A method for simultaneous detection of two ARGs based on continuously color-changing silver nanocluster signal amplification

Abstract

The present invention discloses a method for simultaneously detecting two ARGs based on continuous color-changing silver nanocluster signal amplification, which belongs to the field of analytical detection technology. The probe used in the detection method of the present invention includes a probe DNA silver nanocluster H1-AgNCs and a probe enhancement sequence H2, wherein the two ends of H1-AgNCs respectively stabilize silver nanoclusters with different weak fluorescence emissions, and the two ends of the enhancement sequence H2 are respectively rich in G and T sequences. The target gene and the two probe sequences are alternately connected, and the color-changing silver nanocluster is close to the G / T-rich sequence to tune and amplify the fluorescence signal. The present invention can achieve enzyme-free, simple, and highly specific simultaneous detection of two ARGs by designing two DNA chains. At the same time, the linear DNA structure containing the continuous color-changing silver nanocluster beacon connected by the target gene realizes the transduction and amplification of the two fluorescent signals, which can be widely used for rapid screening or quantitative detection of antibiotic resistance genes in various environmental water samples.

Description

Technical Field

[0001] The present invention belongs to the technical field of analysis and detection, and relates to a method for simultaneously detecting two ARGs based on continuously color-changing silver nanocluster signal amplification. Background Art

[0002] In recent years, with the rapid increase in antibiotic production and use, the emergence of antibiotic-resistant bacteria (ARBs) and antibiotic resistance genes (ARGs) has triggered a global crisis for human health and the environment. ARGs have become globally recognized as emerging pollutants, and various environmental water bodies have become ideal sites for the spread of ARGs and the generation of new ARGs. There is an urgent need to develop reliable methods for the analysis of ARGs in complex environmental samples to assess the generation, distribution, concentration, threat, and potential ecological safety risks of ARGs in aquatic environments.

[0003] Traditional ARGs detection methods mainly rely on polymerase chain reaction (PCR), such as quantitative real-time PCR (qRT-PCR), droplet digital PCR (ddPCR) and metagenomic sequencing. However, PCR-based methods usually require sufficient primers for amplification and rely on obtaining sufficiently high-quality and representative DNA. Each ARGs detection requires the construction of a corresponding standard curve, which limits the detection speed. At the same time, the complex experimental process and reagent costs make it unsuitable for rapid real-time detection of many routine environmental samples. DNA-templated silver nanoclusters have easy synthesis, excellent photostability, good biocompatibility and tunable fluorescence properties, and can replace toxic dyes, quantum dots, and expensive organic fluorophores to become excellent fluorescent probes in the field of analytical detection. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a method for the simultaneous detection of two ARGs based on continuously color-changing silver nanocluster signal amplification. This method uses synthetic DNA-templated silver nanoclusters as label-free fluorescent probes. By complementary pairing of the target gene with the probe, the silver nanoclusters are positioned near a fluorescence-tuning sequence, forming a linear DNA structure with continuously color-changing silver nanocluster beacon branches. This significantly enhances the green and red fluorescence signals, enabling the simultaneous detection of two antibiotic resistance genes.

[0005] The object of the present invention is to achieve the following goals:

[0006] The first aspect of the present invention provides an ARGs detection probe based on color-changing silver nanoclusters, comprising a fluorescent probe DNA silver nanoclusters H1-AgNCs and an enhancement probe H2;

[0007] The fluorescent probe DNA silver nanocluster H1-AgNCs contains sequences that stabilize the silver nanocluster at the 5' and 3' ends (bold sequences), a base sequence that is partially complementary to the target gene tet-A (dotted underline sequence), a base sequence that is partially complementary to the target gene sul-1 (single underline sequence), and a 3-nucleotide-long fluorescence stabilizing sequence (wavy underline sequence). The nucleotide sequence of the probe is:

[0008]

