A non-natural triphosphate (isoTAT), its preparation method, and its applications.

By using isoTAT-type non-natural triphosphates to specifically recognize NaM and G bases, combined with PCR and Sanger sequencing, the problem of accurate localization and sequencing of multiple non-natural base DNA samples in existing technologies has been solved. This has enabled efficient recognition and directional conversion of TPT3-NaM non-natural bases, improving the accuracy and efficiency of sequencing.

CN116425816BActive Publication Date: 2025-10-31HENAN NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310276890.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-20
Publication Date
2025-10-31
Estimated Expiration
2043-03-20

AI Technical Summary

Technical Problem

Existing technologies struggle to accurately sequence DNA containing multiple non-natural base pairs, especially the accurate localization and sequencing of the TPT3-NaM non-natural base pair. Furthermore, existing methods cannot effectively monitor mutations in UBPs or nearby sites that encode multiple closely spaced UBPs or non-default gene loci.

Method used

Using isoTAT-type non-natural triphosphates, the method specifically recognizes NaM and G bases to form complementary base pairs. By combining pre-steady-state and steady-state kinetic methods for double-pair function determination, it achieves accurate localization, tracking, and sequencing of non-natural bases in DNA. It utilizes the function of isoTAT to directionally convert NaM-TPT3 bases to GC bases, combined with PCR amplification and Sanger sequencing methods for accurate localization and sequencing.

Benefits of technology

It enables accurate localization, tracking, and sequencing of TPT3-NaM non-natural base DNA samples containing unlimited sites and quantities, improving sequencing accuracy and efficiency. It can identify and replace multiple non-natural base sites, making it suitable for precise sequencing and gene mutation assessment in semi-synthetic organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116425816B_ABST
    Figure CN116425816B_ABST
Patent Text Reader

Abstract

This invention discloses an isoTAT non-natural triphosphate, its preparation method, and its applications. The structural formula of the isoTAT non-natural triphosphate is as follows: This invention also specifically discloses that, in the presence of isoTATTP, TPT3-NaM can be specifically converted to C-G bases through simple PCR amplification, exhibiting high readability and low sequence dependence, enabling dual localization of multiple TPT3-NaM sites in DNA. This invention provides a universal and convenient method, achieving for the first time the accurate localization, tracking, and sequencing of DNA samples containing unrestricted TPT3-NaM non-natural bases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthesis of non-natural triphosphates and artificial gene code reading and sequencing technology, specifically relating to an isoTAT type non-natural triphosphate, its preparation method and application. Background Technology

[0002] In nature, genetic information is stored in a gene alphabet consisting of four natural bases: A / T / G / C. Recent studies have discovered that some artificially designed and synthesized non-natural base pairs possess excellent amplification capabilities for natural base gene alphabets. Among them, PZ, Ds-Px, and TPT3-NaM non-natural base pairs (UBPs) exhibit superior gene alphabet amplification performance. The unique feature of these non-natural base pairs is their ability to replicate and store genetic information as orthogonal genetic alphabets. For example, phylogenetic evolution of ligands using exponential enrichment (SELEX) of DNA libraries carrying multiple UBPs can yield non-natural base aptamers with pmol-level affinity. A codon and anticodon system carrying UBPs (A-NaM-C as the codon and G-TPT3-T as the anticodon) can encode three non-codon amino acids and has been successfully used to express the sfGFP protein. Inserting more non-natural base pairs can expand the capacity, diversity, and function of classical DNA; however, accurate sequencing of DNA with multiple UBPs using simple and convenient methods remains highly challenging.

[0003] TPT3-NaM is one of the most efficient non-natural base pairs in terms of replication. To date, biotinylation and sequencing analyses have been developed to monitor DNA containing TPT3-NaM. However, biotinylation analysis cannot detect multiple closely spaced coding base pairs (UBPs) or UBPs with non-default gene sites, nor can it detect site mutations near UBPs. Current TPT3-NaM sequencing analyses can be divided into Sanger sequencing and nanopore sequencing. Sanger sequencing can detect single UBPs, where the signal end indicates the correct location of the non-natural base. However, a major obstacle to sequencing multiple UBPs in DNA is the disappearance of the Sanger sequencing signal after the first UBP site, making it difficult to obtain subsequent base sequence information. Nanopore sequencing methods can distinguish non-natural bases based on their different shapes, but this method involves cumbersome modifications to the UBP structure, specialized protein preparation procedures, and specialized instrumentation. To date, it remains impossible to accurately locate and efficiently sequence complex DNA products with two or more TPT3-NaM-UBPs in adjacent coding regions or non-default sites. Summary of the Invention

[0004] The purpose of this invention is to provide an isoTAT-type non-natural triphosphate and its preparation method. This isoTAT-type non-natural triphosphate can specifically recognize and form complementary base pairs with non-natural bases NaM and natural bases G, and for the first time achieves accurate localization, tracking and sequencing of DNA samples containing TPT3-NaM non-natural bases with unlimited sites and quantities.

