A method for mRNA circularization and translation based on catalytic mode of ribozyme
By combining the group I intron self-splicing system with the IRES sequence, efficient circularization and translation of mRNA were achieved, solving the problems of low mRNA stability and translation efficiency in existing technologies, and improving the stability and translation efficiency of circRNA, especially with significant effects in eukaryotic cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TSINGHUA UNIVERSITY
- Filing Date
- 2023-03-27
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies struggle to efficiently circularize mRNA in vitro and improve its stability and translation efficiency, especially the circularization and translation of circRNA in eukaryotic cells, which presents challenges. Furthermore, traditional methods are limited by the secondary structure and 5' cap structure of mRNA.
Using a group I intron self-splicing system combined with a specific IRES sequence, circRNA was generated through in vitro transcription and circularization. The IRES sequence was then introduced into the circRNA to bind to ribosomes for translation. The specific steps included designing recombinant fragments, adding GTP and Mg2+ to perform a circularization reaction, and finally achieving translation in mammalian cells.
It significantly improved the stability and translation efficiency of mRNA. circRNA showed high stability and translation activity in vivo and in vitro, and protein expression was significantly increased. In particular, when it was bound to the 5' cap structure and the IRES structure, the translation efficiency could be increased to 2.9 times.
Smart Images

Figure BDA0004146130810000051 
Figure BDA0004146130810000061 
Figure HDA0004146130820000011
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically to a method for mRNA circularization and translation based on ribozyme catalysis. Background Technology
[0002] mRNA was first discovered by Sydney Brenner and Francis Crick in 1960. Unlike the double-stranded, double-helix structure of DNA, mRNA is typically a single-stranded linear polynucleotide chain, accounting for about 3% of total cellular RNA. Due to the AU / GC pairing phenomenon, most mRNAs possess complex secondary structures (hairpins, stem-loops, etc.). mRNA is usually transcribed from deoxyribonucleic acid (DNA) within biological cells. Post-transcriptional modifications of mRNA vary among different cell types, leading to structural differences in mRNA across these organisms. Generally, in non-eukaryotic cells, mRNA requires almost no post-transcriptional modifications. In eukaryotic cells, however, mRNA precursors typically undergo 5' capping, 3' tailing, and intron removal splicing to form mature mRNA. Therefore, for eukaryotic cells, the complete mRNA structure includes a 5' cap, a 5' untranslated region (UTR), a protein-coding sequence (CDS) or open reading frame (ORF), a 3' untranslated region, and a 3' polyadenine tail. According to the central dogma of molecular biology, genetic information is transmitted through transcription from DNA to RNA, and then translation from RNA to protein. Therefore, the primary function of mRNA is as an intermediate carrier of genetic information. This also makes mRNA one of the most unstable types of RNA in cells. Its easily degraded nature allows cells to effectively regulate intracellular mRNA levels, thereby regulating the levels of different proteins and maintaining cellular homeostasis.
[0003] From a structural perspective, circularizing mRNA into circular RNA (circRNA) can significantly improve its stability. Compared to linear mRNA, circRNA has a closed circular structure and does not require 5' capping or 3' tailing to enhance its stability. circRNA has a natural advantage in stability against exonucleases; endogenous circRNA is two to five times more stable than linear RNA. The concept of circRNA was first proposed by Sanger et al. in 1976. In the following 20 years, circRNA was found in cells of various species, such as yeast, viruses, and mammalian cells. However, because the observed circRNA expression levels were very low, it was thought to be merely a product of RNA missplicing. Therefore, for a long time, research on circRNA did not receive much attention.
[0004] This phenomenon persisted until 2012, when Salzman et al. discovered a large number of circRNAs in human cells, thanks to advancements in high-throughput sequencing and computational analysis technologies. This discovery proved that circRNAs are not products of missplicing of cellular RNA, but rather a common phenomenon in gene expression within cells. Consequently, research on circRNAs proliferated. circRNAs were shown to be significantly more stable than linear mRNAs in vivo. It is noteworthy that most naturally occurring circRNAs are ncRNAs, often acting as miRNA (microRNA) sponges or aiding in protein folding, lacking translational activity. Even so, studies have shown that circRNAs possessing internal ribosome entry sites (IRES) exhibit translational activity both in vivo and in vitro. After demonstrating the stability and translational activity of circRNAs, methods for circularizing linear mRNAs in vitro began to be developed.
[0005] There are three strategies for in vitro circularization of RNA: chemical methods based on cyanogen bromide or similar condensing agents, enzymatic methods based on DNA or RNA ligases, and ribozyme methods based on intron self-splicing function.
[0006] Permuted introns and exons (PIE) is currently the most common method for ribozyme-catalyzed mRNA circularization. Depending on the source of the introns, the PIE method is divided into group I intron self-splicing system and group II intron self-splicing system. Among them, the modified group I intron self-splicing system is the most commonly used ribozyme-catalyzed method. This method only requires the addition of a certain concentration of GTP and Mg2+ as cofactors in the system to achieve mRNA self-circulation. The way to achieve mRNA circularization in the group I intron self-splicing system is to add the corresponding intron and exon sequences to both ends of the target mRNA. After the in vitro transcription reaction is completed, this part of the ribozyme sequence will undergo two ester exchange to achieve self-splicing at the fixed site and complete mRNA circularization. It is worth mentioning that, unlike the above chemical ligation and enzymatic ligation methods, the group I intron self-splicing system can achieve mRNA circularization in vivo and in vitro at the same time
[86] , which further expands its application range. Furthermore, the Group I intron self-splicing system can be used for the circularization of larger linear mRNA precursors, such as mRNAs with a length of 6000–8000 nucleotides. The simple reaction conditions make the Group I intron self-splicing system more suitable for industrial production requirements. However, because the Group I intron self-splicing system requires the introduction of exogenous intron and exon sequences, some exogenous exon sequences remain in the circRNA after circularization, preventing precise mRNA circularization. To address this issue, current research has also achieved precise ligation of mRNA ends through the design of customized self-splicing transcription templates, enabling the efficient synthesis of circRNAs without exogenous exon sequences. Based on these advantages, the Group I intron self-splicing system has become the most studied and widely used mRNA circularization method. However, due to the complexity of mRNA secondary structure, the circularization efficiency of the same Group I intron self-splicing system still varies significantly for different mRNA sequences. In summary, the PIE method based on the group I intron self-splicing system is applicable to the circularization of most mRNAs currently available, but is still limited by the secondary structure of linear mRNA precursors.