[0009] The enhanced probe H2 comprises a T-rich enhancer sequence at the 5' end, a G-rich enhancer sequence at the 3' end, a base sequence complementary to the rest of the target gene tet-A (single underline sequence), a base sequence complementary to the rest of the target gene sul-1 (dotted underline sequence), and a 3-nucleotide fluorescence stabilizing sequence (wavy underline sequence). The probe sequence is:

[0010]

[0011] Based on the above technical solution, the synthesis method of the fluorescent probe DNA silver nanoclusters H1-AgNCs is further as follows: dissolving the DNA template in phosphate buffer, adding AgNO3 solution, mixing and incubating at 0-5°C for 10-60 minutes, then adding freshly prepared NaBH4 solution, mixing and reacting at room temperature in the dark overnight to obtain H1-AgNCs solution.

[0012] Based on the above technical solution, further, the molar ratio of DNA template, AgNO3, and NaBH4 is 1:(3-15):(3-15), preferably 1:6:6.

[0013] The second aspect of the present invention provides an ARGs detection method based on color-changing silver nanoclusters, using the above-mentioned probe, comprising the following steps: adding the fluorescent probe DNA silver nanoclusters H1-AgNCs and the enhanced probe H2 to a buffer solution in a molar ratio of 1:2 to 2:1, then adding a test sample containing the target gene ARGs, mixing evenly and reacting, and detecting the fluorescence intensity using a fluorescence spectrophotometer.

[0014] Based on the above technical solution, further, the target gene ARGs are one or both of tet-A and sul-1, and the nucleic acid sequence of tet-A is:

[0015] 5'-GGACAACATTGCTTGCAGCGCCGGCATTCCGA-3';

[0016] The nucleic acid sequence of sul-1 is:

[0017] 5′-AAGAGCGGCGCAATACGTCTGATCTCATCGGC-3′.

[0018] Based on the above technical solution, further, the buffer is selected from one of Tris-HAc buffer, Tris-HCl buffer, Tris-HNO3 buffer, PBS buffer, and ultrapure water, preferably Tris-HAc buffer.

[0019] Based on the above technical solution, further, the reaction is carried out under light-proof conditions, and the reaction temperature is 4-50°C, preferably 37°C;

[0020] Based on the above technical solution, further, the reaction time is 5 to 75 minutes, preferably 55 minutes.

[0021] Based on the above technical solution, further, the parameters of the fluorescence spectrophotometer were set as follows: the excitation slit and the emission slit were 10 nm, and the scanning voltage was 700V.

[0022] Based on the above technical solution, further, when the target gene tet-A is detected, green fluorescence is lit, and the pH of the fluorescence reaction system is 3.6-5.0.

[0023] Based on the above technical solution, further, when detecting the target gene sul-1, the red fluorescence is enhanced, and the pH of the fluorescence reaction system is 5.6-7.0.

[0024] Based on the above technical solution, further, the simultaneous detection of two target genes was carried out in Tris-HAc buffer at pH 4.4.

[0025] Based on the above technical solution, the two target genes are further paired with H1-AgNCs and H2 respectively. When one of the target genes is detected, the other target gene acts as a bridging DNA. Through the alternating connection of the target gene, H1-AgNCs and H2, an infinitely extendable linear DNA structure containing continuously color-changing silver nanocluster beacons is formed.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. The present invention uses DNA-templated color-changing silver nanoclusters as fluorescent probes to develop a simple, rapid, and low-cost ARGs detection method. Only two DNA probe sequences need to be designed to achieve the simultaneous detection of two antibiotic resistance genes. The analysis method is economical and simple.

[0028] 2. A linear DNA structure containing a continuously color-changing silver nanocluster beacon triggered by the target gene realizes the transduction and amplification of the fluorescent signal.

[0029] 3. The method of the present invention is enzyme-free and has good specificity. It can effectively distinguish single-base mutations and other interfering sequences, and provides a simple and efficient platform for the rapid screening and quantitative detection of ARGs in complex environmental water samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention, the drawings related to the embodiments are briefly introduced below.