[0005] To achieve the above objectives, the present invention employs the following technical solution: an isoTAT non-natural triphosphate, characterized by the following structural formula:

[0006] The method for preparing isoTAT non-natural triphosphate according to the present invention is characterized by the following specific steps:

[0007] Step S1: 5-Thiazolium carbaldehyde, pyridine, malonic acid, and piperidine are added sequentially to the reaction vessel and mixed thoroughly. The mixture is then refluxed at 100°C to generate compound a. The reaction equation for the synthesis process is as follows:

[0008]

[0009] Step S2: Compound a, tetrahydrofuran, and triethylamine were added sequentially to the reaction vessel and mixed thoroughly. DPPA was then added dropwise under ice bath conditions. After the addition was complete, the ice bath was removed, and the reaction was continued with stirring to generate compound b. The reaction equation for the synthesis process is as follows:

[0010]

[0011] Step S3: Add compound b to diphenyl ether and heat to 250°C to react and generate compound c. The reaction equation for the synthesis process is as follows:

[0012]

[0013] Step S4: Compound c, dichloromethane, and N,O-bis(trimethylsilyl)acetamide were added sequentially to the reaction vessel and mixed thoroughly. The mixture was stirred at room temperature. Then, 3,5-di-o-(p-tolyl)-2-deoxy-furanibronyl chloride, dissolved in dichloromethane, was added to the reaction system. Anhydrous tin tetrachloride was added under ice bath conditions. After removing the ice bath, the reaction continued to generate compound d, which is in the β configuration. The reaction equation for the synthesis process is as follows:

[0014]

[0015] Step S5: Compound d, Lawson's reagent, and tetrahydrofuran were added sequentially to the reaction vessel and mixed thoroughly. The mixture was then reacted at 80°C to generate compound e. The reaction equation for the synthesis process is as follows:

[0016]

[0017] Step S6: Compound e, methanol, and sodium methoxide are added sequentially to the reaction vessel and mixed thoroughly. The mixture is stirred at room temperature to generate compound f. The reaction equation for the synthesis process is as follows:

[0018]

[0019] Step S7: Compound f and 1,8-bis(dimethylaminonaphthalene) were added sequentially to a round-bottom flask, followed by the addition of trimethyl phosphate to dissolve them. The flask was then placed at -15°C and phosphorus oxychloride was added to react. Then, a DMF solution of tris(tetrabutylammonium)hydrogen pyrophosphate and a DMF solution of tri-n-butylamine were simultaneously added to the reaction system. The mixture was heated to room temperature under a nitrogen atmosphere to generate compound g. The reaction equation for the synthesis process is as follows:

[0020]

[0021] The non-natural base pairs and their derivatives formed by the specific pairing of isoTAT non-natural triphosphate and NaM described in this invention are characterized in that: the non-natural base pairs and their derivatives formed by the specific pairing of isoTAT non-natural triphosphate and NaM exist in the form of nucleosides, nucleotides, or oligonucleotides containing the non-natural base pairs.

[0022] The present invention relates to the hybridization pairing of isoTAT non-natural base triphosphate and G specifically paired to form a non-natural base with a natural base and its derivatives, characterized in that: the hybrid base pair formed by the specific pairing of isoTAT non-natural base triphosphate and G and its derivatives exist in the form of nucleosides, nucleotides or oligonucleotides containing the non-natural base pair.

[0023] The application of isoTAT non-natural triphosphate and the non-natural base pairs, hybrid base pairs and their derivatives formed by specific pairing of NaM or G described in this invention in the preparation of products having at least one of the following functions: 1)-9)

[0024] 1) Recognition of non-natural bases NaM and TPT3 in DNA;

[0025] 2) Detection of non-natural bases NaM and TPT3 in DNA;

[0026] 3) Sequencing of non-natural bases NaM and TPT3 in DNA;

[0027] 4) PCR amplification of DNA containing non-natural bases NaM and TPT3 using isoTAT triphosphate;

[0028] 5) Use isoTAT for dual-localization sequencing of sites containing non-natural bases NaM and unknown TPT3 sites;

[0029] 6) Detection of plasmid replication in semi-synthetic organisms containing non-natural bases NaM and TPT3 using isoTAT;

[0030] 7) Quantitative evaluation of the replication ability of semi-synthetic organism plasmids containing non-natural bases NaM and TPT3 using isoTAT.

[0031] 8) Precise sequencing of multi-site AP damage in genes using isoTAT;

[0032] 9) Precise sequencing of DNA aptamers using isoTAT.

[0033] Further specifying, the product is a reagent kit or a detection product that uses any of the above-mentioned non-natural base pairs and their derivatives as components.

[0034] Compared with existing technologies, this invention has the following advantages and beneficial effects: This invention uses non-natural nucleotides in DNA that can simultaneously recognize NaM-TPT3 and specific natural bases as creative targets. Through pre-steady-state kinetics and steady-state kinetics methods, the dual-pairing function of the isoTAT non-natural base is determined, revealing that isoTAT can pair highly specifically with NaM bases. The pairing ability of isoTAT with NaM is Km / Vmax = 0.77 × 10⁻⁶. 8 isoTAT can pair with G bases with high specificity. The pairing ability of isoTAT with G is Km / Vmax = 2.14 × 10⁻⁶. 8 DNA containing non-natural bases NaM-TPT3 was amplified by PCR in the presence of isoTAT (non-natural nucleoside triphosphate) and four natural nucleoside triphosphates (dNTPs). The NaM-TPT3 bases in the DNA strand could be effectively converted to GC bases, while the other natural bases remained completely unchanged.

[0035] By utilizing the ability of isoTAT to directionally convert NaM-TPT3 bases to GC bases, and the sequence preference of NaM bases themselves, unknown sites of one or more NaM-TPT3 bases in the DNA strand can be accurately located using two PCR amplifications and Sanger sequencing. The isoTAT-directed conversion of NaM-TPT3 bases to GC bases exhibits high readability and low sequence dependence.

[0036] By utilizing isoTAT's ability to directionally convert NaM-TPT3 bases to GC bases, precise sequencing of non-natural NaM-TPT3 base matrix particles in semi-synthetic organisms and accurate assessment of non-natural base gene mutations can be achieved. Through enzymatic insertion of TPT3-NaM bases into AP sites, followed by isoTAT-mediated PCR to pinpoint their precise location, sequencing of DNA samples containing multiple damage sites has been realized.

