High-iron feed for preventing and treating Clostridium difficile infection in mice and application thereof

The colonization and germination of C. difficile spores were inhibited by high-speed iron feed, and the intestinal inflammation and diarrhea caused by C. difficile infection was solved, providing a safe and effective non-antibiotic therapy, which significantly improved the clinical symptoms and intestinal health of mice.

CN116491603BActive Publication Date: 2025-08-12XUZHOU MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310564654.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-19
Publication Date
2025-08-12
Estimated Expiration
2043-05-19

AI Technical Summary

Technical Problem

In the prior art, intestinal inflammation and diarrhea problems caused by C. difficile infection lack effective non-antibiotic therapy. Long-term use of antibiotics will weaken the diversity of the intestinal microbiota, and it is urgent to find safe and effective alternatives.

Method used

It is provided with a high-iron feed, which consists of casein, L-cystine, corn starch, maltodextrin, sucrose, cellulose, soybean oil, mixed vitamins and ferrous sulfate. Through animal experiments, this feed can inhibit the colonization and germination of C. difficile spores, relieve the symptoms of weight loss, diarrhea and hunchback caused by infection, and increase the secretion of beneficial compounds.

Benefits of technology

High-speed rail feed significantly reduces in vivo colonization and toxin secretion of C. difficile spores, reduces the production of inflammatory factors, improves intestinal inflammation, provides green and safe non-antibiotic therapy, and provides important data for the development of alternative treatment options for C. difficile infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116491603B_ABST
    Figure CN116491603B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of feed technology, and discloses a high-iron feed for preventing and treating Clostridium difficile infection in mice and its application. The raw material composition of the high-iron feed is as follows in g / kg: casein 200, L-cystine 3, corn starch 397.5, maltodextrin 132, sucrose 100, cellulose 50, soybean oil 70, mixed vitamins 10, mixed minerals 35, and ferrous sulfate 0.4. The high-iron feed can be used as a dietary intervention for intestinal inflammation caused by Clostridium difficile infection in mice. Through animal experiments, it was found that the high-iron feed can effectively inhibit the colonization and germination of Clostridium difficile spores in mice, alleviate clinical symptoms such as weight loss, diarrhea, and hunchback caused by Clostridium difficile infection, increase the secretion of beneficial compounds such as tauroursodeoxycholic acid and trillium glycosides, reduce the production of inflammatory cells and inflammatory factors, and thus alleviate Clostridium difficile infectious enteritis. It provides important experimental data for the development of non-antibiotic therapy for Clostridium difficile, and has good application prospects and huge potential value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of feed, and in particular relates to a high-iron feed for preventing and treating Clostridium difficile infection in mice and an application thereof. Background Art

[0002] Clostridium difficile, an anaerobic bacillus, is a common cause of antibiotic-associated diarrhea and colitis in humans and animals. C. difficile infection is the most common cause of infectious diarrhea and colitis in hospitalized patients, placing a significant economic burden on families and society. In recent years, the incidence and severity of C. difficile infection have increased dramatically not only in Europe and North America, but also in China.

[0003] Toxigenic strains of C. difficile primarily release two large protein exotoxins, toxin A and toxin B. Both toxins possess cytotoxic activity. Furthermore, toxin A induces mucus secretion and an inflammatory response in the intestinal loops of experimental animals, hence its designation as enterotoxin. C. difficile toxins are the primary cause of C. difficile pathogenicity, resulting in a range of clinical conditions, including diarrhea, pseudomembranous colitis, and toxic megacolon.

[0004] Currently, antibiotic therapy remains the mainstay of treatment for Clostridium difficile infection, with first-line antibiotics such as metronidazole, vancomycin, and fidaxomicin widely used in clinical treatment of C. difficile. However, long-term antibiotic use can weaken the diversity of the intestinal microbiota, creating opportunities for the invasion of other pathogens. Therefore, the search for a safe and effective non-antibiotic therapy is urgent.