[0031] Figure 1 This is a schematic diagram of the principle of the method for simultaneously detecting two ARGs based on continuously color-changing silver nanocluster signal amplification of the present invention.

[0032] Figure 2 The feasibility analysis of the fluorescence spectrum of the detection method of the present invention (a) and the feasibility verification of natural polyacrylamide gel electrophoresis (b) are shown.

[0033] Figure 3 The detection conditions of the detection method of the present invention are optimized, wherein: (a): optimization of tet-A detection pH, (b): optimization of sul-1 detection pH, (c): optimization of DNA-templated silver nanocluster synthesis ratio, (d): optimization of reaction temperature, (e): optimization of reaction buffer, and (f): optimization of reaction time.

[0034] Figure 4 This is a sensitivity analysis of the detection method of the present invention for detecting two ARGs, wherein: (a): fluorescence spectra of tet-A at different concentrations, (b): linear relationship between fluorescence intensity and tet-A concentration, (c): fluorescence spectra of sul-1 at different concentrations, (d): linear relationship between fluorescence intensity and sul-1 concentration.

[0035] Figure 5 The detection method of the present invention detects tet-A (a) and sul-1 (b) for selectivity analysis.

[0036] Figure 6 Performance analysis of the detection method of the present invention for simultaneous detection of tet-A (a) and sul-1 (b), wherein: (a): fluorescence spectra of different concentrations of tet-A and sul-1, (b): linear relationship between fluorescence intensity and tet-A and sul-1 concentrations. DETAILED DESCRIPTION

[0037] The present invention is described in detail below with reference to the embodiments, but the embodiments of the present invention are not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative work all fall within the scope of protection of the present invention.

[0038] The detection principle of this application is as follows Figure 1 As shown, the ends of the designed fluorescent probe sequence (H1) served as templates, and weakly fluorescent silver nanoclusters (H1-AgNCs) were synthesized by reducing silver nitrate with sodium borohydride. The designed enhanced probe sequence H2 carried G-rich and T-rich sequences at both ends, respectively. When the target gene was present, both complementarily paired with H1-AgNCs and H2, respectively, to alternately form extendable linear DNA structures. The target gene tet-A caused the color-changing silver nanocluster at the 3' end of H1-AgNCs to approach the T-rich sequence of H2, significantly enhancing green fluorescence. The target gene sul-1 caused the color-changing silver nanocluster at the 5' end of H1-AgNCs to approach the G-rich sequence, significantly enhancing red fluorescence. By measuring the emission intensities of the two fluorescences, simultaneous detection of two target ARGs was achieved.

[0039] Table 1. DNA sequences involved in the examples

[0040]

[0041] Example 1 Construction of a probe detection system based on color-changing silver nanoclusters

[0042] a) Design of probe sequence in this embodiment:

[0043] The detection probe consists of a fluorescent probe DNA silver nanocluster sequence H1-AgNCs and an enhancement probe sequence H2;

[0044] The H1-AgNCs contain sequences that stabilize silver nanoclusters at the 5' and 3' ends, a base sequence that is partially complementary to the target gene tet-A, a base sequence that is partially complementary to the target gene sul-1, and a fluorescent stabilizing sequence of 3 nucleotides in length;

[0045] The H2 comprises a T-rich enhancement sequence at the 5' end, a G-rich enhancement sequence at the 3' end, a base sequence partially complementary to the target gene tet-A, a base sequence partially complementary to the target gene sul-1, and a fluorescence stabilizing sequence of 3 nucleotides.

[0046] b) Synthesis of DNA-templated silver nanoclusters:

[0047] Add 10 μL of sequence H1 (100 μM) to phosphate buffer (10 mM, pH 6.6), heat at 95°C for 5 minutes, rapidly cool for 10 minutes, then add 5 μL of AgNO₃ solution, vortex to mix, and incubate at 4°C for 30 minutes. Then, add 5 μL of freshly prepared NaBH₄ solution and shake vigorously for 1 minute. The resulting mixture reacts overnight at room temperature in the dark and refrigerate until use.