[0007] In most eukaryotic cells, mRNA has a 5' cap structure. 7 G modification. This cap structure can serve as a ribosome binding site (RBS) to initiate translation. For a long time, this was considered the only way to initiate eukaryotic mRNA translation. This translation process requires the participation of PABPs and eIF4F. Therefore, 5' cap-mediated translation is less efficient with larger mRNAs and is affected by the absence of cofactors. Furthermore, since circRNAs lack a 5' cap structure, they cannot initiate translation in this way.
[0008] Internal ribosome entry sites (IRES) can initiate translation as a transcriptional basis of stem cells (RBS) independently of the 5' cap. IRES were initially thought to be regulatory elements of viral mRNA transcription. Until 1988, it was discovered that IRES in the 5' UTR of two picornaviruses, poliovirus (PV) and encephalomyocarditis virus (EMCV), could mediate translation independently of the 5' cap. Because the mRNAs derived from these viruses lack a 5' cap and the start codon is located hundreds of nucleotides downstream of the 5' end, a 5' cap would be completely incapable of initiating translation. Therefore, IRES were shown to initiate translation independently of the 5' cap. Currently, IRES are widely found in viruses and cells across various families. Different IRES have different structures and varying requirements for initiation factors (IFs) and IRES trans-acting factors (ITAFs). Based on these differences, viral IRES are classified into four categories. Type I IRES do not require the participation of IFs and ITAFs; they can directly bind to the 40S small ribosomal subunit and initiate translation. Examples include IRES derived from Cricket paralysis virus (CrPV), Plautia staliintestine virus (PSIV), and Taura syndrome virus (TSV). Type II IRES require eIF2 and eIF3 to initiate translation but do not require ITAFs and can directly bind to the 40S small ribosomal subunit to initiate translation. Examples include IRES derived from Hepatitis C virus (HCV), Classicalswine fever virus (CSFV), and Porcine teschovirus 1 (PTV-1). Types III and IV IRES both require a significant number of IFs and ITAFs to initiate translation. Type III IRES are characterized by the need for ITAs to bind to the 40S small subunit of the ribosome, initiating the translation process directly from the binding site. Examples include IRES derived from EMCV and Foot-and-mouth disease virus (FMDV). Type IV IRES also require ITAs to bind to the 40S small subunit of the ribosome, and then initiate the translation process from the start codon AUG. Examples include IRES derived from PV and Rhinovirus (RhV).Although, generally speaking, the more complex the structure of an IRES, the stronger its activity and the less IFs and ITAFs it requires, the underlying mechanisms are not yet fully understood. Summary of the Invention
[0009] The purpose of this invention is to provide a method for mRNA circularization and translation based on ribozyme catalysis.
[0010] In a first aspect, the present invention claims a method for in vitro circularization and translation of mRNA based on ribozyme catalysis.
[0011] The ribozyme-catalyzed mRNA in vitro circularization and translation method claimed in this invention utilizes the Group I intron self-splicing system to complete the in vitro circularization of mRNA to obtain circRNA; and the IRES sequence is introduced into the circRNA to bind to ribosomes and thus achieve translation.
[0012] Wherein, the group I intron self-splicing system is a type I intron from the Td (Thymidylate synthase) gene of T4 phage; the IRES sequence is an IRES sequence derived from MCDV, CVB3, HCV, PTV-1, RSV or TSV.
[0013] Specifically, the method includes the following steps:
[0014] (A1) The type I intron and exon sequences of the Td gene from T4 phage are broken in the middle, with 5' intron and exon 1 on one side of the break point and exon 2 and 3' intron on the other side. The fragments located on both sides of the break point are introduced into the coding DNA of the IRES sequence and the two ends of the target gene to be expressed, respectively, to obtain the recombinant fragment.
[0015] (A2) An RNA polymerase promoter sequence is added upstream of the recombinant fragment to obtain an in vitro transcription template; in vitro transcription is then performed.
[0016] (A3) Adding additional GTP and Mg to the in vitro transcription product 2+ Catalytic cyclization reaction yields the cyclized product circRNA;
[0017] (A4) The circRNA is introduced into mammalian cells for translation.
[0018] Preferably, in step (A1), the IRES sequence is an IRES sequence derived from MCDV, as shown in SEQ ID No. 1.
[0019] In a specific embodiment of the present invention, in step (A1), the type I intron and exon sequences of the Td gene from T4 phage are as shown in SEQ ID No. 2. Further, in the type I intron and exon sequences of the Td gene from T4 phage, the breakpoint is located between positions 285 and 286 of SEQ ID No. 2.
[0020] Further, in step (A1), the recombinant fragment is composed of the 5' intron, exon 1, the coding DNA of the IRES sequence, the target gene to be expressed, exon 2 and the 3' intron, from upstream to downstream.
[0021] Furthermore, the 5' intron is bits 1 to 255 of SEQ ID No. 2; the exon 1 is bits 256 to 285 of SEQ ID No. 2; the exon 2 is bits 286 to 304 of SEQ ID No. 2; and the 3' intron is bits 305 to 491 of SEQ ID No. 2.
