGA7.0 Figure 1 G). It can be seen from Figure 1 G that the ITS sequence of strain GZUMr46 has the highest homology with Metarhizium rileyi (MZ151847.1), with a similarity of 98%. Combined with morphological characteristics, culture characteristics and molecular biology characteristic analysis, strain GZUMr46 was identified as Metarhizium rileyi.

[0036] Experimental Example 2: Laboratory virulence test of strains

[0037] Chemical pesticides emamectin benzoate (Dongguan Ruiguang Defense Biotechnology Co., Ltd.), Bt preparation (32000 IU / mg Bacillus thuringiensis wettable powder, Wuhan Kenono Biological Technology Co., Ltd.) and sex lure (Nanjing Xinannan Zhonglv Biological Technology Co., Ltd.) were purchased from pesticide companies for laboratory bioassay and field application.

[0038] 1. Virulence of GZUMr46 to 2nd and 4th instar larvae of Spodoptera frugiperda

[0039] For laboratory bioassay of fungal pathogens, a spore suspension of 1 × 10 8 spores / mL was prepared with paraffin oil solution, and the treatment with paraffin oil solution was used as control. Healthy 2nd and 4th instar larvae of uniform size were used, and 1 × 10 8 spores / mL spore suspension (0.2 μL per larva for 2nd instar larvae and 5 μL for 4th instar larvae) was dropped on the back of the larvae to determine the virulence of fungi to Spodoptera frugiperda larvae.

[0040] 2. Virulence of GZUMr46 combined with emamectin benzoate to 2nd and 4th instar larvae of Spodoptera frugiperda

[0041] (1) Emamectin benzoate single agent treatment: 5% and 10% emamectin benzoate were used as single agent to treat 2nd and 4th instar larvae, respectively, and the larvae were taken out after 15 s of soaking and fed with artificial feed.

[0042] (2) GZUMr46 single agent treatment: 2nd and 4th instar larvae were soaked in 1 mL of 1 × 10 8 spores / mL Tween spore suspension, and the larvae were taken out after 15 s of soaking, and the excess bacteria solution on the surface of the larvae was removed with filter paper, and the larvae were fed with artificial feed.

[0043] (3) To analyze the synergistic effect between emamectin benzoate and fungi, GZUMr46 was combined with emamectin benzoate for treatment: 5% and 10% emamectin benzoate and 1 × 10 8 spores / mL spore suspension were mixed to form a mixed solution, 2nd and 4th instar larvae were soaked in the mixed solution for 15 s, and the larvae were taken out, the excess bacteria solution on the surface of the larvae was removed with filter paper, and the larvae were fed with artificial feed.

[0044] 3. Virulence of GZUMr46 combined with Bt to 2nd and 4th instar larvae of Spodoptera frugiperda

[0045] (1) GZUMr46 single agent treatment: 2nd and 4th instar larvae were soaked in 1 mL of 1 × 10 8Spores / mL Tween spore suspension, soaked for 15 s, and the excess liquid on the surface of the larvae was removed with filter paper, and then observed and recorded.

[0046] (2) Bt single agent treatment: Prepare Bt solution with a concentration of 6 g / L. Fresh corn leaves are cut into small pieces and soaked in 6 g / L Bt solution for 15 s. Then the leaves are taken out and transferred to absorbent paper in a well-ventilated, light-proof area. The leaves are allowed to air dry naturally and used to feed 2nd and 4th instar larvae. Observe and record.

[0047] (3) To analyze the synergistic effect of Bt and fungi, GZUMr46 was combined with Bt treatment: 2nd and 4th instar larvae were soaked in 1 mL of 1x10 8 Spores / mL Tween spore suspension, soaked for 15 s, and the excess liquid on the surface of the larvae was removed with filter paper, and then observed and recorded.