[0005] Probiotics, fecal microbiota transplantation, diet, nanoparticles, and compounds are all emerging non-antibiotic therapies that have attracted widespread attention. Studies on the relationship between dietary components and infection are common. Iron plays an important role in the growth of both eukaryotic and prokaryotic cells, and excessive dietary iron also has a certain impact on the intestinal microbiota. Clostridium difficile infection is closely related to the intestinal microbiota, so studying the impact of a high-concentration iron diet on C. difficile infection is of certain significance. Summary of the Invention

[0006] In view of the deficiencies in the prior art, the present invention provides a high-iron feed for preventing and treating Clostridium difficile infection in mice and its application.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A high-iron feed for preventing and treating Clostridium difficile infection in mice, wherein the raw material composition is as follows in g / kg: 200g of casein, 3g of L-cystine, 397.5g of corn starch, 132g of maltodextrin, 100g of sucrose, 50g of cellulose, 70g of soybean oil, 10g of mixed vitamins, 35g of mixed minerals, and 0.4g of ferrous sulfate.

[0009] Preferably, the mixed minerals are iron-free S10022G type mixed minerals, that is, the iron element of the mixed minerals in the AIN93G standard sterilized feed is removed and the iron element is supplemented with ferrous sulfate.

[0010] The present invention also provides use of the high-iron feed for preventing and treating Clostridium difficile infection as a dietary intervention for intestinal inflammation caused by Clostridium difficile infection in mice.

[0011] Beneficial effects: Animal experiments have shown that high-iron feed can effectively inhibit the colonization and germination of Clostridium difficile spores in mice, alleviate clinical symptoms such as weight loss, diarrhea and hunchback caused by Clostridium difficile infection, and increase the secretion of beneficial compounds such as tauroursodeoxycholic acid and trillium glycosides, reduce the production of inflammatory cells and inflammatory factors, and thus alleviate Clostridium difficile infectious enteritis; the present invention provides a green, safe and effective treatment for Clostridium difficile infection, provides important experimental data for the development of non-antibiotic treatments for Clostridium difficile, and has good application prospects and huge potential value. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the effect of high-iron feed on the clinical symptoms of Clostridium difficile infection (A. Clostridium difficile infection model; B. Changes in body weight of mice in each group within 48 hours of infection; C. Changes in disease activity index of mice within 48 hours of infection).

[0013] Figure 2 Schematic diagram of the effect of high-iron diet on intestinal damage in mice infected with Clostridium difficile (A. Colon length of mice in each group; B. Representative macroscopic images of cecum and colon and HE staining of cecum of mice in each group; 200×; C. Cecal histopathological scores of mice in each group; D. LCN2 content in cecal contents of mice in each group).

[0014] Figure 3 Schematic diagram of the effect of high-iron feed on the colonization and toxin secretion of Clostridium difficile in the body (A. Toxin content in the cecal contents and fecal toxin content of mice in each group; B. Comparison of cecal bacterial count, cecal content bacterial count, mesenteric lymph node bacterial count, and spleen bacterial count of mice in each group).

[0015] Figure 4 Schematic diagram of the effect of high-iron feed on intestinal immunity infected with Clostridium difficile (A. The proportion of neutrophils in the colon of mice in each group; B. The proportion of macrophages in the colon of mice in each group; C. The expression of CXCL1 protein in the cecum of mice in each group; D. The expression of IL-33 protein in the cecum of mice in each group; E. The expression of TNF-α protein in the cecum of mice in each group; F. The expression of IL-6 protein in the cecum of mice in each group; G. The expression of IL-1β protein in the cecum of mice in each group; H. The expression of genes of colonic inflammatory factors IL-6, TNF-α, IL-33 and CXCL1 in mice in each group).

[0016] Figure 5 Schematic diagram of the effect of high-iron feed on intestinal metabolism of mice infected with Clostridium difficile (A. KEGG metabolic pathway of the infection group and the high-iron feed intervention group; B. KEGG topological analysis bubble diagram of the infection group and the high-iron feed intervention group; C. Volcano diagram of differential metabolism between the infection group and the high-iron feed intervention group; D. Relative abundance of trillium glycosides in the intestines of mice in each group; E. Relative abundance of tauroursodeoxycholic acid in the intestines of mice in each group).

[0017] Figure 6 Schematic diagram of the alleviating effects of the compounds tauroursodeoxycholic acid and trillium glycoside on Clostridium difficile infection (A. Changes in body weight of mice in each group within 48 hours after Clostridium difficile infection; B. Changes in disease activity index of mice in each group within 48 hours after Clostridium difficile infection; C. Cecal contents, cecal and colonic bacterial counts of mice in each group; D. Representative cecal and colon images and cecal HE staining of mice in each group, 200×; E. Colon length of mice in each group; F. Cecal histopathological score of mice in each group; G. Proportion of neutrophils in mice in each group 48 hours after infection; H. CXCL1 protein content in the cecum of mice in each group; I. IL-1β protein expression in the cecum of mice in each group). Implementation Method

[0018] The present invention is described below with reference to specific examples. Those skilled in the art will appreciate that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0019] Example 1 Application of high iron feed in treating Clostridium difficile infection in mice

[0020] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field, and the feeds and reagents used in the following examples are commercially available.