[0022] In a specific embodiment of the present invention, the recombinant fragment, from the 5' end to the 3' end, consists of positions 1-255 (5' intron), positions 256-285 (exon 1) of SEQ ID No. 2, the coding DNA of the IRES sequence, the target gene to be expressed, positions 286-304 (exon 2), and positions 305-491 (3' intron) of SEQ ID No. 2.
[0023] In a specific embodiment of the present invention, in step (A2), the RNA polymerase promoter is the T7 promoter (TAATACGACTCACTATAGG).
[0024] Further, in step (A3), the final concentration of GTP added to the in vitro transcription product can be 2 mM, and the additional Mg... 2+ The final concentration can be 10 mM.
[0025] Furthermore, in step (A3), the conditions for the catalytic cyclization reaction can be incubation at 55°C for 10-20 min (e.g., 15 min).
[0026] In a specific embodiment of the present invention, the mammal in step (A4) is specifically A549 cells, MCF-7 cells, HEK293T cells, or HeLa cells.
[0027] Secondly, the present invention claims protection for a complete product for in vitro circularization and translation of mRNA based on ribozyme catalysis.
[0028] The kit for in vitro circularization and translation of mRNA based on ribozyme catalysis claimed in this invention may include:
[0029] (B1) In vitro transcription plasmid; the in vitro transcription plasmid contains the in vitro transcription template described in the first aspect above;
[0030] (B2)GTP and Mg 2+ ;
[0031] (B3) Mammalian cells.
[0032] Depending on the needs, the complete product may also contain conventional reagents for in vitro transcription.
[0033] Thirdly, the present invention claims protection for the use of the complete product described in the second aspect above in the in vitro circularization and translation of mRNA.
[0034] This invention screened ribozyme sequences from two genes, Laccase2 and ZKSCAN1, from group I intron self-splicing systems reported in different literatures for intracellular RNA circularization, and compared them with ribozyme sequences from the Td gene reported in the literature for in vitro RNA circularization. The Td ribozyme sequence was ultimately determined to be the ribozyme sequence with the highest circularization efficiency. Furthermore, this invention also conducted preliminary exploration of IRES sequences, identifying IRES sequences from MCDV, CVB3, HCV, PTV-1, RSV, or TSV as IRES sequences with strong ribosome binding capacity, among which the MCDV IRES is adapted to various cellular environments. In addition, this invention also verified the function of IRES in linear mRNA. IRES was shown to be able to initiate the translation process independently in linear mRNA. This invention also demonstrated the synergistic effect of the 5' cap structure and the IRES structure. After adding both the 5' cap structure and the IRES structure, the protein expression level of linear mRNA in cells was significantly increased. The protein expression level of linear mRNA containing both the 5' cap structure and CSFVIRES was 2.9 times that of linear mRNA containing only the 5' cap structure.
[0035] This invention is of great significance for improving the stability and expression efficiency of mRNA in vivo and promoting the development of circular mRNA technology. Attached Figure Description
[0036] Figure 1The results show the circularization of different group I intron self-splicing systems. (a) is a schematic diagram of the circularization principle of the group I intron self-splicing system. (b) are the agarose gel electrophoresis results of circularizing linear mRNA precursors using different group I intron self-splicing systems. In the figure, "L" represents the untreated linear mRNA precursor, and "C" represents the circularized mRNA, i.e., circRNA. The plasmid DNA template information corresponding to the numbers in the figure is shown in Table 1.
[0037] Figure 2 The expression of circularized mRNAs from different intron self-splicing systems in HEK293T cells is shown. (a) Comparison of relative fluorescence values of the expressed proteins of different intron self-splicing systems from different introns in HEK293T cells. The relative fluorescence value was selected as the baseline "1" for the experimental results of circRNAs fused with CVB3IRES and circularized using the Td ribozyme sequence. (b) Flow cytometry results of the expression of circularized mRNAs from intron self-splicing systems from group I in HEK293T cells.
[0038] Figure 3 The expression of circRNAs fused with IRES sequences from different viral sources in cells is shown. (a) Comparison of relative fluorescence values of circRNAs fused with IRES sequences from different viral sources after Td ribozyme sequence catalysis in HEK293T cells. The relative fluorescence value was selected as the baseline "1" for the experimental results of circRNAs fused with CVB3 IRES sequences. (b) Flow cytometry results of circRNA expression in HEK293T cells fused with IRES sequences from different viral sources.
[0039] Figure 4 To illustrate the expression of circRNAs fused with different IRES in different cells, the relative fluorescence values were all based on the results of circRNAs fused with CVB3 IRES as baseline "1". (a) Comparison of relative fluorescence values of proteins expressed in A549 cells after Td ribozyme sequence-catalyzed circularization of circRNAs fused with different IRES sequences. (b) Comparison of relative fluorescence values of proteins expressed in HeLa cells after Td ribozyme sequence-catalyzed circularization of circRNAs fused with different IRES sequences. (c) Comparison of relative fluorescence values of proteins expressed in MCF-7 cells after Td ribozyme sequence-catalyzed circularization of circRNAs fused with different IRES sequences. Detailed Implementation
[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0042] Example 1: mRNA cyclization based on ribozyme catalysis
[0043] I. Screening of Intron Self-Splicing Systems in Group I
[0044] In the past two years, due to the significant attention circRNA has received, and methods such as group II intron self-splicing systems and hairpin ribozymes have also seen some development, but related research remains limited. Although ribozyme catalysis offers a variety of ribozyme systems to choose from, including group I intron self-splicing systems, group II intron self-splicing systems, and hairpin ribozymes, the group I intron self-splicing system remains the mainstream ribozyme catalysis method. Figure 1 (a) According to data from the Comparative RNA Web Site and Project (https: / / crw-site.chemistry.gatech.edu), over 3000 group I intron self-splicing systems have been discovered, and these ribozyme sequences are widely distributed in bacteria and eukaryotic cells. To narrow down the screening, group I intron self-splicing systems reported in different literatures for intracellular RNA circularization were selected for in vitro mRNA circularization testing. Information on the plasmid DNA templates used for transcription is shown in Table 1.