[0048] 4. Experimental results

[0049] (1) Toxicity effect of GZUMr46 on 2nd and 4th instar larvae of Spodoptera exigua:

[0050] The results of indoor bioactivity determination showed that the green muscadine fungus strain GZUMr46 showed strong toxicity to 2nd and 4th instar larvae. After treatment with green muscadine fungus strain GZUMr46 1x10 8 spores / mL concentration, the mortality rates of 2nd and 4th instar larvae of Spodoptera exigua were 68%( Figure 2 A) and 72%( Figure 2 C) on the 9th day, while the mortality rates of the control group were only 19% and 18% for 2nd and 4th instar larvae, respectively. The median lethal time of green muscadine fungus strain GZUMr46 to 2nd and 4th instar larvae was 3.843 days( Figure 2 B) and 4.38 days( Figure 2 D), respectively, while the median lethal time of the control group was 18d and 21d for 2nd and 4th instar larvae, respectively. There was a significant difference in mortality rate between the control group and the treatment group. After being killed by green muscadine fungus GZUMr46, the larvae became rigid. After one day of moist incubation in the incubator, white mycelium grew on the surface of the larvae. After 3-4 days of moist incubation, green conidia grew. After 7 days, the spores lost their color and fell off( Figure 1 A, B). Green muscadine fungus GZUMr46 had a significant insecticidal effect on Spodoptera exigua larvae.

[0051] (2) Toxicity effect of GZUMr46 combined with emamectin benzoate on 2nd and 4th instar larvae of Spodoptera exigua:

[0052] 1) Toxicity effect of GZUMr46 combined with 5% emamectin benzoate on 2nd instar larvae of Spodoptera exigua

[0053] The results showed that 5 days after treatment, the cumulative survival rates of the second-instar larvae treated with GZUMr46, 5% emamectin methyl benzoate, and GZUMr46 combined with 5% emamectin methyl benzoate were 73.3%, 50%, and 13.3%, respectively. Figure 3 A); 5% emamectin methyl benzoate and 1×10 8 The median lethal time of a single dose of GZUMr46 to the second-instar larvae was 4.2 days and 7.65 days respectively. Figure 3 B), and 1×10 8 The median lethal time of the group treated with GZUMr46 and 5% emamectin methyl benzoate was 3.16 days ( Figure 3 B) showed significant differences, indicating that the mortality rate increased after 5% emamectin methyl benzoate was mixed with Metarhizium anisopliae GZUMr46, Metarhizium anisopliae acted slowly, while emamectin methyl benzoate acted quickly, and the mixing of reduced doses of emamectin methyl benzoate with Metarhizium anisopliae GZUMr46 increased the insecticidal toxicity.

[0054] 2) Toxicity of GZUMr46 combined with 10% emamectin methyl benzoate to the 4th instar larvae of Spodoptera frugiperda

[0055] The results showed that the mixture of 10% emamectin methyl benzoate and Metarhizium anisopliae GZUMr46 had a significant control effect on the 4th instar larvae of Spodoptera frugiperda. Six days after treatment, the cumulative survival rates of the 4th instar larvae treated with Metarhizium anisopliae GZUMr46, 10% emamectin methyl benzoate, and 10% emamectin methyl benzoate and Metarhizium anisopliae were 86.67%, 80%, and 43.3%, respectively. Figure 3 C); 10% emamectin methyl benzoate and 1×10 8 The median lethal time of the fourth instar larvae treated with spores / mL of Metarhizium anisopliae GZUMr46 was 5.68 days ( Figure 3 D), significantly shorter than 8.67d and 1×10 8 spores / mL GZUMr46 treated alone was 10.37d( Figure 3 D) This indicates that the combined use of 10% emamectin methyl benzoate and Metarhizium anisopliae GZUMr46 accelerates the insecticidal effect.

[0056] (3) Toxicity of GZUMr46 combined with Bt against the 2nd and 4th instar larvae of Spodoptera frugiperda:

[0057] 1) The experimental results showed that the combined use of GZUMr46 and Bt had certain differences in pathogenicity against the 2nd and 4th instar larvae of Spodoptera frugiperda.