[0037] By utilizing isoTAT's ability to directionally convert NaM-TPT3 bases to GC bases and its combination with NaM sequence preference, accurate sequencing of nucleic acid aptamers containing multiple non-natural TPT3 bases can also be achieved. The aforementioned isoTAT's ability to directionally convert NaM-TPT3 bases to GC bases provides a universal and convenient method, enabling for the first time accurate localization, tracking, and sequencing of DNA samples containing unrestricted TPT3-NaM non-natural bases. Attached Figure Description

[0038] Figure 1 It is the design of the non-natural base isoTAT structure and the function of converting NaM-TPT3 bases into GC bases.

[0039] Figure 2 These are the pre-steady-state and steady-state kinetic parameters of the non-natural base isoTAT paired with NaM and G.

[0040] Figure 3 This involves a PCR reaction using isoTAT to convert NaM-TPT3 bases to GC bases and Sanger sequencing.

[0041] Figure 4 This is a preference analysis of the sequences converted from NaM-TPT3 bases to GC bases by isoTAT.

[0042] Figure 5 It utilizes isoTAT for precise sequencing of non-natural base matrix particles containing NaM-TPT3 in semi-synthetic organisms and accurate assessment of non-natural base gene mutations.

[0043] Figure 6 The sequencing of DNA samples containing multiple damaged AP sites is achieved by enzymatically inserting TPT3-NaM bases into the AP site and then using isoTAT-mediated PCR to pinpoint the precise location.

[0044] Figure 7 This is the sequencing standard curve of sample A mixed with sample B. The signal intensity is calculated using the reverse C method.

[0045] Figure 8This is the standard curve for sequencing sample C mixed with B, calculated using the reverse of three C signals.

[0046] Figure 9 It is the mutation rate of G on the sense strand of DNA in the DNA fragment deep sequencing after PCR amplification with isoTAT assistance. Detailed Implementation

[0047] The following embodiments further illustrate the above-described content of the present invention in detail. However, it should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0048] Example 1

[0049] Synthesis, isolation, purification and structural identification of non-natural base isoTAT nucleoside triphosphate

[0050] 10.0 g (88.4 mmol) of 5-thiazolyl carboxaldehyde, 50 mL of pyridine, 13.8 g (132.7 mmol) of malonic acid, and 1.3 mL (1.1 g, 13.3 mmol) of piperidine were added sequentially to a 250 mL round-bottom flask. The mixture was refluxed at 100 °C for 8 hours in an oil bath. The reaction was monitored by a TCL until the reactants had completely reacted, at which point the reaction was stopped. After cooling to room temperature, the reaction solution was poured into 150 mL of ice water. 3 M hydrochloric acid was added dropwise with constant stirring. A white solid precipitated continuously during the addition. After precipitation was complete, the mixture was filtered, washed with cold water, and dried under vacuum to give 12.0 g of white solid compound 9, with a yield of 87.5%.

[0051] Compound 9 (12.0 g, 77.3 mmol), 50 mL of dry tetrahydrofuran, and 12.9 mL of dry triethylamine (9.4 g, 92.8 mmol) were sequentially added to a 250 mL round-bottom flask. Under ice bath conditions, 18.3 mL of DPPA (23.4 g, 85.1 mmol) was slowly added dropwise. After the addition was complete, the ice bath was removed, and the reaction was continued with stirring. The reaction was monitored using a TCL until compound 9 was completely reacted, at which point the reaction was stopped. The solvent was removed using a rotary evaporator, and the product was separated by column chromatography to obtain 10.9 g of a white solid, compound 10, in 78.4% yield.

[0052] 200 mL of diphenyl ether was added to a 500 mL round-bottom flask and heated to 250 °C. Compound 10 (5.0 g, 27.7 mmol) was dissolved in a suitable amount of dry dichloromethane and then slowly added dropwise to the reaction system. The reaction was monitored by TLC until compound 10 reacted completely, at which point the reaction was stopped. Column chromatography yielded 1.9 g of a yellowish-brown solid 11, with a yield of 45.2%.

[0053] Under nitrogen protection, compound 11 (340 mg, 2.24 mmol), 10 mL of dry dichloromethane, and N,O-bis(trimethylsilyl)acetamide (500 mg, 2.5 mmol) were sequentially added to a 100 mL round-bottom flask. The mixture was stirred at room temperature for 40 min. 3,5-di-o-(p-tolyl)-2-deoxy-furanibronyl chloride (956.8 mg, 2.46 mmol) was dissolved in a suitable amount of dry dichloromethane and added to the reaction system. Anhydrous tin tetrachloride (290.8 mg, 1.12 mmol) was slowly added dropwise to the reaction system under ice bath conditions. The ice bath was removed and stirring continued. The reaction was monitored by TLC. Once compound 11 had reacted completely, a suitable amount of saturated sodium bicarbonate solution was added to quench the reaction. The mixture was extracted with dichloromethane and saturated brine. The combined organic phases were dried over anhydrous sodium sulfate, and the solvent was removed using a rotary evaporator. 484 mg of white solid compound 12 (β configuration) was obtained by column chromatography, with a yield of 42.9%.

