Fhh-based colloidal gold detection method for fasciola hepatica

Abstract

The application discloses a liver fluke colloidal gold detection method based on specific antigen FHH, which adopts liver fluke specific antigen gene FHH, FHH protein, colloidal gold particles, S. aureus protein A labeled colloidal gold particles and a detection test strip to perform detection. The method has the advantages of simplicity and rapidness, visual result, low cost, high specificity and high sensitivity. The antigen gene FHH obtained through screening of a liver fluke adult cDNA expression library guarantees the specificity of the application. The application is suitable for clinical rapid diagnosis and large-scale epidemiological investigation.

Description

Technical Field

[0001] This invention relates to the field of immunology technology, specifically to a colloidal gold detection method for Fasciola hepatica based on the specific antigen FHH. Background Technology

[0002] Fasciolopsis buski is an important zoonotic parasitic disease caused by Fasciolopsis buski. It can infect various mammals, including ruminants such as cattle, sheep, and deer, pigs, equines, and some wild animals; human infection has also been reported. The disease can cause hepatitis and cholangitis in the host, accompanied by systemic poisoning and nutritional deficiencies, seriously endangering human health and significantly impacting livestock farming. Currently, commonly used detection methods for Fasciolopsis buski include etiological, molecular biological, and immunological methods. Etiological diagnosis often involves microscopic observation of fecal samples containing fascioliasis eggs, a classic diagnostic method. However, this method has drawbacks such as high resource consumption, low detection rate, and a tendency to miss cases. Molecular biological diagnosis primarily targets specific genes of Fasciolopsis buski. While this method has high specificity and sensitivity, it requires specialized equipment and is suitable for laboratory testing, but not for widespread clinical application. The principle of immunological diagnosis of liver flukes is the specific binding of antigens and antibodies, using known liver fluke antigens (antibodies) to detect antibodies (antigens). ELISA detection requires specialized operation and equipment, and is time-consuming. Colloidal gold test strips offer a rapid, simple, and intuitive diagnostic method that does not require specialized operation or equipment, making it suitable for clinical examination. Mature and reliable immunological diagnostic methods are based on antigen genes with high specificity and sensitivity; therefore, the selection of specific antigens is particularly important. Furthermore, addressing the current scarcity of diagnostic antigens for liver fluke disease in my country, this invention screens liver fluke-specific antigen genes from a liver fluke cDNA library and, based on this, develops a colloidal gold test strip for detecting sheep liver flukes, which is then used to test clinical samples. Summary of the Invention

[0003] The purpose of this invention is to address the deficiencies of existing technologies by providing a colloidal gold detection method for Fasciola hepatica based on the specific antigen FHH, thereby resolving the problems mentioned in the background section.

[0004] To achieve the above objectives, the present invention provides the following technical solution: a colloidal gold detection method for Fasciola hepatica based on the specific antigen FHH. This method comprises the Fasciola hepatica specific antigen gene FHH, FHH protein, colloidal gold particles, colloidal gold particles labeled with Staphylococcus aureus protein A, and a test strip for detection. The Fasciola hepatica specific antigen gene FHH is screened using a Fasciola hepatica cDNA expression library, establishing an indirect colloidal gold test strip detection method. During the detection process, the FHH protein binds to specific antibodies in the positive serum of sheep infected with Fasciola hepatica, making the colloidal gold immunochromatographic test strip more specific. This test strip can be stored in a normal environment, requires no instruments or equipment, and is easy to carry. The method allows for visual observation of results in approximately 15 minutes, making it suitable for large-scale clinical sample testing.

[0005] As a preferred embodiment of the present invention, the liver fluke-specific antigen gene FHH has the gene sequence shown in Sequence 1; the primers for amplifying the antigen gene FHH were designed using CE designV1 software, using the restriction enzyme sites BamHI and Xho I, and their nucleotide sequences are shown in Sequence 2.