[0021] 1. Experimental steps

[0022] 1. Experimental feed

[0023] The AIN93G standard sterilized feed used in this example was purchased from Jiangsu Collaborative Biological Co., Ltd. The high iron feed raw material composition g / kg is:

[0024] Casein 200g, L-cystine 3g, corn starch 397.5g, maltodextrin 132g, sucrose 100g, cellulose 50g, soybean oil 70g, mixed vitamins 10g, mixed minerals (S10022G-iron deficiency) 35g and ferrous sulfate 0.4g.

[0025] The g / kg composition of AIN93G standard sterilized feed raw materials is:

[0026] Casein 200g, L-cystine 3g, corn starch 397.5g, maltodextrin 132g, sucrose 100g, cellulose 50g, soybean oil 70g, mixed vitamins 10g, mixed minerals 35g.

[0027] 2. Clostridium difficile spores

[0028] In this study, Clostridium difficile strain ATCC43255 was stored at -80°C and revived before use. The strain was inoculated onto brain heart infusion (BHI) broth plates and incubated anaerobically at 37°C for 48 hours. A single colony was picked and inoculated into 5 ml of fresh BHI broth and incubated anaerobically at 37°C for 48 hours. The bacterial strain was then inoculated into fresh BHI broth at a ratio of 1:25. After anaerobically incubating at 37°C for 5 days, the cells were washed and centrifuged three times with PBS and inactivated at 70°C for 10 minutes. Spores were diluted, counted, and frozen at -20°C until use.

[0029] 3. Experimental Animals

[0030] Twenty-four male C57BL / 6 mice, 6 weeks old and specific pathogen-free (SPF), were provided by the Experimental Animal Center of Xuzhou Medical University, license number SCXK (Su) 2020-0011. Mice were housed in the Experimental Animal Center of Xuzhou Medical University at a room temperature of 25°C and a humidity of 40–70%. They were provided with a 12-h day / night cycle, standard laboratory sterilized chow, and free access to food and water. They were acclimated to the environment for 3 days before the experiment.

[0031] 4. High iron feed intervention process for Clostridium difficile infection

[0032] like Figure 1As shown, mice were divided into a randomized control group (NC), a high-iron diet control group (NC+Iron diet), a Clostridium difficile infection (CDI) group, and a high-iron diet intervention group (CDI+Iron diet), with six mice in each group. The NC and CDI groups maintained a standard sterilized AIN93G diet, while the NC+Iron diet and CDI+Iron diet mice were fed a high-iron diet until sample collection. Starting on day 16 of the diet change, the drinking water of the four groups was switched to a cocktail of antibiotics, which was then returned to sterile drinking water after five days. The cocktail of antibiotics consisted of 0.4 mg / mL kanamycin, 0.035 mg / mL gentamicin, 0.045 mg / mL colistin, 0.215 mg / mL metronidazole, and 0.045 mg / mL vancomycin. On day 21, the cocktail of antibiotics was withdrawn and mice were given an intraperitoneal injection of 10 mg / kg clindamycin. One day later, each mouse in the CDI and CDI+ Iron diet groups was gavaged with 5×10 6 The mice in the other two groups were gavage-treated with 200 μL of PBS for 48 hours. Body weight, feces, and mental status of the mice were recorded every 12 hours for 48 hours after infection. Mice were sacrificed 48 hours later, and colon length was measured. Cecal tissue was fixed with 4% formaldehyde for histological examination. Spleen, mesenteric lymph nodes, feces, cecum, cecal contents, and colon were collected and frozen at -80°C for subsequent analysis.

[0033] 5. The data processing involved in the following examples are all statistically analyzed using the following method:

[0034] Statistical analysis was performed using GraphPad Prism 8.0 software. Measurement data were expressed as χ(——)±SEM, and independent t-test was used to compare measurement data between two groups; one-way analysis of variance (ANOVA) was used to compare measurement data between multiple groups. p< 0.05(** p< 0.01,* p< 0.05) was considered statistically significant.