[0045] Table 1. Plasmid DNA template information for the intron self-splicing system of Group I
[0046]
[0047]
[0048] References:
[0049] [1]Zhang XO,Wang H Bin,Zhang Y,et al.Complementary sequence-mediatedexon circularization[J].Cell,Cell,2014,159(1):134–147.
[0050] [2]Zhang Y,Xue W,Li X,et al.The Biogenesis of Nascent Circular RNAs[J].Cell Reports,Cell Rep,2016,15(3):611–624.
[0051] [3]Garikipati V N S,Verma S K,Cheng Z,et al.Circular RNA CircFndc3bmodulates cardiac repair after myocardial infarction via FUS / VEGF-A axis[J].Nature Communications,Nat Commun,2019,10(1).
[0052] [4]Liang D,Tatomer D C,Luo Z,et al.The Output of Protein-Coding GenesShifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting[J].Molecular Cell,Mol Cell,2017,68(5):940-954.e3.
[0053] [5]Liang D,Wilusz J E.Short intronic repeat sequences facilitatecircular RNA production[J].Genes and Development,Genes Dev,2014,28(20):2233–2247.
[0054] [6]Kramer M C,Liang D,Tatomer D C,et al.Combinatorial control ofDrosophila circular RNA expression by intronic repeats,hnRNPs , and SR proteins[J].Genes and Development,Genes Dev,2015,29(20):2168–2182.
[0055] Since these plasmid DNA templates are all used for intracellular RNA circularization, they do not contain the T7 promoter. Therefore, the T7 promoter needs to be introduced during PCR through primer design. In vitro transcription experiments were performed using the obtained linearized DNA templates, and mRNA samples before and after circularization were subjected to agarose gel electrophoresis. The method for introducing the T7 promoter was to add the T7 promoter sequence (TAATACGACTCACTATAGG) to the 5' end of the front primer during standard PCR primer design.
[0056] The components of the in vitro transcription system are shown in Table 2.
[0057] Table 2. Components of the in vitro transcription system
[0058] Components Added volume (25 μL) 5x Transcription Buffer 5μL 10mM rNTPs Mix 4μL 100mM DTT 2.5μL Template DNA 1μg T7 RNA polymerase 2μL <![CDATA[DEPC-treated H2O]]> Add to 25μL
[0059] All components were stored at -20°C. The 5x Transcription Buffer contained the following components: 50mM NaCl, 40mM MgCl2, 10mM spermidine, 400mM Tris-HCl, pH 8.0.
[0060] The template DNA needs to be linearized before the reaction, and linearized template DNA is obtained using PCR. The template DNA must contain the T7 promoter sequence.
[0061] The specific procedures for in vitro transcription are as follows:
[0062] 1) Thaw all components except T7 RNA polymerase on ice.
[0063] 2) In an RNase-free environment, mix all components according to Table 1. The scale of the reaction system can be appropriately increased according to experimental requirements.
[0064] 3) Incubate at 37°C for 2 hours. If the target mRNA is shorter than 300 nt, the reaction time can be extended to 4 hours or 16 hours.
[0065] 4) In an RNase-free environment, add 1 μL of DNase I to 25 μL of the reacted solution to degrade the template DNA. Incubate at 37°C for 10–15 min.
[0066] 5) Purify mRNA using a kit or lithium chloride precipitation method, and determine the recovered concentration using Nanodrop. Store at -80°C for later use.
[0067] Ribozyme-catalyzed ligation is performed as follows:
[0068] 1) After the in vitro transcriptional DNase I degradation reaction was completed, in an RNase-free environment, an additional 2 mM GTP solution was added to the reaction system, along with a certain concentration of MgCl2 solution, so that the additional Mg in the system... 2+ The concentration is 10 mM.
[0069] 2) React at 55℃ for 15 min.
[0070] 3) Purify mRNA using a kit or lithium chloride precipitation method, and determine the recovered concentration using Nanodrop. Store at -80°C for later use.
[0071] Agarose gel electrophoresis was performed, and the relevant solution components are shown in Table 3.
[0072] Table 3. Agarose gel electrophoresis components
[0073] solution Components (1L) 50x TAE <![CDATA[242 g Tris, 37.2 g Na2EDTA·2H2O, 57.1 mL Acetic Acid, make up to 1 L with deionized water]]> 1x TAE Add 20 mL of 50x TAE and top up with deionized water to 1 L. Gum dye solution 100 μL of Gelsafe dissolved in 1 L of 1x TAE
[0074] The specific procedure for agarose gel electrophoresis is as follows:
[0075] 1) Add agarose to the gel staining solution at a concentration of 1% (w / v) (this concentration is the commonly used agarose gel concentration; it can be changed if necessary). Place the mixed suspension in a microwave oven and heat until the agarose is completely dissolved.
[0076] 2) Pour the solution into the mold with the comb teeth inserted before it cools down, and let it stand to cool and set.
[0077] 3) Transfer the cooled and set gel to the electrophoresis tank. Add 1x TAE to the tank until the gel surface is submerged.
[0078] 4) Mix the nucleic acid sample and 6x DNA loading buffer at a ratio of 5:1. Add the processed sample to the wells of the gel, the amount depending on the size of the wells. Additionally, add the corresponding marker to each well for subsequent determination of the nucleic acid sample size.
[0079] 5) Connect the power supply, set the voltage to 140V, the current to 200mA, and the time to approximately 30 minutes.
[0080] 6) Gel imaging: Scan the image at 302 nm and save the image for subsequent analysis.