[0006] As a preferred embodiment of the present invention, the FHH protein is a purified pET-32a-FHH recombinant protein, which is predicted to have good antigenicity using bioinformatics analysis, and the protein is verified to have good reactivity by Western blotting.

[0007] As a preferred technical solution of the present invention, the preparation process of the colloidal gold particles is as follows: 40nm colloidal gold particles are prepared by calcination using the trisodium citrate reduction method.

[0008] As a preferred embodiment of the present invention, the colloidal gold particles labeled with Staphylococcus aureus protein A are prepared as follows: 1 mL of colloidal gold solution is added to 2 μL of 0.2 mol / L K2CO3 to adjust the pH, 5 μg of SPA protein is added for labeling, then blocked with 10% BSA, the supernatant is discarded after centrifugation, the solution is dissolved in 10% reconstitution solution and dropped onto the gold labeling pad.

[0009] As a preferred embodiment of the present invention, the test strip is composed of a PVC base plate, a sample pad, a gold-labeled pad, a glass fiber membrane, a nitrocellulose membrane, and an absorbent plate; wherein the gold-labeled pad contains a gold-labeled antibody, the NC membrane detection line contains purified liver fluke-specific antigen FHH protein, and the NC membrane control line contains rabbit anti-SPA secondary antibody; finally, the sample pad, gold-labeled pad, NC membrane, and absorbent plate are overlapped by 2 mm to assemble the test strip.

[0010] The beneficial effects of this invention are:

[0011] First, a novel Fasciola hepatica-specific antigen gene FHH (gene number) was provided through screening of a Fasciola hepatica cDNA expression library, and this gene was used to improve the specificity of the colloidal gold detection method.

[0012] Second, by expressing FHH protein in prokaryotes, and by making colloidal gold particles, Staphylococcus aureus protein A (SPA) labeled colloidal gold particles, and test strips, the production cost of this detection method has been reduced.

[0013] Third, an indirect colloidal gold test strip was developed, which is simple, fast, requires no professional personnel or instruments, and provides intuitive results, making it suitable for clinical application.

[0014] In summary, this method is rapid, convenient, provides visual results, is low in cost, and has high specificity. It can serve as a tool for detecting liver flukes in sheep without requiring specialized instruments or personnel. It is particularly suitable for clinical field testing and large-scale epidemiological surveys, providing a good technical means for the diagnosis and prevention of liver fluke disease. Attached Figure Description

[0015] Figure 1 The image shown is a graph of phage plaques and immune screening results;

[0016] Figure 2 The image shown is a bioinformatics analysis diagram of the FHH protein;

[0017] Figure 3 The image shown is a diagram of the purification process of the FHH recombinant protein.

[0018] Figure 4 The image shown is an identification diagram of the FHH recombinant protein;

[0019] Figure 5 The diagram shown illustrates the criteria for judging colloidal gold test strips.

[0020] Figure 6 The image shown is a transmission electron microscope (TEM) image of colloidal gold particles.

[0021] Figure 7 The image shown is a transmission electron microscope (TEM) image of SPA-labeled colloidal gold particles.

[0022] Figure 8 The figure shows the determination of the optimal coating concentration for the detection line (T);

[0023] Figure 9 The figure shows the determination of the optimal coating concentration for the quality control line (C);

[0024] Figure 10 The image shows a sensitivity test;

[0025] Figure 11 The image shows a specificity test;

[0026] Figure 12 The diagram shows a repeatability test;

[0027] Figure 13 The image shown is a clinical sample testing diagram. Detailed Implementation

[0028] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings, so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby providing a clearer and more explicit definition of the scope of protection of the present invention.

[0029] Example 1: Screening and Analysis of Liver Fluke cDNA Expression Library

[0030] 1. Phage culture and induced expression;

[0031] (1) XL1-Blue bacterial culture: 10 μL of XL1-Blue glycerol bacteria were inoculated into liquid LB medium containing 0.1% tetracycline and incubated overnight at 37°C with a shaker. The bacterial culture was centrifuged and the precipitate was collected.