[0054]

[0055] Chemical Synthesis Route of isoTAT Nucleoside Triphosphate

[0056] Under nitrogen protection, compound 12 (56 mg, 0.11 mmol), Lawson's reagent (67.4 mg, 0.17 mmol), and 8 mL of tetrahydrofuran were added sequentially to a 50 mL round-bottom flask. The mixture was reacted overnight in an oil bath at 80 °C. The reaction was monitored by TLC, and the solvent was evaporated using a rotary evaporator. 29 mg of a pale yellow solid, compound 13, was obtained by column chromatography, yielding a yield of 45.6%. Compound 13 (120 mg, 0.1 mmol), 5 mL of methanol, and sodium methoxide (49.8 mg, 0.9 mmol) were added sequentially to a 50 mL round-bottom flask. The mixture was stirred at room temperature until the reaction solution became clear. The reaction was monitored by TLC. After compound 13 had reacted completely, the solvent was evaporated using a rotary evaporator, and 46 mg of a pale yellow solid, compound 14, was obtained by column chromatography, yielding a yield of 70.7%. Compound 14 (20 mg, 0.07 mmol) and 1,8-bis(dimethylaminonaphthalene) (20 mg, 0.07 mmol) were added sequentially to a 10 mL round-bottom flask. The flask was purged three times. Under nitrogen atmosphere, 320 μL of trimethyl phosphate was added to dissolve the reactants. The flask was then placed in an ice-salt bath at -15 °C. Phosphorus oxychloride (14 mg, 0.07 mmol) was added, and the reaction was carried out at -15 °C for 3 hours. Tris(tetrabutylammonium)hydrogen pyrophosphate (364 mg, 0.36 mmol dissolved in 760 μL of dry DMF) and tri-n-butylamine (77.8 mg, 0.4 mmol) were added to the reaction system simultaneously. The reaction was carried out at -10 °C and -5 °C for 10 minutes each, and at 0 °C for 5 minutes. Finally, 0.3 mL of 1.2 M TEAB buffer was added to quench the reaction. The crude product was first separated using DEAEsephdex A25, and then separated by high performance liquid chromatography and freeze-dried to obtain 3.6 mg of the pale yellow solid compound disoTATTP, with a yield of 10%.

[0057] Structural identification data of disoTATTP and its key intermediates:

[0058] Compound 9: ¹H NMR (400MHz, MeOD) δ 9.04 (s, ¹H), 8.11 (s, ¹H), 7.89–7.85 (d, J = 16, ¹H), 6.33–6.29 (d, J = 16, ¹H). ¹³C NMR (101MHz, MeOD) δ 168.04, 155.98, 145.47, 135.06, 133.66, 121.07. Compound 10: ¹H NMR (400 MHz, CDCl₃) δ 8.82 (s, ¹H), 8.03 (s, ¹H), 7.88–7.84 (d, J = 16, ¹H), 6.21–6.17 (d, J = 16, ¹H). ¹³C NMR (101 MHz, CDCl₃) δ 171.14, 155.59, 147.42, 135.35, 134.44, 121.53. Compound 11: ¹H NMR (400 MHz, DMSO) δ 11.70 (s, ¹H), 9.14 (s, ¹H), 7.37–7.35 (d, J = 8, ¹H), 6.96–6.95 (d, J = 4, ¹H). ¹³C NMR (101 MHz, DMSO) δ 158.00, 153.54, 144.78, 144.51, 131.46, 100.06. Compound 12: ¹H NMR (400MHz, CDCl3) δ = 8.83 (s, 1H), 7.98-7.96 (d, J = 8, 2H), 7.89-7.87 (d, J = 8, 2H) ,7.70-7.68(d,J=8,1H),7.29-7.27(d,J=8,2H),7.21-7.19(d,J=8,2H),6.85-6.82 (q,J=4,1H),6.65-6.63(d,J=4,1H),5.66-5.63(m,1H),4.79-4.68(m,2H),4.64-4. 62(q,J=4,1H),3.07-3.02(m,1H),2.43(s,3H),2.39(s,3H),2.36-2.29(m,1H).13C NMR (101MHz, CDCl3) δ166.20,166.16,157.15,151.82,144.51,144.31,144.15,143.09,129.91,129.57,129.33,129 .30,127.99,126.64,126.39,100.06,86.08,83.28,75.10,67.79,64.34,46.85,39.43,33.55,21.76,21.71,20.62.Compound 13: 1H NMR (400MHz, CDCl3) δ8.99 (s, 1H), 8.17-8.16 (d, J = 4, 1H), 7.99-7.97 (m, 2H), 7 .89-7.87(m,2H),7.45-7.42(q,J=4,1H),7.29-7.26(d,J=12,2H),7.22-7.20(d ,J=8,2H),7.04-7.02(d,J=8,H),5.65-5.64(m,1H),4.87-4.74(m,2H),4.71-4 .68(m,1H),3.48-3.42(m,1H),2.44(s,3H),2.40(s,3H),2.30-2.22(m,1H).13C NMR (101MHz, CDCl3) δ166.16,158.08,154.71,154.44,154.07,150.09,144.58,144.47,140.83,138.36,131.38,130.06,129.93,129.59 ,129.39,129.33,127.50,126.53,126.31,109.76,105.61,97.58,91.40,84.42,83.81,74.55,64.08,38.79,29.71,21.78,21.72,1.03. Compound 14: ¹H NMR (400 MHz, MeOD) δ 9.19 (s, ¹H), 8.58–8.56 (d, J = 8, ¹H), 7.44–7.42 (d, J = 8, ¹H), 7.31–7.28 (t, J = 4, ¹H), 4.45–4.41 (m, ¹H), 4.09–4.06 (q, J = 4, ¹H), 3.96–3.82 (m, ¹H), 2.83–2.77 (m, ¹H), 2.17–2.11 (m, ¹H). ¹³C NMR (101MHz, MeOD) δ174.35,155.92,153.70,138.96,131.42,105.74,91.13,88.25,69.84,60.79,41.13. disoTATTP: 31PNMR(162MHz,D2O)δ-9.10,-11.27,-11.39,-22.72,-22.85,-22.97.