[0048] c) Constructing a fluorescence detection system:

[0049] 2.5 μL of H2 (10 μM) was dissolved in 20 mM Tris-HAc buffer, heated at 95°C for 5 minutes, and rapidly cooled for 10 minutes. Then, 2.5 μL of H1-AgNCs and 2 μL of different concentrations of two target ARGs (tet-A and sul-1) were added to create a 50 μL mixture. The reaction was incubated at 25°C in the dark for 55 minutes and measured using a fluorescence spectrophotometer. Instrument parameters were set as follows: excitation wavelengths of 495 nm and 580 nm, emission wavelength ranges of 520–650 nm and 600–720 nm, excitation slits of 10 nm, emission slits of 10 nm, and a voltage of 700 V.

[0050] Example 2 Verification of the feasibility of simultaneous detection of two ARGs using a probe based on color-changing silver nanoclusters

[0051] a) Fluorescence spectrum verification scheme feasibility

[0052] Figure 2 In the fluorescence spectrum graph shown in a, the left half of the figure shows the fluorescence intensity curves in the absence and presence of tet-A, from bottom to top, respectively. The right half of the figure shows the fluorescence intensity curves in the absence and presence of sul-1, from bottom to top, respectively. As can be seen from the figure, when the target gene is absent, there are no significant signal emission peaks at 549nm and 641nm. After the target gene tet-A is added, a significant green fluorescence emission peak appears at 549nm. After the target gene sul-1 is added, a significantly enhanced red fluorescence emission peak appears at 641nm. The results show that the present invention can be successfully applied to the simultaneous detection of two ARGs.

[0053] b) Feasibility verification by native polyacrylamide gel electrophoresis

[0054] The hybridization results of the target gene and the probe were further verified by 15% native polyacrylamide gel electrophoresis. The hybridization products and oligonucleotides were electrophoresed at a constant voltage of 500 V for 120 min in 1× TBE buffer (90 mM Tris, 90 mM phosphoric acid, 1 mM EDTA; pH 7.9) and then stained with SYBR TM The sections were stained with gold solution for 20 minutes, washed three times with ultrapure water, and then photographed using a gel imaging system.

[0055] Figure 2In b, lanes 1-3 indicate the positions of the two target genes and two probes after electrophoresis. Lanes 4-7 show that each target gene can be complementary paired with each probe individually. Lanes 8 and 9 show the single color-changing silver nanocluster beacon formed when a single target gene coexists with two probes. Lane 10 demonstrates the formation of an extendable linear DNA structure after the simultaneous addition of two target genes. Lane 11 shows that when neither target gene is present, the two probes exist alone and do not form a complementary structure, indicating that the detection is free of false positive signal interference. The gel electrophoresis results demonstrate that the present invention can be successfully applied to the simultaneous detection of two ARGs and that a linear DNA structure containing continuously color-changing silver nanoclusters is formed.

[0056] Example 3 Optimization of detection method conditions

[0057] Several important conditions during the use of the method were optimized, including reaction pH, the ratio of DNA, AgNO3 and NaBH4 during H1-AgNCs synthesis, reaction temperature, reaction buffer, and reaction temperature. The specific process is as follows:

[0058] a) Optimization of pH

[0059] This example investigates the effect of pH on the fluorescence intensity of the detection system. When detecting tet-A (based on the adjacent fluorescence enhancement of the T-rich sequence), eight pH values ​​of 3.6, 3.8, 4.0, 4.2, 4.4, 4.6, 4.8, and 5.0 were optimized. The optimal reaction pH was 4.2. However, this proximity enhancement strategy was greatly affected by pH. When the pH of the reaction system was higher than 4.4, the fluorescence emission peak at 549 nm decreased significantly ( Figure 3 a). When detecting sul-1 (based on adjacent fluorescence enhancement of G-rich sequences), eight pH values ​​of 5.6, 5.8, 6.0, 6.2, 6.4, 6.6, 6.8, and 7.0 were optimized, and the optimal reaction pH was 6.6 ( Figure 3 b) This detection strategy is significantly less affected by pH than T-rich sequences.