[0032] (2) Phage culture: Preheat NZY agar plates; treat the top layer of NZY agar at 45℃; sequentially add 200μL 20mM Mg2SO4, 100μL SM buffer, and 100μL 10 5 Resuspend the XL1-Blue bacterial block in a 4 mL centrifuge tube after dilution of the liver fluke phage cDNA expression library. Add NZY top agar, mix well, and pour into an NZY agar plate. Seal and incubate at 37°C for 6 hours.

[0033] (3) Phage screening library induction expression: The NC membrane was immersed in 10mM IPTG solution. The NC membrane was then placed on the top layer of cultured NZY medium, sealed, and incubated upside down in a 37℃ incubator for 6 hours. The NC membrane was carefully peeled off with tweezers and placed in a petri dish, which was then placed at 4℃.

[0034] 2. Immunoincubation of plaque-expressing proteins;

[0035] (1) Blocking: Wash the NC membrane with TNT buffer for 5-8 min / wash, 3 times. Place the NC membrane containing liver fluke expression protein in TNT blocking solution and block at room temperature for 2 h.

[0036] (2) Primary antibody incubation: The positive serum of sheep liver fluke naturally infected with TNT blocking solution was diluted to a dilution ratio of 1:400. Then the NC membrane was placed in the primary antibody dilution solution containing the primary antibody and incubated at room temperature for 3 hours.

[0037] (3) Membrane washing: After the primary antibody incubation is completed, the membrane is washed. The NC membrane is placed in TNT buffer solution for washing for 15-20 min each time, for a total of 3 times.

[0038] (4) Secondary antibody incubation: The HRP-rabbit anti-goat IgG antibody was diluted with TNT blocking buffer at a dilution ratio of 1:5000. Then the NC membrane was placed in the secondary antibody dilution buffer and incubated at room temperature for 1 hour.

[0039] (5) Membrane washing: After the secondary antibody incubation is completed, the membrane is washed. The NC membrane is placed in TNT buffer solution for washing, 15-20 min / time, for a total of 3 times;

[0040] (6) Development: Place the NC membrane in the ECL chemiluminescence imaging system with the side of the NC membrane that is in contact with the NZY culture medium facing upwards. Add an appropriate amount of developing solution to the NC membrane for development.

[0041] 3. Amplification of positive phage plaques;

[0042] Phage plaques consistent with the development results were selected from the plate for amplification. Primers were universal primers for phage sequencing: upstream primer: 5'-CTCGGGAAGCGCGCCATTGTGTTGGT-3'; downstream primer: 5'-ATACGACTCACTATAGGGCGAAT-TGGCC-3'. PCR reaction mixture (total 20 μL): 10 μL 2×Master Mix, 1 μL each of upstream and downstream primers, 1 μL template, and ddH2O to make up the volume. PCR program: 94℃ for 5 min; 94℃ for 60 s, 61℃ for 60 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 10 min. PCR products were identified by 1% agarose gel electrophoresis. The recovered and purified PCR products were sent to the company for sequencing, and the sequencing results were analyzed using BLAST on NCBI.

[0043] 4. Specific gene bioinformatics analysis;

[0044] The secondary structure and antigenic epitopes of the protein were analyzed using the protean program in the bioinformatics software DNAStar, and their functional prediction analysis was performed using the COFACTOR algorithm in I-TASSER.

[0045] result:

[0046] 1. Screening for positive phage plaques;

[0047] Overnight phage culture showed uniform and well-distributed phage plaques on plates. Figure 1 After incubation on the NC membrane, clear protein expression blots were observed during imaging. Figure 1 The results showed that the liver fluke antigen gene was successfully expressed on the surface of the bacteriophage.

[0048] 2. PCR amplification and sequence analysis of positive phage plaques;

[0049] Positive phage plaques were selected and amplified using universal phage primers to obtain the inserted Fasciola hepatica gene fragment in the phage. Homology analysis of the PCR product sequencing results showed that the hypothetical protein D915-009456 is a Fasciola hepatica-specific antigen gene, showing homology only with Fasciola hepatica-related proteins and no cross-homology with proteins from other species.