[0058] 2) Toxicity of GZUMr46 combined with 6g / L Bt against the second-instar larvae of Spodoptera frugiperda

[0059] On the 4.5th day after treatment, the cumulative survival rates of the second-instar larvae treated with Metarhizium anisopliae GZUMr46, Bt, and GZUMr46 combined with Bt were 83.3%, 36.7%, and 3%, respectively. Figure 4 A); LT50 are: 7.64d, 3.66d, 2.58d ( Figure 4 B) showed significant differences, indicating that the insecticidal effect of Metarhizium anisopliae GZUMr46 was accelerated after mixing with Bt;

[0060] 3) Toxicity of GZUMr46 combined with 6g / L Bt against the fourth-instar larvae of Spodoptera frugiperda

[0061] The cumulative mortality of the fourth-instar larvae treated with GZUMr46 in combination with Bt was higher than that of the single-dose treatments of Bt and GZUMr46. On the 6th day after treatment, the cumulative survival rates of the fourth-instar larvae treated with GZUMr46, Bt, and GZUMr46 in combination with Bt were 86.67%, 53.3%, and 16.67%, respectively. Figure 4 C); 1×10 8 The median lethal time of the mixture of spores / mL Metarhizium anisopliae GZUMr46 and 6g / L Bt to the 4th instar larvae was 3.81d ( Figure 4 D), also shorter than 1×10 8 Spores / mL GZUMr46(LT 50 =10.37d) and 6g / LBt alone (LT 50 =5.18d)( Figure 4 D).

[0062] Experimental Example 3: Production of Metarhizium anisopliae fungal granules

[0063] 1. Production method of Metarhizium anisopliae fungal granules

[0064] (1) Prepare SMAY solid culture medium: weigh 40 g of maltose, 10 g of peptone, 10 g of yeast extract, and 20 g of agar, and dilute to 1 L with pure water; sterilize under high pressure for 20 min, cool to about 50°C, and transfer the culture medium into a sterile culture dish on a sterile operating table to obtain a SMAY plate.

[0065] (2) Prepare SMAY liquid medium: weigh 40 g of maltose, 10 g of peptone, and 10 g of yeast extract, dilute to 1 L with pure water, sterilize under high pressure for 20 min, and set aside.

[0066] (3) Inoculate GZUMr46 Metarhizium on SMAY plate and cultivate at 28℃, 14L:10D photoperiod for 15 days.

[0067] (4) Scrape spores on the plate to make 1×10 8 spores / mL spore suspension, take 100μL spore suspension to inoculate 300mL flask containing 100mL SMAY liquid medium, cultivate at 28℃, 220r / min for 5 days, and obtain the cultivation product as liquid seed for next step solid state fermentation.

[0068] (5) Weigh the grains soaked in water for 24 hours and put them into 20cm×50cm inoculation bag (purchased from Wenzhou Shangjun Plastic Products Co., Ltd.), the weight of the soaked grains in each bag is 100g, then sterilize at 121℃ for 30 minutes.

[0069] (6) Inoculate the liquid seed of step (4) into the inoculation bag containing grains of step (5), the inoculation amount of liquid seed in each bag is 10mL, then cultivate at 28℃, humidity (70±5)%, photoperiod L:D=16:8 for 15-30 days, obtain the fermentation product of GZUMr46 Metarhizium and grains, and the fermentation product is GZUMr46 Metarhizium granules.

[0070] 2. Spore production, germination rate, contamination rate and water content determination of GZUMr46 Metarhizium granules

[0071] The solid state fermentation ends, which is granules, and the spore production of the granules (wheat, corn, rice) after the fermentation ends is determined. The results show that the spore production of wheat is the highest, which is 1.8125×10 9 spores / g, 3.8125×10 9 spores / g and 8.2825×10 9 spores / g on the 15th day, 20th day and 25th day after inoculation (Table 1). The spore production of rice and corn is similar on the 15th day, 20th day and 25th day after inoculation, which is 4.375-5.875×10 8 spores / g, 1.1-1.19×10 9 spores / g and 1.2-1.3×10 9 spores / g (Table 1).

[0072] Table 1 Spore production of GZUMr46 granules on different media

[0073]

[0074]

[0075] The moisture content, germination rate and contamination rate of the spores produced by the wheat were further analyzed. The moisture content of the germinated spores of the wheat was 7.07%, and the moisture content of the wheat culture medium after removing the spores was 7.13%. The spore germination rate was 95.81%, and the contamination rate was 1.3%.