[0060] b) Synthesis ratio of DNA-templated silver nanoclusters

[0061] During the synthesis of DNA-templated silver nanoclusters, changing the ratio of DNA, AgNO3 and NaBH4 will affect the particle size of DNA silver nanoclusters, thereby changing their fluorescence emission intensity. The ratios of DNA, silver nitrate and sodium borohydride are set to 1:3:3, 1:6:6, 1:9:9, 1:12:12 and 1:15:15. Figure 3c It can be seen that for tet-A, the fluorescence value of the molar ratio of 1:9:9 is slightly higher than that of 1:6:6, and for sul-1, the fluorescence value of the molar ratio of 1:6:6 is significantly higher than that of 1:9:9. Considering all factors, the DNA:AgNO3:NaBH4 molar ratio of 1:6:6 is selected as the optimal ratio for synthesizing H1-Ag NCs.

[0062] c) Optimization of reaction temperature

[0063] This example investigates the effects of four temperatures, 4, 25, 37, and 50°C, on the fluorescence intensity of the reaction system. 25°C is the most suitable reaction temperature ( Figure 3 d), indicating that this method has good practicability in room temperature environment.

[0064] d) Optimization of reaction buffer

[0065] This example investigates the effects of five reaction buffers, ddH2O, PBS, Tris-HAc, Tris-HCl, and Tris-HNO3, on the fluorescence signal intensity. Among them, Tris-HAc is the best reaction buffer ( Figure 3 e).

[0066] e) Optimization of reaction time

[0067] The change of fluorescence intensity with reaction time was investigated. After adding the target gene for 5 minutes, the fluorescence value of the reaction system was measured every 10 minutes. Figure 3 As shown in Figure f, the fluorescence intensity of the two target genes was basically stable after 55 min, so 55 min was selected as the optimal reaction time.

[0068] Example 4 Sensitivity Analysis of Fluorescence Detection Method

[0069] In order to study the sensitivity of the detection method, two probes (500 nM) were complementary paired with target ARGs at different concentrations under the optimal conditions obtained in Example 3. Figure 4 As shown, the fluorescence intensity increased significantly with increasing target gene concentration. Within the 5-100 nM range, the fluorescence intensity exhibited a good linear relationship with the concentration of tet-A and sul-1, with correlation coefficients of 0.9983 and 0.9986, respectively. The limits of detection (LOD) for tet-A and sul-1 were 0.45 nM and 0.32 nM, respectively.

[0070] Example 5 Specificity Analysis of Fluorescence Detection Method

[0071] This example investigates the detection method for target ARGs and their corresponding single mismatches (SM), double mismatches (DM) and different types of ARG interference fragments, including the quinolone antibiotic resistance gene qnrs, the aminoglycoside antibiotic resistance gene aadA and the lactam resistance gene bla TEM Selectivity. Figure 5 As shown, a significant fluorescence intensity difference (F-F0) at 549 nm and 641 nm is observed only when the target gene is present. The fluorescence intensity difference is significantly reduced for single- and double-mismatched DNA with high sequence homology and three other antibiotic resistance genes. These results demonstrate that the proposed method has excellent selectivity for distinguishing various types of interferences.

[0072] Example 6: Simultaneous detection of two ARGs using fluorescence detection method

[0073] In order to evaluate the performance of the detection method of the present invention in the simultaneous detection of two target genes, two detection probes (500 nM) were added together with different concentrations of target ARGs (20-250 nM) in Tris-HAc buffer at pH 4.4, incubated at 25°C in the dark for 55 min, and the fluorescence intensity of the reaction system was measured under excitation at 495 nm and 580 nm. Figure 6 As shown, as the concentration of tet-A and sul-1 increased from 20 nM to 250 nM, the fluorescence emission peak intensities at 549 nm and 641 nm increased linearly. The detection limits for analyzing tet-A and sul-1 were 1.89 nM and 13.44 nM, respectively. Therefore, the two target ARGs can be quantitatively analyzed simultaneously in the same environment using the detection method of the present application.