[0050] 3. Bioinformatics analysis of specific antigen genes;

[0051] Using biological software to analyze secondary structures and antigenic epitopes Figure 2 The gene for the hypothetical protein D915_009456 was found to be 231 bp in length, encoding 76 amino acids. Based on its secondary structure, hydrophilicity, surface potential, flexibility, and antigenicity, the hypothetical protein D915_009456 is predicted to have three potential B-cell antigenic epitopes, mainly located at or near amino acid residues 11-16, 22-24, and 43-49, totaling 16 amino acids, accounting for 21% of the entire amino acid sequence. Furthermore, protein function prediction suggests that the hypothetical protein D915_009456 may possess hydrolase activity; therefore, it will be referred to as FHH protein below, and is presumed to have good antigenicity.

[0052] Example 2: Expression and purification of FHH protein, a liver fluke-specific antigen;

[0053] 1. Construction of prokaryotic vectors;

[0054] (1) Primer design: Amplification primers for the specific gene FHH were designed using CE designV1 software. The restriction sites were BamHI and XhoI. The upstream primer was 5'-GCCATGGCTGATATCGGATCCATGAATTTCCTTGGGATTATTTTAACT-3'; the downstream primer was 5'-GTGGTGGTGGTGGTGCTCGAGAAGCTGAGCAATATATCCGCG-3'.

[0055] (2) Amplification of the target gene: Amplification was performed using liver fluke cDNA as a template. The PCR reaction system (25 μL) consisted of: TaKaRaTaq enzyme 0.25 μL, 10× PCR buffer (Mg... 2+ 5 μL of pre- and post-conversion primers, 4 μL of dNTP Mixture, 500 ng of template, 2 μL each of forward and reverse primers, and dd H2O to make up the volume. PCR program: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 10 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 10 min.

[0056] (3) Vector construction: The amplified and recovered target gene product was ligated into the cloning vector pMD-18T, and then the plasmid was extracted for identification by agarose gel electrophoresis, double enzyme digestion, and sequencing. Double enzyme digestion system (20 μL): pMD-18T-FHH 16 μL, 10×QuickcutGreen 2 μL, QuickCut TM BamHI 1μL, QuickCut TM XhoI 1 μL, incubated at 37℃ for 25 min. After correct sequence alignment, ligated into the expression vector pET-32a, and subjected to double enzyme digestion and sequencing again. Plasmids with correct sequence alignment were extracted and transformed into competent BL21(DE3) cells for later use.

[0057] 2. Purification and identification of recombinant protein FHH;

[0058] (1) Inclusion body purification: After overnight incubation of pET-32a-FHH bacterial culture at 37°C on a shaker, 1 mL of the activated bacterial culture was added to a fresh 1 L container containing Amp. + In resistant LB medium, the culture was shaken at 37°C until the OD value of the bacterial suspension reached 0.6-0.8. IPTG, the inducer, was added, and the culture was incubated at 16°C for 16 hours. After incubation, the bacterial suspension was centrifuged to collect the precipitate. The bacterial precipitate was washed three times with 0.01 mol / L PBS, and TE buffer was added. The suspension was then sonicated, and the inclusion body precipitate was collected. Washing buffer I was added, and the suspension was washed at 200 rpm for 2 hours at room temperature. The precipitate was then centrifuged at 6080 g for 40 minutes at 4°C, and the inclusion body precipitate was collected. The inclusion bodies were washed once with washing buffer II under the same conditions. The precipitate was dissolved in denaturing buffer and stirred overnight at 120 rpm at room temperature. The precipitate was then centrifuged at 6080 g for 30 minutes at 25°C, and the supernatant was collected. Denatured inclusion bodies were placed in dialysis bags and sequentially immersed in refolding buffers I, II, III, and IV at 4°C for renaturation, with each dialysis session lasting 6–12 hours. The bodies were then dialyzed in 0.01 mol / L PBS buffer (pH 7.4) for 6 hours. Afterward, the bodies were centrifuged at 6080 × g for 30 minutes at 4°C, and the supernatant was collected. Samples from each step were analyzed using 15% SDS-PAGE.