[0076] The fermented Metarhizium granules were dried in a blast drying oven at 30-35°C for 24 hours to reduce the moisture content, then vacuum bag sealed and stored at 4-25°C for standby use. The Metarhizium granules obtained by fermenting wheat were used in the following field experiments.

[0077] Experimental Example 4: Field Application

[0078] From May to October 2022, field experiments were conducted in Tongzhou Town, Pingtang County, Qian Nan Buyi and Miao Autonomous Prefecture, Guizhou Province. A total of 7 pairs of plots were designed in the test field, including control and treatment groups, as shown in Table 2. Each plot included 7 ridge columns of control and treatment groups, with two side ridges as isolation columns without any treatment, and 5 inner ridge columns as control and treatment, respectively. Each ridge column was composed of two rows, with about 120 corn seedlings in each row, and 3-6 leaves at the beginning.

[0079] Two field experiments were conducted. The first experiment monitored the field armyworm adult moths and investigated the parasitic effect of the noctuid black wasp on armyworm eggs; the second experiment applied Metarhizium granules and investigated the number of armyworm larvae and the rate of intact corn plants.

[0080] In the first field experiment, the control effect of sex pheromone and noctuid black wasp on armyworm adults and eggs was analyzed respectively. The field experiment was conducted on July 12 in CK0 / T0, CK1 / T1 and CK2 / T2 plots, when the corn seedlings had 3-5 leaves. CK0 and T0 plots were for adult detection, with two sex pheromones for adult detection respectively. Five inner ridges of CK1 and T1 plots were also placed with two sex pheromones for adult detection; five inner ridges of CK2 and T2 plots were placed with one block of noctuid black wasp eggs on both sides of each ridge, and the eggs were fixed on the back of the corn leaves with double-sided tape. On July 22, the number of armyworm larvae and the number of adult moths were investigated.

[0081] The second field experiment was conducted on July 31, 2008 in CK1-6 and T1-6 plots. The eggs of H. zea were applied on both sides of five inner ridges of CK1-6 and T1-6 plots, and the eggs were fixed on the back of corn leaves with double-sided tape. For CK1 and T1, two sex pheromone traps were set for both control and treatment groups, but the treatment group was added with Metarhizium granules, which were applied to the core of each corn seedling, the trumpet or the heart leaf to analyze the synergistic effect of M. anisopliae GZUMr46 and sex pheromone. CK2 and T2 were the groups treated with Trichogramma and fungi. After the Trichogramma was released in the first field experiment, the Trichogramma was not released again in CK2 and T2 groups, and the Metarhizium granules were applied to the T2 plot to analyze the synergistic effect of M. anisopliae GZUMr46 and Trichogramma. CK3 and T3 were the groups treated with fungi alone. In CK3 and T3 plots, one non-inoculated grain (wheat grain was soaked in water for 24 hours and then sterilized by high-pressure steam for 30 minutes, and then cooled) or one Metarhizium granule (elliptical, length: 0.6 mm-1 cm) was placed in each corn seedling core or heart leaf, respectively. CK4 and T4 were the groups treated with emamectin benzoate and fungi. According to the recommended amount in the field, the emamectin benzoate EC was mixed with non-inoculated grain or Metarhizium granule in the control group, and the EC was adhered to the grain or granule and applied to the corn seedling core or heart leaf in the CK4 and T4 ridge rows. CK5 and T5 were the groups treated with Bt and fungi. The Bt preparation was mixed with non-inoculated grain or Metarhizium granule, and the Bt powder was adhered to the grain or granule and applied to the corn seedling core or heart leaf or trumpet in the CK5 and T5 ridge rows, respectively. CK6 and T6 were the groups treated with integrated control. Two sex lures and Trichogramma (released in the first field experiment) were set in CK6 and T6 plots, respectively, and emamectin benzoate and Bt were mixed with sterile grain or fungal granules and then applied to the corn seedling core, heart leaf or trumpet.