[0035] 2. Experimental results:

[0036] 1. Effect of high-iron feed on clinical symptoms of Clostridium difficile infection

[0037] The clinical disease activity index (DAI) score, used to assess the severity of enteritis, is a composite score based on percentage weight loss (0: no weight loss, 1: 1-5%, 2: 5-10%, 3: 10-15%, 4: >15%), stool consistency (0: normal, 1: loose stools, 2: loose stools, 3: loose watery stools, 4: mucous stools), and mental status (0: normal, 1: slow movement, 2: limited movement, 3: hunched back, limited movement, 4: hunched back, slow movement, or even death). The final DAI score is calculated by adding the scores of these three outcomes.

[0038] from Figure 1 BC shows that within 48 hours of C. difficile infection, the infected group experienced increased DAI due to weight loss, hunchback, and diarrhea. However, the high-iron diet intervention group showed no symptoms of C. difficile infection within 48 hours of infection, indicating that high-iron diet can significantly improve C. difficile enteritis.

[0039] 2. Effects of high-iron diet on intestinal damage in mice infected with Clostridium difficile

[0040] (1) Influence of colon length

[0041] like Figure 2 As shown in Figures A and 2B, the cecum and colon of the standard diet-infected group were significantly atrophied, with less intestinal content and a significantly shorter colon length compared to mice fed a high-iron diet. In contrast, the cecum and colon of mice fed a high-iron diet showed no significant changes, whether infected or not with Clostridium difficile.

[0042] (2) Cecal histopathological scoring

[0043] The colon tissue was removed and fixed in paraformaldehyde fixative, routinely dehydrated, transparent, wax-impregnated, and paraffin-embedded for sectioning. Hematoxylin-eosin (HE) staining was used for pathological observation, and these stained sections were scored according to the degree of inflammatory infiltration (0-3), the degree of intestinal epithelial damage (0-3), and the degree of edema (0-3).

[0044] The HE staining results of cecal tissue sections under light microscope are as follows: Figure 2 As shown in B, the colon tissues of the uninfected NC group and the NC+Iron diet group showed no signs of damage or inflammation; the CDI group mice showed symptoms of colitis such as intestinal epithelial loss, crypt structure destruction, and edema; while the CDI+Iron diet group mice had less intestinal epithelial damage, more intact crypt structure, less inflammatory cell infiltration, and less edema. Figure 2 In C, the histological score of the CDI+Iron diet group was closer to that of the NC+Iron diet and NC groups. This result indicated that high-iron diet improved the cecal mucosal barrier damage.

[0045] (3) LCN2 determination

[0046] Since LCN2 reflects intestinal damage to a certain extent, we collected the cecal contents of mice and detected the expression of LCN2 protein in mice using an ELISA kit.

[0047] like Figure 2 Results showed that LCN2 levels in mice in the NC+ Iron diet and CDI+ Iron diet groups were similar to those in the NC group, while LCN2 levels in the CDI group increased dramatically, consistent with intestinal damage. This result suggests that a high-iron diet significantly reduced intestinal inflammation.

[0048] 3. Effects of high-iron feed on colonization and toxin secretion of Clostridium difficile

[0049] In terms of bacterial count determination, the cecum, spleen, and mesenteric lymph nodes of mice were weighed and homogenized with sterile PBS, and then diluted in multiples and counted using BHI plates. For the feces and cecal contents of mice, bacterial DNA was extracted from the specimens after weighing, and the Cq value of Clostridium difficile toxin TcdB was determined using qPCR technology. The Cq value of Clostridium difficile toxin TcdB was determined based on the standard curve of the amount of Clostridium difficile bacteria and the Cq value of toxin TcdB. In terms of toxin detection, the cecal contents and feces were weighed and homogenized with sterile PBS. After centrifugation, the supernatant was taken and its content was determined using an ELISA detection kit.

[0050] Figure 3 A results showed that the toxin content in the CDI group was significantly higher than that in the NC group, which means that the bacterial load in the mice was higher. Figure 3 Results from B demonstrated that the CDI group had a higher intestinal and extraintestinal burden of C. difficile than the CDI + Iron diet group. Therefore, a high-iron diet significantly reduced the colonization, growth, toxin secretion, and extraintestinal dissemination of C. difficile spores.

[0051] 4. Effect of high iron diet on the recruitment of colitis cells in mice infected with Clostridium difficile

[0052] Fresh mouse colon tissue was collected, and mononuclear cells from the mouse colon lamina propria were extracted and stained with surface antibodies. The ratio of neutrophils and macrophages in the colon was obtained by flow cytometry analysis.