[0081] The results are as follows Figure 1As shown in (b), the agarose gel electrophoresis results in the figure show that the self-splicing system of introns I in groups 1 to 14 exhibits single nucleic acid bands before and after circularization, while the self-splicing system of introns I in groups 15 to 22 exhibits double nucleic acid bands before and after circularization. Since the nucleic acid bands of circRNA move more slowly than linear mRNA precursors in agarose gel electrophoresis, it is concluded that the self-splicing system of introns I in groups 15 to 22 successfully achieved circularization. In the double nucleic acid bands, the slower-moving nucleic acid band represents the circRNA nucleic acid band, and the faster-moving nucleic acid band represents the linear mRNA precursor nucleic acid band. However, it is noteworthy that in the experimental results of successful circularization, double nucleic acid bands also appeared in the agarose gel electrophoresis results that should have shown non-circularization, meaning that the non-circularized linear mRNA precursor also exhibited circularization. In the experiment, compared to the uncirculated mRNA, the circularized mRNA was simply incubated with additional GTP at 55°C for 15 minutes. Therefore, the possible reason why the uncirculated linear mRNA precursor also exhibited circularization is that the in vitro transcription system already contained a high concentration of GTP and the cofactor Mg required for circularization. 2+ At 37°C, the transcribed linear mRNA precursor underwent self-circularization catalyzed by the ribozyme sequence at the ends, forming circRNA. Analysis of the agarose gel electrophoresis results of the group I intron self-splicing systems (numbered 1 to 14) that failed to circularize revealed that the circularized nucleic acid bands (numbered 2, 3, 6, 7, 8, 13, and 14) moved faster than the uncircularized bands, meaning the molecular weight of the circularized nucleic acid bands was smaller than that of the uncircularized bands. A possible reason for this structure is that the 5' and 3' intron sequences are cleaved during group I intron self-splicing, leading to a decrease in the molecular weight of the circularized nucleic acid bands. This indicates that the group I intron self-splicing systems (numbered 2, 3, 6, 7, 8, 13, and 14) only completed the intron cleavage process and did not successfully splice into circRNA, remaining linear mRNAs.
[0082] Based on the above experimental results, subsequent experiments will use the group I intron self-splicing system of plasmid DNA templates numbered 15 to 22. Although the expressed target genes are different, these successfully circularized group I intron self-splicing systems all originated from the Laccase2 and ZKSCAN1 genes.
[0083] II. Intracellular expression of circRNA catalyzed by ribozymes
[0084] circRNAs obtained via the group I intron self-splicing system, a ribozyme-catalyzed mechanism, retain some exon sequences, which may partially affect their translational activity. To further verify the circularization efficiency of different group I intron self-splicing systems and test their effects on circRNA translational activity in cells, the circularized circRNAs were transfected into mammalian cells for expression. The selected group I intron self-splicing system included not only the Lacase2 and ZKSCAN1 genes screened in step one, but also the Td (Thymidylate synthase) gene from T4 phage, which has been verified to have circularization activity in vitro. Furthermore, since circRNAs lack a 5' cap structure, they cannot be translated via the usual ribosome binding mechanism. Therefore, an IRES sequence was introduced into the circRNA to bind to ribosomes. Five commonly used IRES sequences (Table 4) were selected for the experiment. sfGFP was chosen as the target gene for expression. The IRES sequence was introduced immediately before the ATG start codon in the sfGFP coding region.
[0085] The specific sequence of the Td ribozyme recombinant plasmid (containing sfGFP, but without the IRES sequence) is as follows:
[0086]
[0087] Positions 451-735 are the 5' end sequence of the Td ribozyme (containing the 5' intron and exon 1); positions 736-1470 are the sfGFP coding region sequence; and positions 1470-1676 are the 3' end sequence of the Td ribozyme (containing exon 2 and 3' intron).
[0088] The specific sequence of the Laccase2 recombinant plasmid (containing sfGFP, but without the IRES sequence) is as follows:
[0089]
[0090] Positions 882-1575 are the 5' end sequence of the Laccase2 ribozyme; positions 1576-2310 are the sfGFP coding region sequence; and positions 2311-3183 are the 3' end sequence of the Laccase2 ribozyme.
[0091] The specific sequence of the ZKSCAN1 recombinant plasmid (containing sfGFP, but without the IRES sequence) is as follows:
[0092]
[0093] Among them, positions 882-1410 are the 5' end sequence of ZKSCAN1 ribozyme; positions 1411-2145 are the sfGFP coding region sequence; and positions 2146-2962 are the 3' end sequence of ZKSCAN1 ribozyme.