[0082] Table 2. Test reagents and test design and results of the second field experiment

[0083]

[0084]

[0085] The results showed that:

[0086] (1) The field test was conducted from July 12 to August 23. The first field test was conducted on July 12, when the corn seedlings had 3-6 leaves, and there were no Spodoptera frugiperda eggs or larvae in the corn. In the field test, two sex pheromones were placed in each of the CK0 and T0 plots for adult monitoring. In the first field test, the average number of Spodoptera frugiperda adults captured by CK0 and T0 sex pheromones was 7.5 and 6.5, respectively, and then in the second investigation, CK0 and T0 sex pheromones further captured 1.5 and 2 Spodoptera frugiperda adults, respectively Figure 5 A) and reduced the number of Spodoptera frugiperda larvae from 100% (CK3) to 30% (CK0), 29% (T0), and increased the plant integrity rate from 0% to 52.8% (CK0), 31% (T0) Figure 5 B).

[0087] (2) In the first field test, the effect of sex pheromones on Spodoptera frugiperda adults in CK1 and T1 plots and the effect of Tachinaephagus sp. on Spodoptera frugiperda eggs in CK2 and T2 plots were mainly investigated, and 1 egg block was released on each inner ridge of all CK1-6 and T1-6 plots before application to maintain consistency. The results showed that each sex pheromone in the T1 area averaged 6 adults Figure 5 C, the average number of larvae per hundred corn plants in the T1 area was 20.1%, which was significantly lower than that in the control area (CK1, 50.8%) Figure 5 C). In the first field test, Tachinaephagus sp. had an effect of 17.6% per hundred corn plants Figure 5 E), which was significantly lower than that in the control plot (CK2, 45.5%) Figure 5 E). The results showed that both sex pheromones and Tachinaephagus sp. could effectively reduce the number of Spodoptera frugiperda adults and eggs in the field test, and further reduce the number of larvae.

[0088] (3) In the second field test, we collected all the egg blocks and released an average of 1 egg block per ridge before application. The application of Metarhizium anisopliae GZUMr46 granules alone could reduce the number of larvae from 100% (CK3) to 40.0% (T3), and increase the number of intact plants from 0% (CK3) to 40.0% (T3) Figure 5 G). In the second field test, the application of sex pheromones alone only slightly reduced the number of larvae from 100.0% (CK3) to 78.0% (CK1), and slightly increased the number of undamaged plants from 0.0% (CK3) to 12.2% (CK1) Figure 5 D). The combination of sex pheromones and fungal granules (T3) could not significantly reduce the number of larvae (52.2%) Figure 5 D), but the combination of the two could significantly increase the number of intact plants from 0 (CK3) to 71.0% (T1) Figure 5D). The synergistic effect of Metarhizium anisopliae granules and sex pheromone was revealed from the plant protection effect.

[0089] (5) After the first field release of T. urticae, no additional parasitoids were released in CK2 and T2 plots, considering that the parasitoids could continue to reproduce in the field. The second experiment showed that one month after the release of T. urticae alone, the amount of H. armigera larvae decreased to 68.9% (CK2) Figure 5 F), but was significantly lower than the amount of larvae in the control (CK3), and the intact plant rate of corn plants reached 37.2% (T2) Figure 5 F). Compared with the use of T. urticae or Metarhizium anisopliae granules alone, the combined treatment of T. urticae and Metarhizium anisopliae granules could further reduce the number of larvae to 32.5% and increase the intact plant rate to 78.7% (T2) Figure 5 F). This revealed the synergistic effect of Metarhizium anisopliae granules and T. urticae from the control of the number of larvae and the plant protection effect.