[0053] like Figure 4 As shown in Figures AB, after C. difficile infection, a large number of neutrophils were recruited to the colon of mice in the CDI group, while the increase in macrophages was not significant. In the CDI + Iron diet group, the recruitment of both macrophages and neutrophils was not significant. This suggests that a high-iron diet reduces neutrophil recruitment to the intestinal inflammatory sites of mice infected with C. difficile.

[0054] 5. Effect of high-iron diet on the secretion of inflammatory factors in the intestinal tissue of mice infected with Clostridium difficile

[0055] The mouse cecum was weighed and homogenized with lysis buffer. The supernatant was collected by ultrasonic centrifugation and the protein expression of inflammatory factors tumor necrosis factor-α (TNF-α), interleukin-33 (IL-33), chemokine (CXC motif) ligand 1 (CXCL1), interleukin-6 (IL-6), and interleukin-1β (IL-1β) was detected using cytokine ELISA kits.

[0056] mRNA was extracted from mouse colon using a total RNA extraction kit (Solarbio, China). TNF-α, IL-6, CXCL1, and IL-33 mRNA expression levels were quantified by qPCR (Roche Light Cycler 96, USA) using UltraSYBR mix (Bimake, USA) and specific primers according to the manufacturer's instructions. Gene expression was normalized to β-actin and analyzed by 2 -△△Ct Calculation. Primers were as follows: β-actin: 5'GGCTGTATTCCCCTCCATCG 3' and 5'CCAGTTGGTAACAATGCCATGT 3'; TNF-α: 5'GATCGGTCCCCAAAGGGATG 3' and 5'TTTGCTACGACGTGGGCTAC 3'; IL-6: 5'AGACAAAGCCAGAGTCCTTCAG 3' and 5'GAGCATTGGAAATTGGGGTAGG 3'; CXCL1: 5'CACCCAAACCGAAGTCATAGC 3' and 5'GAAGCCAGCGTTCACCAGA 3'; IL-33: 5'TCCAACTCCAAGATTTCCCCG 3' and 5'CATGCAGTAGACATGGCAGAA 3'.

[0057] like Figure 4 The CH and CDI groups showed significantly increased expression of the neutrophil chemoattractant CXCL1 and proinflammatory factors IL-33, TNF-α, IL-6, and IL-1β at both the protein and gene levels compared to the NC group. However, the CDI + Iron diet group showed no significant increase in inflammatory factors. This suggests that a high-iron diet significantly reduces the intestinal immune response induced by Clostridium difficile infection, thereby alleviating intestinal damage.

[0058] 6. Effects of high-iron diet on intestinal metabolism in mice infected with Clostridium difficile

[0059] The cecal contents of mice were collected, quickly frozen in liquid nitrogen, and sent to Shanghai Meiji Biotechnology Co., Ltd. for non-targeted metabolomics testing. After the test was completed, the data was analyzed through the cloud platform.

[0060] Data analysis results Figure 5 Figure A shows that there are significant differences in amino acid metabolism and lipid metabolism between CDI mice and CDI+Iron diet groups, and the KEGG topology analysis in Figure B shows that the differences in amino acid metabolism such as arginine synthesis are even more obvious. By analyzing the differential metabolites between CDI mice and CDI+Iron diet, we found that the expression of trillium glycosides and tauroursodeoxycholic acid was significantly upregulated in the CDI+Iron diet group ( Figure 5 CE), which may be related to the alleviation of Clostridium difficile infection by high-iron feed.

[0061] Example 2: Application of Tauroursodeoxycholic Acid and Trillium in Clostridium difficile Infectious Enteritis

[0062] 1. Experimental steps

[0063] 1. Medication

[0064] The drugs used in this experiment were purchased from Beijing Solebow Technology Co., Ltd. (SD8370, purity ≥98%), and tauroursodeoxycholic acid was purchased from Beijing Solebow Technology Co., Ltd. (IT0790, purity ≥98%).

[0065] 2. Experimental Animals

[0066] Twenty male C57BL / 6 mice, 4 weeks old, specific pathogen-free (SPF) were provided by the Experimental Animal Center of Xuzhou Medical University, license number SCXK (Su) 2020-0011. Mice were housed in the Experimental Animal Center of Xuzhou Medical University at a room temperature of 25°C and a humidity of 40–70%. They were provided with a 12-h day / night cycle, standard laboratory sterilized chow, and free access to food and water. They were acclimated for 3 days before the experiment.