[0094] Table 4. Five types of IRES sequences
[0095] source abbreviation Sequence length (bp) Classical swine fever virus CSFV 373 Coxsackievirus group B type 3 CVB3 741 Encephalomyocarditis virus EMCV 696 Human enterovirus 71 EV71 743 Poliovirus PV 742
[0096] The nucleic acid encoded by the CSFV IRES sequence:
[0097] GTATACGAGGTTAGTTCATTCTCGTATACACGATTGGACAAATCAAAATTATAATTTGGTTCAGGGCCTCCCTCCAGCGACGGCCGAACTGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAGGGACTAGCCGTAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAGTACAGGACAGTCGT CAGTAGTTCGACGTGAGCAGAAGCCCACCTCGAGATGCTACGTGGACGAGGGCATGCCCAAGACACACCTTAACCCTAGCGGGGGTCGCTAGGGTGAAATCACACCACGTGATGGGAGTACGACCTGATAGGGCGCTGCAGAGGCCCACTATTAGGCTAGTATAAAAATCTCTGCTGTACATGGCAC
[0098] The encoded nucleic acid of the CVB3IRES sequence:
[0099] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA
[0100] Coding nucleic acid of EMCV IRES sequence:
[0101] TTGCCAGTCTGCTCGATATCGCAGGCTGGGTCCGTGACTACCCACTCCCCCTTTCAACGTGAAGGCTACGATAGTGCCAGGGCGGGTACTGCCGTAAGTGCCACCCCAAACAACAACAACAAAACAAACTCCCCCTCCCCCCCCTTACTATACTGGCCGAAGCCACTTGGAATAAGGCCGGTGTGCGTTTGTCTACATGCTATTTTCTACCGCATTACCGTCTTATGGTAATGTGAGGGTCCAGAACCTGACCCTGTCTTCTTGACGAACACTCCTAGGGGTCTTTCCCCTCTCGACAAAGGAGTGTAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTAAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGTGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACGTGCTTTACACGTGTTGAGTCGAGGTGAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAACCACGATTACAAT
[0102] Coding nucleic acid of EV71 IRES sequence
[0103] TTAAAACAGCTGTGGGTTGTCACCCACCCACAGGGTCCACTGGGCGCTAGTACACTGGTATCTCGGTACCTTTGTACGCCTGTTTTATACCCCCTCCCTGATTTGCAACTTAGAAGCAACGCAAACCAGATCAATAGTAGGTGTGACATACCAGTCGCATCTTGATCAAGCACTTCTGTATCCCCGGACCGAGTATCAATAGACTGTGCACACGGTTGAAGGAGAAAACGTCCGTTACCCGGCTAACTACTTCGAGAAGCCTAGTAACGCCATTGAAGTTGCAGAGTGTTTCGCTCAGCACTCCCCCCGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCTATGGGGTAACCCATAGGACGCTCTAATACGGACATGGCGTGAAGAGTCTATTGAGCTAGTTAGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACATACCCTTAATCCAAAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTTATTCTTGTATTGGCTGCTTATGGTGACAATTAAAGAATTGTTACCATATAGCTATTGGATTGGCCATCCAGTGTCAAACAGAGCTATTGTATATCTCTTTGTTGGATTCACACCTCTCACTCTTGAAACGTTACACACCCTCAATTACATTATACTGCTGAACACGAAGCG
[0104] Coding nucleic acid of PV IRES sequence:
[0105] TTAAAACAGCTCTGGGGTTGTACCCACCCCAGAGGCCCACGTGGCGGCTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATACTCCCTTCCCGTAACTTAGACGCACAAAACCAAGTTCAATAGAAGGGGGTACAAACCAGTACCACCACGAACAAGCACTTCTGTTTCCCCGGTGA TGTCGTATAGACTGCTTGCGTGGTTGAAAGCGACGGATCCGTTATCCGCTTATGTACTTCGAGAAGCCCAGTACCACCTCGGAATCTTCGATGCGTTGCGCTCAGCACTCAACCCCAGAGTGTAGCTTAGGCTGATGAGTCTGGACATCCCTCACCGGTGACGGTGGTCCAGGCTGCGTTGGCGGC CTACCTATGGCTAACGCCATGGGACGCTAGTTGTGAACAAGGTGTGAAGAGCCTATTGAGCTACATAAGAATCCTCCGGCCCCTGAATGCGGCTAATCCCAACCTCGGAGCAGGTGGTCACAAACCAGTGATTGGCCTGTCGTAACGCGCAAGTCCGTGGCGGAACCGACTACTTTGGGTGTCCG TGTTCCTTTTTTATTGTGGCTGCTTATGGTGACAATCACAGATTGTTATCATAAAGCGAATTGGATTGGCCATCCGGTGAAAGTGAGACTCATTATCTATCTGTTTGCTGGATCCGCTCCATTGAGTGTGTTTACTCTAAGTACAATTTCAACAGTTATTTCAATCAGACAATTGTATCATA
[0106] mRNAs fused with different IRES, obtained through in vitro transcription (see previous section for details), were circularized using a group I intron self-splicing system (see previous section for ribozyme-catalyzed ligation steps) and transfected into HEK293T cells for expression. Different group I intron self-splicing systems were compared.
[0107] The specific procedures for mRNA transfection in adherent mammalian cells are as follows:
[0108] 1) Pre-culture cells until binding is 100%.
[0109] 2) Under sterile conditions, add 1 mL of DMEM medium to each well of a 24-well plate. Seed the pre-cultured cells into the 24-well plate at a density of 1 x 10⁶ cells per well. 5 Cells were seeded individually and incubated statically in a 37°C, 5% CO2 incubator for 24 hours.
[0110] 3) In a sterile environment, take 25 μL of Opti-MEM. TM I Reduced Serum Medium (Thermofisher) was mixed with 2 μL of transfection reagent and 1 μg of target mRNA. The mixture was incubated for 10 min.
[0111] 4) In a sterile environment, mix the two solutions and incubate for 15 minutes.
[0112] 5) In a sterile environment, add the incubated mixed solution to a 24-well plate that has been cultured for 24 hours.
[0113] 6) Incubate statically at 37℃ in a 5% CO2 incubator for 48 hours. Confirm protein expression status.
[0114] Flow cytometry detection:
[0115] The flow cytometer used in this invention is the BIO-RAD S3e. TM Cell Sorter and BD FACSCalibur. Since the operation of flow cytometers is similar, only the specific operation of BD FACSCalibur will be described here:
[0116] 1) Turn on the power to the BD FACSCalibur until the "STNDBY" button lights up. Check if the sheath fluid tank contains enough sheath fluid. If not, add sheath fluid to at least 2 / 3 of the tank's capacity. Check if the waste liquid tank contains excessive waste liquid. If so, pour the waste liquid into the laboratory flow cytometry waste liquid recovery container.
[0117] 2) Adjust the pressure regulator to the pressurized position. Observe whether there are air bubbles in the pipeline. If there are no air bubbles, you can proceed to the next step of the experiment.