[0059] Example 2

[0060] The recognition pairing of the non-natural base isoTAT with NaM and G bases (e.g.) Figure 2 (As shown)

[0061] I. Pre-steady-state kinetics study of single nucleotide insertion experiments

[0062] 1. Anneal and bind a 45-mer DNA template containing NaM, TPT3, or a native base at position 24 with a 5' fluorescently labeled 23-mer primer to form a template / primer complex (2.25 pmol). 2. Mix the template / primer complex with 4.5 U KF (exo-) DNA polymerase and pre-stabilize at 37°C for 1 min. 3. Initiate the reaction by adding isoTAT triphosphate for 15 s. 4. Terminate the reaction by adding 0.05 M pH 8.0 EDTA and evaporate to remove excess water. 5. Add 4 μL of 1× single-stranded loading buffer to the reaction mixture, perform 15 wt% polyacrylamide gel electrophoresis, image with an Amersham Imager 680, and quantify using AI600 imaging analysis software. 6. Calculate the proportion of the n+1 product (primer 24-mer product) to the total primer volume, i.e., the yield of the n+1 product.

[0063] The pairing efficiency of isoTAT with NaM is 90.63%, and the pairing efficiency of isoTAT with G bases is 94.94%. The pairing efficiencies of isoTAT with TPT3 and other natural bases A, T, and C are all below 5%. (See attached figure for results.) Figure 2 B and 2C. Mononucleotide insertion experiments showed that isoTAT can specifically recognize and pair with NaM and G bases without interfering with the recognition and pairing of other natural and non-natural bases.

[0064] II. Measurement of Steady-State Dynamic Parameters

[0065] To further investigate the pairing ability of isoTAT with NaM, G, and their natural and non-natural bases, the kinetic parameters of mononucleotide insertion were determined. All kinetic parameter determinations were performed under steady-state conditions.

[0066] 1. Dissolve 9 pmol of template and primer in 1× reaction buffer, anneal, and bind to form a template / primer complex. 2. Mix the template / primer complex with 0.225 U KF(exo-) DNA polymerase and pre-stabilize at 37°C for 1 min. 3. Initiate the reaction by adding different concentrations of nucleotides for 10 s. 4. Immediately terminate the reaction by adding 0.05 M pH 8.0 EDTA and evaporate to remove water. 5. Add 4 μL of 1× single-stranded loading buffer to the reaction residue, perform 15 wt% polyacrylamide gel electrophoresis, image with Amersham Imager 680, and perform quantitative analysis using AI600 imaging analysis software. 6. Calculate the proportion of n+1 (primer 24-mer product) to the total primers, i.e., the yield of n+1 product, and calculate the initial velocity of single-base insertion reactions at different concentrations of nucleotides. 7. Michaelis-Menten curve fitting was performed using GraphPad Prism 8, and the kinetic parameters of the reaction, such as Vmax, Km, and Vmax / Km, were calculated.

[0067] The Km / Vmax value for isoTAT paired with NaM recognition is 0.77 × 10⁻⁶. 8 The Km / Vmax value for isoTAT paired with G is 2.14 × 10⁻⁶. 8 In comparison, under the same conditions, isoTAT exhibits a lower reaction rate for recognizing and pairing with T, A, and C bases than the detection limit. Therefore, isoTAT can specifically recognize and pair with NaM and G bases.

[0068] Example 3

[0069] PCR amplification and sequencing of DNA containing TPT3-NaM bases using non-natural base pairs (e.g., IsoTAT). Figure 3 (As shown)

[0070] ① Preparation of DNA double-stranded template containing dNaM-PTP3

[0071] To verify the base specificity of disoTAT and dNaM substitution PCR, we first prepared a double strand containing dNaM-PTP3 using a customized single-stranded DNA template, and then used this as a template for substitution PCR.

[0072] DNA template sequence (single-stranded containing dNaM):

[0073] CACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAGCACTTGGAATTCACAACCGGNaMATCCCGAGGAAACCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCCTATAGTGAGTCGTATTAATTTC

[0074] Primers:

[0075] FendT-FTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACACAGGAAACAGCTATGAC

[0076] FendT-RTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATTAATACGACTCACTATAGG

[0077] 2×OneTaq DNA polymerase, dNaMTP and disoTATTP

[0078] Reaction system: 12.5 μL DNA polymerase, 100 μM non-natural triphosphates dNaMTP and disoTATTP, 0.4 μM primers, 0.4 ng template, and ultrapure water added to a final volume of 25 μL. Subsequent PCR amplification reactions followed this system, differing only in the template and the types of non-natural triphosphates used.

[0079] Mix the reaction mixture thoroughly and place it in a PCR instrument. Run the following program (subsequent PCR programs are consistent with this program): a: 96℃ denaturation for 10 seconds; b: 60℃ annealing for 15 seconds; c: 68℃ extension for 1 minute; d: repeat steps a, b, and c for 35 cycles; e: 68℃ extension for 5 minutes. Take 3 μL of the reaction mixture, add 0.5 μL of loading buffer, and perform agarose gel electrophoresis. The target band should appear at 250 bp. Perform Sanger sequencing on the remaining samples (sequencing in both forward and reverse directions).

[0080] ②disoTATTP base substitution PCR

[0081] Using the DNA double-stranded template containing dNaM-dTPT3 obtained in ①, the template was named 1N template. Then, disoTATTP-dNaMTP was added to the PCR reaction system, and the base substitution results were obtained through sequencing.