[0090] (6) Compared with the control, the single application of emamectin benzoate only reduced the number of larvae from 100.0% to 80.3%, but significantly increased the rate of non-damaged plants from 0.0% to 80.3% (CK4) Figure 5 H). The combined treatment of emamectin benzoate and Metarhizium anisopliae granules (T4) could reduce the number of larvae (40.0%) to the level of Metarhizium anisopliae granules alone (40%), and maintain the rate of non-damaged plants (79.1%) to the level of emamectin benzoate alone (80.3%) (T4) Figure 5 H). The single treatment of Bt preparation (CK5) could not significantly reduce the number of larvae (89.1%), but compared with the control (CK3), it could significantly increase the rate of non-damaged plants from 0.0% to 23.7% (CK5) Figure 5 I). The combined treatment of Bt and Metarhizium anisopliae granules could reduce the number of larvae to 43.0% and increase the intact plant rate to 48.0% (T5) Figure 5 I), which was equivalent to the level of Metarhizium anisopliae granules alone. CK6 and T6 were comprehensive treatment plots, consisting of sex pheromone, T. urticae (first field release), emamectin benzoate, Bt preparation, and sterile grain (CK6) or Metarhizium anisopliae granules (T6). Compared with the control CK3, the number of larvae in the CK6 plot decreased to 47.2% and the intact plant rate increased to 76.2% (CK6) ​ J). While the number of larvae in the T6 plot further decreased to 32.7% and the rate of non-damaged plants was similar to that in the CK6 plot (75.1%) (T6) ​ J).

[0091] In summary, the GZUMr46 Metarhizium anisopliae granules combined with one or more of sex pheromone, emamectin benzoate, Bt preparation and noctuid black egg parasitic wasp can improve the control effect, and is an effective method to improve the control of Helicoverpa armigera larvae, adults and protect the plant integrity.

[0092] It should be noted that the experimental operations involved in the above experimental examples have certain universality, and therefore are not described in detail. The part not described in detail refers to the related operations in other experimental examples or the prior art, and will not be repeated here.

Claims

1. An inoculant characterized in that, Including Metarhizium anisopliae ( Metarhizium rileyi ) GZUMr46 and emamectin methyl benzoate, or, including Metarhizium anisopliae GZUMr46 and Bt preparation; the preservation number of Metarhizium anisopliae GZUMr46 is CCTCC M 2023161, and the preservation unit is China Center for Type Culture Collection.

2. A Metarhizium granule, characterized in that, The Metarhizium in the granules is the GZUMr46 strain of claim 1, the granules are the fermentation of GZUMr46 and grains, and the grains are wheat.

3. The Metarhizium granule of claim 2, wherein The preparation method of the fermentation includes: GZUMr46 Metarhizium is expandedly cultured in SMAY liquid medium, and the culture product is a liquid seed; the grains are soaked in water for 24-48 h, and the soaked grains are used as a solid culture medium; the liquid seed is inoculated into the solid culture medium at a volume-to-mass ratio of 10-20 mL / 100 g, and then solid fermentation is performed.

4. The Metarhizium granules of claim 3, characterized in that, The preparation method of the liquid seed includes: (1) preparing SMAY solid culture medium, sterilizing by high-pressure steam, and then pouring into sterile culture dishes to obtain SMAY plates; (2) preparing SMAY liquid medium, sterilizing by high-pressure steam, and then reserving; (3) inoculating GZUMr46 Metarhizium on the SMAY plates of step (1), and culturing at 25-30 ℃ with a light cycle of 14L:10D for 7-25 days; (4) Scrape the spores on the plate after step (3) to make a spore suspension of 1 x 10 8 spores / mL, inoculate the spore suspension into the SMAY liquid medium of step (2) at a volume ratio of 1: (1000-2000), and cultivate at 25-30 °C with shaking at 180-250 r / min for 4-6 days. The cultivation product is a liquid seed. The solid culture medium is high-pressure sterilized after being divided into inoculation bags, and the liquid seed is inoculated, the inoculation bag has a size of (20-50) cm×(30-100) cm, and the filling amount of each inoculation bag accounts for 20-70% of the volume of the inoculation bag; The fermentation conditions of the solid fermentation are 28 ℃, humidity (70±5) %, and a light cycle of L:D=16:8, and the culture is performed for 15-30 days.

5. The use of the microbial agent of claim 1 in the prevention and treatment of Spodoptera frugiperda.

6. The use of the Metarhizium granules of any one of claims 2 to 4 in the prevention and treatment of Spodoptera frugiperda.

7. The use according to claim 6, characterized in that The Metarhizium granules are used to prevent and treat Spodoptera frugiperda by being placed in any part of the plant or directly applied to the roots of the plant or the soil around the plant, and the any part includes the inside of the trumpet of the plant, the seed core, or the heart leaf.

Images