[0059] (2) Specific serum verification: The purified liver fluke FHH recombinant protein was prepared and Western blotting was performed using sheep liver fluke infection positive serum to identify the recombinant protein and analyze its reactivity.

[0060] result:

[0061] 1. Construction of a protein expression vector for the liver fluke-specific antigen gene FHH;

[0062] (1) Amplification of the target gene: A single, distinct band was observed at 250 bp by 1% agarose gel electrophoresis, and the FHH gene band was successfully obtained.

[0063] (2) Vector construction: The expression vector pET-32a and the recombinant cloning plasmid pMD-18T-FHH were double-digested, and the antigen gene fragment and vector fragment were recovered by gel digestion. The fragments were ligated using T4 ligase. Colony PCR showed that the antigen gene fragment and vector fragment were successfully ligated.

[0064] 2. Purification and identification of recombinant protein FHH;

[0065] (1) Inclusion body purification: After transforming the recombinant expression vector into the expression strain BL21, the recombinant protein was induced to express using IPTG. SDS-PAGE analysis showed that the target band size was approximately 28 kDa, consistent with expectations, and expressed in inclusion body form. Figure 3 );

[0066] (2) Specific serum verification: Western blotting was performed using serum from sheep infected with Fasciola hepatica to obtain a clear immunoblot. Figure 4 This indicates that FHH has good reactivity.

[0067] Example 3: Establishment of a method for detecting sheep liver fluke using colloidal gold chromatography test strips;

[0068] 1. Preparation and identification of colloidal gold solutions;

[0069] (1) Preparation of colloidal gold solution: Taking 100 mL as an example, measure 99 mL of ultrapure water and add it to a round-bottom flask, which is then placed on a heated magnetic stirrer. Turn on the heating switch, and after the rotor surface is covered with bubbles, turn on the magnetic rotary switch and add 1 mL of chloroauric acid solution and 1 mL of sodium citrate solution in sequence. After observing that the liquid color turns into a stable wine red, continue heating for 8 min and then turn off the heat. Cool the colloidal gold to room temperature, and make up the volume to 100 mL with ultrapure water. Store at 4°C protected from light.

[0070] (2) Identification of colloidal gold particles: Take transmission electron microscopy to observe whether the colloidal gold particles are uniform in size and evenly distributed.

[0071] 2. Optimization of detection conditions;

[0072] (1) Determination of optimal pH: The pH of the colloidal gold solution was adjusted by adding 1, 2, 3, 4, 5, and 6 μL of 0.2 M K₂CO₃ solution, respectively, and 30 μg of excess SPA protein was added to each tube. After mixing, the solution was allowed to stand at room temperature for 30 min, and then 100 μL of 10% NaCl solution was added to each tube and incubated at room temperature for 2 h. The color change of the solution was observed. The optimal pH value was the one that maintained the colloidal state of the colloidal gold and remained bright red.

[0073] (2) Determination of the optimal labeling amount of SPA protein: After adjusting the solution to the optimal pH, 0, 5, 10, 15, 20, and 25 μg of SPA protein were added sequentially. After thorough mixing, the mixture was allowed to stand at room temperature for 30 min. Then, 100 μL of 10% NaCl solution was added to each tube, and the tubes were incubated at room temperature for 2 h. The optimal labeling amount of SPA in the colloidal gold solution was determined based on the color change. Typically, an amount 10% higher than this is selected.