[0067] 3. Tauroursodeoxycholic acid and trillium glycosides interfere with the process of Clostridium difficile infection

[0068] Mice were randomly divided into a control group (NC), a Clostridium difficile infection (CDI) group, a tauroursodeoxycholic acid (TUDCA)-treated group, and a trillium glycoside (CDI)-treated group (Collettiside I) group, with five mice in each group. Mice in the CDI+TUDCA group were gavaged with 100 mg / kg tauroursodeoxycholic acid from one week before infection until the day before sampling. Six days before infection, the drinking water of all three groups was replaced with a cocktail of antibiotics. Five days later, the drinking water was switched back to sterile drinking water, and mice were intraperitoneally injected with 10 mg / kg clindamycin. The cocktail of antibiotics consisted of 0.4 mg / mL kanamycin, 0.035 mg / mL gentamicin, 0.045 mg / mL colistin, 0.215 mg / mL metronidazole, and 0.045 mg / mL vancomycin. One day later, each mouse in the CDI, CDI+TUDCA, and CDI+Collettiside I groups was orally administered with 5×10 6 CFU of Clostridium difficile spores were inoculated, and mice in the NC group were gavaged with 200 μL of sterile water as a control. Two hours after infection, mice in the CDI + Collettiside I group were gavaged with 100 mg / kg of trillium glycosides for two consecutive days. Body weight, feces, and mental status of the mice were recorded every 12 hours for 48 hours after infection. Mice were sacrificed 48 hours later, and colon length was measured. Colon tissue was fixed with 4% formaldehyde for histological observation. Cecum and colon were also collected and frozen at -80°C for subsequent experimental analysis.

[0069] 2. Experimental Results

[0070] According to the method described in Example 1, the weight, feces and mental state of the mice were monitored, the cecum and colon were observed and histologically scored, and ELISA and flow cytometry were used to detect changes in inflammatory factors and inflammatory cells.

[0071] The results are as follows Figure 6 As shown, compared with the CDI group, the compound intervention groups CDI+ TUDCA and CDI+ Collettiside I groups showed significantly reduced symptoms such as weight loss, hunchback and diarrhea within 48 hours of Clostridium difficile infection ( Figure 6 AB), which may be related to the fact that the compound reduces the amount of intestinal bacteria in infected mice ( Figure 6 C). Accordingly, the compound also alleviated the damage and atrophy of the cecum and colon in mice, and the histopathological scores were significantly reduced ( Figure 6 DF). In addition, compared with the CDI group, the compound intervention group showed reduced neutrophil recruitment in the colon, and significantly decreased secretion of chemokine CXCL1 and pro-inflammatory factor IL-1β ( Figure 6 These data suggest that tauroursodeoxycholic acid (TUDCA) and trillium glycosides alleviate intestinal epithelial damage by reducing C. difficile toxin secretion, thereby reducing neutrophil recruitment and secretion of inflammatory cytokines and ameliorating C. difficile infection.

[0072] Animal experiments have shown that high-iron diets can inhibit the colonization and growth of C. difficile spores in vivo, reduce the production of C. difficile toxins, and thus reduce toxin-induced neutrophil recruitment and the production of pro-inflammatory factors, alleviating C. difficile enteritis. Furthermore, high-iron diets alter the metabolism of the mouse intestinal flora, upregulating the production of metabolites such as tauroursodeoxycholic acid and trillium glycosides, inhibiting the intestinal growth of C. difficile, reducing intestinal damage and neutrophil chemotaxis at the site of injury, thereby alleviating symptoms such as weight loss and diarrhea caused by C. difficile infection. In summary, high-iron diets can be used as an effective mouse diet for the prevention and treatment of C. difficile infection.

Claims

1. A use of a high-iron feed for preventing and treating Clostridium difficile infection in mice in preparing a feed as a dietary intervention for intestinal inflammation caused by Clostridium difficile infection in mice, characterized in that: The raw material composition of high iron feed g / kg is as follows: casein 200, L-cystine 3, corn starch 397.5, maltodextrin 132, sucrose 100, cellulose 50, soybean oil 70, mixed vitamins 10, mixed minerals 35, ferrous sulfate 0.

4.

2. Use of the high-iron feed for preventing and treating Clostridium difficile infection in mice according to claim 1 in preparing a feed for dietary intervention of intestinal inflammation caused by Clostridium difficile infection in mice, characterized in that: The mixed mineral is an iron-free S10022G type mixed mineral.