[0082] 1N template: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAGCACTTGGAATTCACAACCGGNaMATCCCGAGGAAACCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCCTATAGTGAGTCGTATTAATTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0083] Reaction system: 12.5 μL LoneTaq DNA polymerase, 0.4 μM primers, 0.4 ng template 1N, 100 μM dNaMTP, 100 μM disoTATTP, and ultrapure water added to a reaction system of 25 μL.

[0084] Sample 1: 1N template, One Taq DNA polymerase, dNaMTP

[0085] Sample 2: 1N template, One Taq DNA polymerase, disoTATTP, and dNaMTP

[0086] Experimental Results Analysis: In the PCR reaction system with only dNaMTP, the position of the non-natural base dNaM was read as T. This is because, in the absence of dTPT3 in the system, dNaM is more likely to pair with A, resulting in dNaM being read as a T signal during sequencing. However, in the PCR system with disoTATTP, the position of the non-natural base NaM was replaced with G. The sequencing passthrough of DNA sequences containing disoTATTP-dNaMTP indicates that isoTAT replaces most or all of the complementary non-natural base sites in the DNA with natural bases.

[0087] Example 4

[0088] Accurate sequencing of non-natural base matrix particles containing NaM-TPT3 in semi-synthetic organisms using isoTAT and accurate assessment of non-natural base gene mutations (e.g.) Figure 5 (As shown)

[0089] Experiments have demonstrated that disoTAT can replace the non-natural base NaM in the template with G. The replaced DNA solution was then mixed with other natural templates in a specific ratio for sequencing. A standard curve was constructed by comparing the ratio of non-natural base signals in the original sequencing signal to the ratio of non-natural base signals in the post-sequencing signal, and the proportion of GC template. This standard curve can be used to calculate the retention rate of non-natural bases in cells amplified with non-natural base pairs.

[0090] ① DNA template and primers used in the experiment

[0091] Contains a NaM 1N template:

[0092] CACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAGCACTTGGAATTCACAACCGGNaMATCCCGAGGAAACCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCCTATAGTGAGTCGTATTAATTTC

[0093] Natural template:

[0094] CACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAGCACTTGGAATTCACAATACTTTCTTTAAGGAAACCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCCTATAGTGAGTCGTATTAATTTC

[0095] 3N Template:

[0096] CACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAGCACTTGGNaMATTCACAATACTNaMTCTTTAAGGAAACCNaMTAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCCTATAGTGAGTCGTATTAATTTC

[0097] Note: Differences between the 1N template and the natural template are indicated by underscores. The non-natural base NaM corresponds to the natural base T in the natural template. The first and third non-natural bases in the 3N template correspond to A in the natural template and are indicated by italics and bold.

[0098] Primers: Long primers containing poly-T, consistent with the PCR amplification primers in Example 2. 2×OneTaq DNA polymerase, disoTATTP, and dNaMTP.

[0099] ② Experimental methods and results

[0100] Reaction system:

[0101] Sample A: 12.5 μL 2×OneTaq DNA polymerase, 0.4 ng non-natural template 1N, 0.4 μM primers, 100 μM disoTATTP and dNaMTP, with water added to 25 μL.

[0102] Sample B: 12.5 μL 2×OneTaq DNA polymerase, 0.4 ng natural template, 0.4 μM primer, water added to 25 μL.

[0103] Sample C: 12.5 μL 2×OneTaq DNA polymerase, 0.4 ng non-natural template 3N, 0.4 μM primers, 100 μM disoTATTP and dNaMTP, with water added to 25 μL.

[0104] The PCR reaction procedure is the same as above.

[0105] After the reaction, the PCR products were recovered by agarose gel electrophoresis and a gel extraction kit to obtain samples A, B, and C containing the target band. (Because sequencing samples require a certain concentration, the above reaction is not limited to one set). Samples A, B, and C were quantified to the same concentration and then mixed thoroughly in different proportions as follows before being sent for sequencing.

[0106] Sequencing sample ①: 100% A; Sequencing sample ②: 90% A and 10% B

[0107] Sequencing sample ③: 80% A and 20% B; Sequencing sample ④: 70% A and 30% B

[0108] Sequencing sample ⑤: 60% A and 40% B; Sequencing sample ⑥: 50% A and 50% B

[0109] Sequencing sample ⑦: 40% A and 60% B; Sequencing sample ⑧: 30% A and 70% B

[0110] Sequencing sample ⑨: 20% A and 80% B; Sequencing sample ⑩: 100% B

[0111] Samples B and C (sequencing samples 11-20) were mixed using the same mixing method, and the sequencing results are as follows:

[0112] In sample A, non-natural base pairs were replaced with GC by isoTAT, while in sample B, the corresponding sites for natural base pairs were TA. In sample C, all three non-natural base pairs were replaced with GC, while in sample B, the corresponding sites were AT, TA, and AT, respectively. As the number of samples B gradually increased, the signal value of T corresponding to non-natural bases gradually increased. As the number of samples A gradually decreased, the signal value of G corresponding to non-natural base replacement gradually decreased. The proportion of non-natural base signal intensity varied depending on the ratio of samples A to C.

[0113] Calculation of signal intensity ratio for non-natural bases (based on raw sequencing signals): Taking the 1N reverse non-natural base site C as an example: Signal intensity ratio of C = Sequencing signal of C / Average signal value of all C sites after the non-natural base. A standard curve is plotted between the signal intensity ratio and the actual sample proportion, as shown below. Figure 7 As shown.