[0074] 3. Preparation and identification of gold-labeled antibodies;

[0075] (1) Preparation of gold-labeled antibody: Adjust the colloidal gold solution to the optimal pH value by adding 0.2M K2CO3 under optimal conditions. Add the optimal amount of SPA protein for colloidal gold labeling. Add 10% BSA for blocking. After thorough mixing, centrifuge at 12000g, 4℃ for 30min. Discard the supernatant, resuspend the precipitate with 10% reconstitution solution, add it to a gold-labeled pad, and dry at 37℃ for later use.

[0076] (2) Identification of gold-labeled antibodies: The size, uniformity and aggregation of gold-labeled antibody particles are observed by transmission electron microscopy, and whether a halo appears around the colloidal gold particles.

[0077] 4. Determining the optimal conditions for the test line (T) and the quality control line (C);

[0078] The NC membrane was cut into strips of 300×25mm, and SPA and FHH proteins were added to the NC membrane as control line (C) and detection line (T), respectively.

[0079] SPA secondary antibody was diluted with PBS solution to concentrations of 1, 0.5, 0.25, and 0.125 mg / mL and added to an NC membrane as the T line. Test strips were assembled to detect positive serum from sheep infected with Fasciola hepatica. The concentration of SPA secondary antibody that produced the best colorimetric effect and required the least amount was selected.

[0080] The purified protein FHH was diluted with PBS solution to concentrations of 2, 1, 0.5, and 0.25 mg / mL, maintaining a certain distance from the T line, and the C line was added. Test strips were assembled to detect positive and negative sera from sheep infected with Fasciola hepatica. The concentration of purified protein added was determined when the C line showed the same colorimetric effect as the T line.

[0081] 6. Assembly of the test strips;

[0082] Assemble the sample pad, gold label pad, nitrocellulose membrane, and absorbent paper onto the PVC support base, overlapping them by 1–2 mm to allow for liquid flow. Use a paper cutter to cut the paper into individual 4.0 mm wide strips, pack them into plastic shells, and then individually package them into sealed bags for dry, light-protected storage.

[0083] 7. Criteria for determining the suitability of colloidal gold test strips;

[0084] The sample is first captured by colloidal gold-labeled SPA protein, forming an antigen-antibody immune complex, which then migrates chromatographically on the test strip. When it migrates to line C, it is captured by the SPA secondary antibody, displaying a visible red band on line C, indicating the test strip is effective; if line C does not show color, the test strip is invalid. When liver fluke-specific antibodies are present in the serum, this complex migrates chromatographically to the FHH protein-coated line and is captured, displaying a visible red band on line T; if liver fluke-specific antibodies are not present, no color is displayed. Therefore, the judgment criterion is as follows: if... Figure 5 As shown:

[0085] If both the C and T lines show color, it indicates that the sample is positive.

[0086] If the C line shows color but the T line does not, it indicates that the sample test is negative.

[0087] If line C does not show color, regardless of whether line T shows color, the test strip is invalid and needs to be tested again.

[0088] result:

[0089] 1. Firing of colloidal gold solutions;

[0090] The results showed that the successfully prepared colloidal gold solution was a bright and clear wine-red color, with no particulate sediment at the bottom of the bottle and no floating impurities on the surface.

[0091] 2. Optimization of detection conditions;

[0092] By adjusting the amount of K2CO3 solution added, the colloidal gold solution showed stable color and required the least amount when 2 μL of 0.2 mol / L K2CO3 was added, proving that it had the best effect in adjusting the pH value.

[0093] Furthermore, when the amount of SPA added was 5 μg, the color was stable without significant change, and the color remained unchanged as the amount of SPA added increased. Based on this, increasing the amount of SPA added by 20% to 6 μg was the optimal amount of SPA labeling in this experiment.

[0094] 3. Observation using transmission electron microscopy (TEM);

[0095] Transmission electron microscopy revealed that the colloidal gold particles in the prepared solution were uniform in size, moderately dense, dispersed without aggregation, and shaped like round or elliptical particles. Figure 6 ). Microscopic observation of the colloidal gold particles labeled with the gold antibody revealed a distinct halo around each particle, indicating that the SPA protein successfully labeled the colloidal gold particles. Figure 7 ).