[0074] Example 7: Fluorescence detection method for detecting real environmental samples

[0075] Real samples were collected from farm wastewater, a sewage treatment plant, and surface river water. Before testing, the three collected samples were filtered through a 0.22 μm filter membrane. Subsequently, different concentrations of tet-A and sul-1 (0, 20, and 60 nM) were spiked into the samples. The results are shown in Table 2.

[0076] Table 2. Investigation of the recovery of the detection method of the present invention applied to three real environmental samples

[0077]

[0078] The results in Table 2 show that the present invention has a good recovery rate in the detection of actual samples, which provides great potential for the analysis and detection of ARGs in real environmental samples without the need for complex pretreatment processes.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting ARGs based on color-changing silver nanoclusters, characterized in that: The detection method is a non-disease treatment and diagnosis method, comprising the following steps: adding fluorescent probe DNA silver nanoclusters H1-AgNCs and enhanced probe H2 to a buffer at a molar ratio of 1:2 to 2:1, then adding a sample to be tested containing target gene ARGs, mixing them evenly and reacting them, and detecting the fluorescence intensity using a fluorescence spectrophotometer; The target gene ARGs are tet-A and sul-1 One or both of tet-A The nucleic acid sequence: 5'-GGACAACATTGCTTGCAGCGCCGGCATTCCGA-3'; sul-1 The nucleic acid sequence is: 5′-AAGAGCGGCGCAATACGTCTGATCTCATCGGC-3′; The nucleotide sequence of the fluorescent probe DNA silver nanocluster H1-AgNCs is: 5’-CCTCCTTCCTCC / TTT / GTATTGCGCCGCTTTTCGGAATGCCGGCGCT / TAT / CCCTTAATCCCC-3’; The nucleotide sequence of the enhanced probe H2 is: 5’-TTTTTTTTTTTT / ATA / GCAAGCAATGTTGTCCGCCGATGAGATCAGAC / AAA / GGGTGGGGTGGGGTGGGG-3’; The reaction temperature is 4~50℃, and the reaction time is 5~75min; The fluorescence spectrophotometer parameters were set as follows: excitation wavelength: 495 nm and 580 nm, emission wavelength range: 520–650 nm and 600–720 nm, excitation slit and emission slit were 10 nm, and scanning voltage was 700 V. Detection of target genes tet-A When the green fluorescence is turned on, the pH of the fluorescence reaction system is 3.6-5.0; the target gene is detected sul-1 When the red fluorescence is enhanced, the pH of the fluorescence reaction system is 5.6-7.0; the simultaneous detection of the two target genes is carried out in Tris-HAc buffer at pH 4.

4.

2. The detection method according to claim 1, characterized in that The synthesis method of the fluorescent probe DNA silver nanoclusters H1-AgNCs is as follows: dissolving a DNA template in a phosphate buffer, adding an AgNO3 solution, mixing and incubating at 0-5°C for 10-60 minutes, then adding a freshly prepared NaBH4 solution, mixing and reacting at room temperature in the dark overnight to obtain an H1-AgNCs solution.

3. The detection method according to claim 2, wherein The molar ratio of DNA template, AgNO3, and NaBH4 is 1:(3~15):(3~15).

4. The detection method according to claim 3, characterized in that The molar ratio of DNA template, AgNO3, and NaBH4 is 1:6:

6.

5. The detection method according to claim 1, wherein All reactions were carried out in the dark at a temperature of 37°C.

6. The detection method according to claim 1, characterized in that The reaction time is 55 minutes.

Images