[0114] From the standard curve of the 3N template ( Figure 8 As can be seen, even for the same sequence, different non-natural base pairs yield different standard curves, which may be due to differences in sequencing signal intensity at different sites. Establishing a standard curve helps calculate the retention rate of non-natural base pairs in cells. Using semi-synthetic organisms containing non-natural base pairs as templates, PCR amplification and sequencing are performed. By calculating the signal intensity ratio of non-natural base pairs in the sequence, the retention rate is calculated based on the standard curve.

[0115] Intracellular experimental validation standard curve:

[0116] PtNTT2 plasmid expression was synthesized using GenScript. Simultaneously, PCR amplification of the 134-mer template containing dNaM was performed using OneTaq DNA polymerase, including a 1N template containing one pair of non-natural bases and a 3N template containing three pairs of non-natural bases. A linear fragment was amplified from pBLUE-T. The product was purified using a DNA gel extraction kit. Circular overlap extension PCR was used to bind the linear fragment to the 134-mer template.

[0117] The PCR procedure was the same as above. The PCR products were analyzed by restriction endonuclease digestion and directly used for E. coli transformation. dTPT3 was incubated separately with E. coli samples using different templates for 17 hours, and cell growth was monitored. Finally, polymerase chain reaction (PCR) was performed using E. coli cells as a template, and the reaction mixture was sequenced.

[0118] The sequencing results are shown in the figure:

[0119] In vivo sequencing retention rate calculation

[0120]

[0121] Analysis of experimental results: From Figure 5 As can be seen, the addition of non-natural bases attenuates the sequencing results of dTPT3-dNaM, proving that the non-natural base pairs were successfully incorporated into the cells. Currently, sequencing can be used to calculate the retention rate and fidelity of sequences containing one non-natural base pair. Fidelity is calculated using raw sequencing data and a standard curve. Retention rate ① is estimated from the standard curve, and retention rate ② is calculated from the sequencing data. Currently, it is not possible to calculate the retention rate of sequences containing multiple non-natural base pairs, but this can be done using the standard curve. Differences between actual calculations and formula estimations are normal; some bases are lost during in vivo amplification of non-natural bases, leading to higher calculated results. Establishing a standard curve helps to estimate the retention rate of sequences containing multiple non-natural base pairs in E. coli cells.

[0122] Example 5

[0123] Sequencing of DNA samples containing multiple damaged AP sites is achieved by enzymatically inserting TPT3-NaM bases into AP sites and then using isoTAT-mediated PCR to pinpoint their precise location. Figure 6 )

[0124] Using TPT3 to label the AP sites generated after dU splicing in DNA

[0125] KRAS-1U-F or 2U-F and KRAS-R or 134-2U-F and 134-2U-R (0.2 μM, 50 μL) were annealed in AB cloning buffer B to form double-stranded DNA. UDG (1 U) was added to the reaction mixture and incubated at 37 °C for 30 min. Then, APE1 (10 U) was added to the reaction mixture, and the mixture was incubated at 37 °C for 1 h, followed by heating at 95 °C for 10 min. Next, dTPT3TPbiotin (30 μM) and Kf(exo-)DNA polymerase (7 U) were added to the reaction mixture, and the reaction was terminated at 37 °C for 1 h by heating to 95 °C. Finally, T4-DNA ligase (200 U), dimethyl sulfoxide (10% (v / v)), and ATP (0.2 mM) were added to the reaction mixture, and the mixture was incubated at 25 °C for 1 h. The reaction steps were monitored using a 20% denaturing PAGE gel.

[0126] The gap formation and ligation processes were analyzed using denaturing PAGE gel chromatography. Treatment of the template DNA with APE1 revealed two shorter DNA strands, which were detected as full-length products upon the addition of T4-DNA ligase. The reaction products were then used for PCR amplification with dTPT3TPbiotin and NaM, and the PCR products were conveniently enriched via biotin-streptavidin-based strand translocation.

[0127] Isolation of labeled DNA and PCR amplification of TPT3-labeled AP site DNA

[0128] The final reaction solution (KRAS-1U or 134-2U) was used as a template for further PCR assays. First, labeled DNA was further labeled and amplified by PCR. The following reagents were added: template (final reaction solution, 1 μL), dNTPs (400 μM), dTPT3TPbiotin (20 μM), dNaMTPs (50 μM), and MgSO4 (2.2 mM), primers (400 nM each), OneTaq DNA polymerase (0.018 U / μL), and DeepVent DNA polymerase (0.007 U / μL), in 1× reaction buffer (total 25 μL). The mixture was thermally cycled under the following conditions: 20× (96 °C, 30 s; 50 °C, 10 s; 68 °C, 4 min), with a final extension at 68 °C for 5 min. The product (5 μL) was then incubated with streptavidin (1 μg, Solarbio) at 37 °C for 30 min. The samples were then mixed with the loaded dye and separated by 6% (134-2U) or 10% (KRAS-1U) non-denaturing polyacrylamide gel electrophoresis. The transposition strips were eluted by shaking and soaking at 37°C for 2 hours, and quantification was performed using NanoDrop. TM OneC was used as a template for PCR (0.5-2 ng per sample) for PCR amplification.

[0129] For DNA samples containing one dU site, the dU site replaced by TPT3 biotin was transferred to C, while the original dU site was transferred to T. For DNA samples containing two dU sites, all dU sites replaced by TPT3 biotin were transferred to C, while all original dU sites were transferred to T. These results indicate that TPT3 biotin can insert into dU lesion sites and transfer to C via bridging PCR, and dU can be identified in this model system.