[0096] 4. Determination of the optimal coating concentration for the test line (T) and control line (C);

[0097] Even after diluting FHH protein to 0.5 mg / mL, the detection line (T) remained clear. Figure 8 This method uses the least amount of protein and therefore the optimal coating concentration for the detection line (T) is 0.5 mg / mL.

[0098] The test line (T) was coated with 0.5 mg / mL FHH protein, and rabbit anti-SPA secondary antibody was serially diluted with PBS. When the coating concentration was 0.125 mg / mL, the control line (C) remained clearly visible. Figure 9 Therefore, the optimal coating concentration of the rabbit anti-SPA secondary antibody for the quality control line (C) is 0.125 mg / mL.

[0099] Example 4: Performance testing of test strips and detection of clinical samples;

[0100] 1. Performance testing of the test strips;

[0101] (1) Sensitivity and specificity tests;

[0102] The lower limit of detection of the colloidal gold test strip was evaluated using standard positive serum for detecting Fasciola hepatica infection in sheep under the above conditions. Positive serum was serially diluted from 1:10 to 1:160, and the sensitivity of the method was determined by whether there was a color change in the test line (T).

[0103] Using optimized test strips, positive and negative serum samples of Fasciola hepatica, positive serum samples of Diclofenac medullaris, positive serum samples of Neospora spp., and positive serum samples of Haemaphysema contortus were tested to determine the test strip results and whether there was any cross-reaction.

[0104] (2) Repeatability tests and stability tests;

[0105] Test strips prepared in three different batches were used to test standard positive and standard negative sera of sheep liver fluke infection. The repeatability of the test strips was evaluated based on the color change of the test line (T).

[0106] Place the assembled test strips into a sealed bag containing desiccant, and store them in environments of 4°C, room temperature, and 37°C. Test them after 7, 30, 60, and 90 days. Determine the maximum shelf life of the test strips based on the color change of the test line (T).

[0107] 2. Detection of clinical samples using colloidal gold chromatography test strips;

[0108] To further evaluate the colloidal gold test strip, it was used in conjunction with a commercially available ELISA kit to test 24 sheep serum samples from a region in Inner Mongolia.

[0109] result;

[0110] 1. Performance testing of the test strips;

[0111] (1) Sensitivity tests and specificity tests;

[0112] Serum samples positive for Fasciola hepatica infection in sheep were serially diluted at ratios of 1:10, 1:20, 1:40, 1:80, and 1:160. The results showed that the test line (T) still showed color at a 1:80 dilution, therefore the sensitivity of this test strip is 1:80. Figure 10 ).

[0113] Using optimized test strips, positive and negative sera from sheep infected with Fasciolopsis buski, Diclofenac parasite, Neospora glomerata, and Haemophilus contortus were tested. The color change of the test line (T) was observed. The results showed that only the test strip with positive sera from sheep infected with Fasciolopsis buski developed a colored test line (T). The test strips with negative sera from sheep infected with Fasciolopsis buski, positive sera from Diclofenac parasite, Neospora glomerata, and Haemophilus contortus did not develop a colored test line (T). There was no cross-reaction with other specific sheep sera, indicating that the test strip has good specificity. Figure 11 ).

[0114] (2) Repeatability test and shelf life test;

[0115] Three different batches of test strips were used, and positive and negative serum from sheep liver fluke infection were added respectively for repeatability testing. The results showed that the test strip had good repeatability. Figure 12 ).

[0116] The prepared test strips were placed in sealed bags containing desiccant and stored at 4°C, room temperature, and 37°C, respectively. Tests were conducted after 7, 30, 60, and 90 days of storage. The shelf life was determined by the color change of the test line (T) on the test strip. The test strips stored at 4°C had a longer shelf life, still capable of detecting positive samples after 90 days. The test strips could only be stored for 60 days at room temperature and 37°C.