[0118] 3) Press the “PRIME” button to pre-run the flow cytometer; the “PRIME” button will light up at this time. After completion, the “STNDBY” button will automatically light up, and the “PRIME” button will automatically turn off. Press the “PRIME” button again to pre-run the flow cytometer and repeat the above operation.
[0119] 4) Connect the computer power supply, start the computer, and open the CELLQuest software. Set the relevant parameters according to the experimental requirements. In the Acquire command bar, select Connect to Cytometer. After the flow cytometer stabilizes for 3-5 minutes, place the sample to be tested on it and press the "RUN" button to run the flow cytometer. In the software, select Acquire to collect data. After collection is complete, select Save in the software to save the data and press the "STNDBY" button on the flow cytometer.
[0120] 5) If there are other samples, repeat the previous step.
[0121] 6) After all samples have been analyzed, add 75% ethanol and press the "RUN" button to start the flow cytometer. After 10 minutes, press the "STNDBY" button. Add the flow cytometry wash buffer and press the "RUN" button to start the flow cytometer. After 10 minutes, press the "STNDBY" button. Adjust the pressure regulator to the depressurization position. Turn off the power to the BD FACSCalibur and the computer.
[0122] 7) The experimental data were then analyzed using FlowJo software.
[0123] For the Td ribozyme system, corresponding to Figure 1 In (a), the uppermost recombinant fragment, from the 5' end to the 3' end, consists of positions 1-255 (5' intron), positions 256-285 (exon 1) of SEQ ID No. 2, the coding DNA of the IRES sequence, the target gene to be expressed (sfGFP gene), positions 286-304 (exon 2), and positions 305-491 (3' intron) of SEQ ID No. 2.
[0124] The results are as follows Figure 2 As shown in (a), the average expression level of circRNAs catalyzed by Td ribozyme was high in HEK293T, followed by ZKSCAN1, and then Lacase2. Compared to CVB3IRES, the efficiency of the Td ribozyme sequence was 1.4 times that of ZKSCAN1 and 6.8 times that of Lacase2. This indicates that Td exhibits the highest cyclization activity among the three ribozyme sequences and has the least impact on circRNA translation activity. Furthermore, the experimental results demonstrate that the IRES sequence can indeed mediate the binding of ribosomes to circRNA, thereby achieving circRNA translation activity. Simultaneously, different IRES sequences also have different effects on the translation activity of circRNAs obtained by cyclization from different intron self-splicing systems in group I. Figure 2(b)). For Td ribozyme sequences, IRES sequences from CSFV, CVB3, EV71, and PV showed strong and similar ribosome binding abilities, while EMCV IRES showed weaker ribosome binding. For Laccase2 ribozyme sequences, only PV IRES showed strong ribosome binding. For ZKSCAN1 ribozyme sequences, PV IRES showed the strongest ribosome binding, followed by IRES sequences from CSFV, CVB3, and EMCV, while EV71 IRES showed the weakest ribosome binding. The reason for the different effects of IRES sequences on the translational activity of circRNAs obtained from the self-splicing system of intron I introns may be the alteration of mRNA secondary structure by IRES sequences. Unlike the usual mRNA 5'UTR, IRES sequences often have a larger sequence length (Table 3). Therefore, IRES sequences can significantly alter the secondary structure of mRNA. This alteration of secondary structure allows circRNAs to bind to ribosomes and initiate the translation process without a 5' cap structure. However, the secondary structure changes induced by the IRES sequence can also affect the circularization efficiency of the group I intron self-splicing system. Furthermore, the intron self-splicing process can also lead to changes in the secondary structure of the IRES region. These two factors interact, resulting in inconsistent expression levels of the final circRNA within the cell.
[0125] In summary, the Td ribozyme sequence is currently the group I intron self-splicing system with the highest cyclization efficiency screened out. Meanwhile, the IRES sequences from CSFV, CVB3, and PV have minimal impact on ribozyme-catalyzed cyclization efficiency and possess high ribosome binding capacity. These sequences will be selected for further testing.
[0126] Example 2: Screening of IRES sequences based on Td ribozyme sequences
[0127] IRES sequences have been found in RNA from various eukaryotes and viruses. However, in studies of in vitro synthesized circRNAs, most IRES sequences are derived from viruses. This may be because the process of exogenous circRNA transfection into cells is similar to viral infection, and viral IRES sequences are more suitable for the translation of exogenous circRNAs within cells. IRES sequences from different viral sources, some of which have been reported and studied in the literature, were screened from the IRES database IRESbase (http: / / reprod.njmu.edu.cn / cgi-bin / iresbase / index.php) (Table 5). Since IRES sequences from five viruses—CVB3, CSFV, EMCV, EV71, and PV—have already been compared in Example 1, only IRES sequences from CVB3, CSFV, and PV, which have strong ribosome binding ability, were selected for screening in this example. The target gene expressed was sfGFP.
[0128] Table 5. IRES sequences from different viral sources
[0129] source abbreviation NCBI ID Cricket paralysis virus CrPV NC_003924.1 Duck hepatitis A virus 3 DHAV-3 EU352805.2 Foot-and-mouth disease virus FMDV NC_003992.2 Hepatitis C virus HCV NC_004102.1 Human immunodeficiency virus 1 HIV-1 NC_001802.1 Mud crab dicistrovirus MCDV NC_014793.1 Plautia stali enterovirus PSIV AB006531.1 Porcine teschovirus 1 PTV-1 AB038528.1 Reticuloendotheliosis virus REV NC_006934.1 Rous sarcoma virus RSV NC_001407.1 Taura syndrome virus TSV AF277675.1 Classical swine fever virus CSFV NC_002657.1 Coxsackievirus group B type 3 CVB3 M33854.1 Poliovirus PV KU866422.1
[0130] mRNAs fused with different IRES sequences were circularized using a T4 ribozyme, and the uncirculated and circularized mRNAs were transfected into HEK293T cells for expression. See Example 1 for specific procedures.