[0130] Preparation of plasmids containing multiple AP damage sites

[0131] pUC-19 plasmid was transformed into E. coli DH5α cells. Single colonies were grown overnight at 37°C in 2 mL of LB medium. Then, 10 μL of the culture was diluted with fresh LB medium and incubated at 37°C and 230 rpm until OD500 was achieved. 600 =1 for H2O2 treatment. Add H2O2 to the culture at a final concentration of 1 mM to generate AP sites. After incubation at ambient temperature for 30 minutes, harvest cells by centrifugation at ambient temperature and extract plasmid DNA using a plasmid isolation kit according to the manufacturer's (OMEGA) protocol. Use plasmids from cells not treated with H2O2 as a control.

[0132] As described above, AP sites in plasmid DNA were labeled with the non-natural nucleotide dTPT3TPbiotin. The labeled DNA was isolated and subjected to isoTAT-assisted PCR and deep sequencing. We found that the mutation rates of A with C and C with A were selectively increased at certain sites. Furthermore, we found significantly increased mutation rates at some G and T sites. Most sites showing increased A or C signaling overlapped well, especially these sites, which showed the largest increases, while the mutation ratios at other sites were close to baseline. Figure 9 These findings suggest that AP sites may accumulate in some preferred regions, and our bridging method can be used to identify AP damage sites in DNA.

[0133] The above embodiments describe the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are only illustrative of the principles of the present invention. Various changes and modifications can be made to the present invention without departing from the scope of the principles of the present invention, and all such changes and modifications fall within the protection scope of the present invention.

Claims

1. A non-natural triphosphate (isoTAT), characterized in that... Its structural formula is:

2. A method for preparing isoTAT non-natural triphosphate as described in claim 1, characterized in that... The specific steps are as follows: Step S1: 5-Thiazolium carbaldehyde, pyridine, malonic acid, and piperidine are added sequentially to the reaction vessel and mixed thoroughly. The mixture is then refluxed at 100°C to generate compound a. The reaction equation for the synthesis process is as follows: Step S2: Compound a, tetrahydrofuran, and triethylamine were added sequentially to the reaction vessel and mixed thoroughly. DPPA was then added dropwise under ice bath conditions. After the addition was complete, the ice bath was removed, and the reaction was continued with stirring to generate compound b. The reaction equation for the synthesis process is as follows: Step S3: Add compound b to diphenyl ether and heat to 250°C to react and generate compound c. The reaction equation for the synthesis process is as follows: Step S4: Compound c, dichloromethane, and N,O-bis(trimethylsilyl)acetamide were added sequentially to the reaction vessel and mixed thoroughly. The mixture was stirred at room temperature. Then, 1-α-chloro-3,5-di-O-p-toluamide-2-deoxy-D-furanose dissolved in dichloromethane was added to the reaction system. Anhydrous tin tetrachloride was added under ice bath conditions. After removing the ice bath, the reaction continued to generate compound d, which is in the β configuration. The reaction equation for the synthesis process is as follows: Step S5: Compound d, Lawson's reagent, and tetrahydrofuran were added sequentially to the reaction vessel and mixed thoroughly. The mixture was then reacted at 80°C to generate compound e. The reaction equation for the synthesis process is as follows: Tol is p-toluyl; Step S6: Compound e, methanol, and sodium methoxide are added sequentially to the reaction vessel and mixed thoroughly. The mixture is stirred at room temperature to generate compound f. The reaction equation for the synthesis process is as follows: Step S7: Compound f and 1,8-bis(dimethylaminonaphthalene) were added sequentially to a round-bottom flask, followed by the addition of trimethyl phosphate to dissolve them. The flask was then placed at -15°C and phosphorus oxychloride was added to react. Then, a DMF solution of tris(tetrabutylammonium)hydrogen pyrophosphate and a DMF solution of tri-n-butylamine were simultaneously added to the reaction system. The mixture was heated to room temperature under a nitrogen atmosphere to generate compound g. The reaction equation for the synthesis process is as follows:

3. A nucleotide, characterized in that: The nucleotide comprises a non-natural base pair formed by the specific pairing of isoTAT (non-natural triphosphate) and NaM as described in claim 1.

4. The nucleotide according to claim 3, characterized in that: The nucleotide is an oligonucleotide.

5. A nucleotide, characterized in that: The nucleotide comprises isoTAT, a non-natural base triphosphate as described in claim 1, and G specifically paired to form a hybridization pair between the non-natural base and the natural base.

6. The nucleotide according to claim 5, characterized in that: The nucleotide is an oligonucleotide.

7. The use of the non-natural base pairs or hybrid base pairs formed by the specific pairing of isoTAT non-natural triphosphate and NaM or G according to claim 1 in the preparation of products having at least one of the following functions: 1)-9) 1) Recognition of non-natural bases NaM and TPT3 in DNA; 2) Detection of non-natural bases NaM and TPT3 in DNA; 3) Sequencing of non-natural bases NaM and TPT3 in DNA; 4) PCR amplification of DNA containing non-natural bases NaM and TPT3 using isoTAT triphosphate; 5) Use isoTAT for dual-localization sequencing of sites containing non-natural bases NaM and unknown TPT3 sites; 6) Detection of plasmid replication in semi-synthetic organisms containing non-natural bases NaM and TPT3 using isoTAT; 7) Quantitative evaluation of the replication ability of semi-synthetic organism plasmids containing non-natural bases NaM and TPT3 using isoTAT. 8) Precise sequencing of multi-site AP damage in genes using isoTAT; 9) Precise sequencing of DNA aptamers using isoTAT.

8. The application according to claim 7, characterized in that: The product in question is a reagent kit.

Citation Information

Patent Citations

  • Synthetic method for non-natural basic monomer-heterocyclic pyridine thioketone deoxyribonucleoside triphosphate and derivatives thereof

    CN104262437A

  • Non-natural base triphosphoric acid as well as synthesis method and application thereof

    CN114031648A