[0117] 2. Detection of clinical samples using colloidal gold chromatography test strips;

[0118] The established colloidal gold chromatography test strip method was used to detect the serum of 24 sheep serum samples from a region in Inner Mongolia. Figure 13Four samples were found to be positive, with a positive rate of 16.7% (4 / 24). This is consistent with the results of commercial kits for these 24 sheep serum samples, indicating that the colloidal gold chromatography strip can be used for clinical sample testing.

[0119] Sequence 1: Liver fluke-specific antigen gene FHH

[0120] GenBank: JXXN02005516.1

[0121] >JXXN02005516.1:c51472-51366,c51152-51029 Fasciola hepatica F_hepatica-1.0_Cont5516,whole genome shotgun sequence

[0122] ATGAATTTCCTTGGGATTATTTTAACTTTTCGACCAACTAGATATTCT

[0123] TATCTGCCCTCTTTTCTACTTT

[0124] CTTTCACCTGTTTGATCTGCAGAAAGCAATACTACAGCTTCTTCAAAT

[0125] GGCACATCGAGGCCCCCCAGTC

[0126] ACATGGCTTTCCTCACATTCCCGCTAAAGTGTCTTGGATTGATCCAGT

[0127] AGTGGATACGTTTAGTTGCCGC

[0128] GGATATATTGCTCAGCTTTAA

[0129] Sequence 2: Primers for amplifying the liver fluke-specific antigen gene FHH

[0130] Upstream primer:

[0131] 5'-GCCATGGCTGATATCGGATCCATGAATTTCCTTGGGATTATTTTAACT-3';

[0132] Downstream primer:

[0133] 5'-GTGGTGGTGGTGGTGCTCGAGAAGCTGAGCAATATATCCGCG-3'.

[0134] The above embodiments merely illustrate several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A colloidal gold detection method for Fasciola hepatica based on the specific antigen gene FHH, characterized in that: This detection method utilizes the Fasciola hepatica-specific antigen gene FHH, FHH protein, colloidal gold particles, Staphylococcus aureus protein A-labeled colloidal gold particles, and test strips. The Fasciola hepatica-specific antigen gene FHH was screened using a Fasciola hepatica cDNA expression library, establishing an indirect colloidal gold test strip detection method. During the detection process, the FHH protein binds to specific antibodies in Fasciola hepatica-infected positive serum from sheep. The liver fluke-specific antigen gene FHH has the gene sequence shown in Sequence 1. Primers for amplifying the FHH antigen gene were designed using CE designV1 software and employed restriction enzyme sites. BamH I and Xho I, whose nucleotide sequence is shown in Sequence 2; The FHH protein is a purified pET-32a-FHH recombinant protein; The test strip consists of a PVC base plate, a sample pad, a gold label pad, a glass fiber membrane, a nitrocellulose membrane, and an absorbent plate. The gold label pad contains colloidal gold particles labeled with Staphylococcus aureus protein A, the NC membrane detection line contains purified liver fluke-specific antigen FHH protein, and the NC membrane control line contains rabbit anti-SPA secondary antibody. Finally, the sample pad, gold label pad, NC membrane, and absorbent plate are overlapped by 2 mm to assemble the test strip.

2. The method for detecting colloidal gold in liver fluke based on the specific antigen gene FHH according to claim 1, characterized in that: The colloidal gold particles were prepared by calcination using the trisodium citrate reduction method to prepare 40 nm colloidal gold particles.

3. The method for detecting colloidal gold in liver fluke based on the specific antigen gene FHH according to claim 1, characterized in that: The colloidal gold particles labeled with Staphylococcus aureus protein A are prepared as follows: 1 mL of colloidal gold solution is added to 2 μL of 0.2 mol / L K2CO3 to adjust the pH, 5 μg of SPA protein is added for labeling, and then blocked with 10% BSA. After centrifugation, the supernatant is discarded, dissolved in 10% reconstitution solution, and dropped onto the gold labeling pad.

Images