[0131] The results are as follows Figure 3 As shown in (a), the experimental results demonstrate that the expression level of circularized circRNA was significantly increased compared to that of uncirculated linear RNA. This result verifies that circularizing mRNA can significantly improve mRNA stability. Furthermore, comparing the expression levels of circRNAs fused with different IRES sequences in HEK293T, IRES sequences derived from CVB3, HCV, MCDV, PTV-1, RSV, and TSV were identified as having strong ribosome-binding capabilities. Figure 3 (b)). Among them, the expression level of PTV-1IRES, which was the highest, was about 48% higher than that of CVB3IRES. The results of this experiment further demonstrate that there are significant differences in the activity of different IRES sequences in cells.
[0132] IRES require the assistance of various IFs and ITAFs to achieve their ribosome binding function. However, the types of IFs and ITAFs vary depending on the cellular environment. Therefore, it is desirable to screen for a universal IRES sequence that can adapt to different cell types. Based on HEK293T cell experiments, A549, HeLa, and MCF-7 cell lines were selected to test the expression of circRNAs containing IRES sequences in different cell types, thereby screening for highly efficient and universal IRES sequences. The IRES sequences used in the experiments were the six IRES sequences with strong ribosome binding ability previously screened: CVB3, HCV, MCDV, PTV-1, RSV, and TSV. The target protein expressed was sfGFP. The cyclization strategy used was Td ribozyme-catalyzed ligation. See Example 1 for specific procedures.
[0133] Analyze the experimental results ( Figure 4 In A549 and MCF-7 cells, CVB3IRES and MCDV IRES exhibited strong ribosome binding abilities. In HeLa cells, CVB3IRES and RSV IRES showed stronger ribosome binding abilities. Analysis of these experimental results indicates that both CVB3IRES and MCDV IRES demonstrate strong activity in these three cell types. Combined with the experimental results in HEK293T cells, MCDV IRES exhibits strong activity in various cell types, with minimal influence from the circulation method. Therefore, it can be concluded that MCDV IRES is an IRES sequence with high ribosome binding capacity suitable for use in circRNA.
[0134] The IRES sequences derived from MCDV are as follows:
[0135] CAUUUAUUUAUAUUAAAUCUGACACUUUGCGGGGUUAAAAUGUUUAAUACUAUUUUUCAAUUUGAGGUUGUAUGAGAUAAUUUUGAUUUCUAUGUUAUCAUGAAUAAGGGAGUCUGGCCCUAAUUGAUGUACGACUCUUCUUUGGUUGCGACCCGAGUCCCUUCUACAUCAAG (SEQ ID No. 1)
[0136] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A method for in vitro circularization and translation of mRNA based on catalytic mode of ribozyme, characterized in that: The method utilizes the group I intron self-splicing system to complete the in vitro circularization of mRNA to obtain circRNA; and the IRES sequence is introduced into the circRNA. The group I intron self-splicing system is a type I intron derived from the Td gene of T4 phage; the IRES sequence is an IRES sequence derived from MCDV, CVB3, HCV, PTV-1, RSV, or TSV; wherein, the IRES sequence derived from MCDV is shown in SEQ ID NO:1; the genome sequence of CVB3 is shown in GenBank: M33854.1; the genome sequence of HCV is shown in GenBank: NC_004102.1; the genome sequence of PTV-1 is shown in GenBank: AB038528.1; the genome sequence of RSV is shown in GenBank: NC_001407.1; the genome sequence of TSV is shown in GenBank: AF277675.1; The method includes the following steps: (A1) The type I intron and exon sequences of the Td gene from T4 phage are broken in the middle, with 5' intron and exon 1 on one side of the break point and exon 2 and 3' intron on the other side. The fragments located on both sides of the break point are introduced into the coding DNA of the IRES sequence and the two ends of the target gene to be expressed, respectively, to obtain the recombinant fragment. (A2) An RNA polymerase promoter sequence is added upstream of the recombinant fragment to obtain an in vitro transcription template; in vitro transcription is then performed. (A3) additional GTP and Mg are added to the in vitro transcription product 2+ catalyzing the cyclization reaction to obtain a cyclization product circRNA; (A4) The circRNA is introduced into mammalian cells for translation; In step (A1), the type I intron and exon sequences of the Td gene from T4 phage are shown in SEQ ID No. 2; the break point is located between positions 285 and 286 of SEQ ID No. 2; In step (A1), the recombinant fragment is composed of the 5' intron, exon 1, the coding DNA of the IRES sequence, the target gene to be expressed, exon 2 and the 3' intron from upstream to downstream; The 5' intron is from position 1 to position 255 of SEQ ID No. 2; exon 1 is from position 256 to position 285 of SEQ ID No. 2; exon 2 is from position 286 to position 304 of SEQ ID No. 2; and the 3' intron is from position 305 to position 491 of SEQ ID No.
2.
2. The method of claim 1, wherein: In step (A2), the RNA polymerase promoter is the T7 promoter.
3. The method according to claim 1 or 2, characterized in that: In step (A3), the final concentration of GTP added additionally to the in vitro transcription product is 2 mM, and the final concentration of Mg 2+ added additionally is 10 mM.
4. The method according to claim 1 or 2, characterized in that: In step (A3), the catalytic cyclization reaction is carried out at 55°C for 10-20 min.
5. A complete product for in vitro circularization and translation of mRNA based on ribozyme catalysis, comprising: (B1) In vitro transcription plasmid; The in vitro transcription plasmid contains the in vitro transcription template as described in any one of claims 1-4; (B2) GTP and Mg 2+ ; (B3) Mammalian cells.
6. The application of the complete product according to claim 5 in the in vitro circularization and translation of mRNA.