Yellow water active extract and uses thereof

Abstract

The application discloses a kind of yellow water active extract and purposes, belong to liquor by-product recycling technical field.The application is to realize the recycling utilization value of brewing by-product yellow water, extracts an active extract from yellow water, and the extraction steps are as follows: take yellow water, organic solvent precipitates, centrifugal, supernatant is sequentially filtered by ultrafiltration membrane and nanofiltration membrane, and finally concentrated, to obtain yellow water active extract.The application removes macromolecular polysaccharide and protein by organic solvent precipitation, and then obtains active ingredients in yellow water by ultrafiltration membrane and nanofiltration membrane molecular interception;By ultra-high performance liquid chromatography-mass spectrometry detection, yellow water active extract contains a large amount of amino acids and small molecule peptides and other amino acid derivatives, and through cell experiment, it is verified that yellow water active extract has certain protective effect on BV2 nerve cells, provides data basis for the value of yellow water in medicinal aspect, improves the application value of yellow water, and expands the use of yellow water.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of recycling of liquor by-products, and particularly relates to a yellow water active extract and uses thereof. BACKGROUND

[0002] Yellow water is a yellow or brownish yellow liquid produced in the process of starter dripping in solid-state liquor brewing, and is a fermentation product of microorganisms using grains as raw materials. Yellow water is rich in sugars, proteins and liquor flavor components. The flavor components in yellow water are recovered by distillation, while the remaining bottom pot yellow water is discharged as waste liquid. The active compounds such as polysaccharides, polypeptides and small molecule peptides formed by the decomposition of proteins in yellow water are not recovered, resulting in a COD value of yellow water waste liquid as high as 100,000 or more. Yellow water is a by-product of solid-state liquor brewing, and its production is large. It can only be discharged as waste liquid, which not only causes waste liquid treatment burden, but also causes great resource waste. Separation and extraction of active components in yellow water and activity evaluation can improve the recycling value of yellow water.

[0003] Microglial cells BV2 are immune cells in the central nervous system, which can protect neurons by phagocytizing pathogens and harmful particles in brain tissue, and can also activate into reactive microglial cells under the action of inflammatory factors, and secrete inflammatory cytokines to have toxic effects on neurons. Microglial cells are an important target for treating neuroinflammation and neurodegenerative diseases. Neuropathic pain is a chronic pain caused by damage to the nervous system, and its pathogenesis is complex. So far, there is still lack of effective treatment drugs. Activated microglial cells express P2X4 receptors and P2X7 receptors, which can induce the occurrence of pathological pain.

[0004] There is no report on the extraction of active components from yellow water, and the evaluation of the therapeutic effect of the active extract on BV2 neural cells in terms of cell viability and P2X4 and P2X7 mRNA expression. SUMMARY

[0005] The present application realizes the recycling value of yellow water, a by-product of liquor brewing, and extracts an active extract from yellow water, which has in vitro antioxidant activity, and has a good therapeutic effect on BV2 neural cells through cell experiments.

[0006] The present application first provides a yellow water active extract, and a preparation method thereof, which comprises the following steps:

[0007] A. Take yellow water, and perform first static refrigeration to obtain supernatant and organic solvent, mix the supernatant and the organic solvent uniformly, perform second static refrigeration, and then centrifuge to remove the precipitate to obtain a clear liquid;

[0008] B, taking the supernatant obtained in step A, first filtering through an ultrafiltration membrane to remove macromolecules, then filtering through a nanofiltration membrane to remove water and organic reagents, to obtain an extract, and concentrating the extract to obtain the Huangshui active extract.

[0009] In the above Huangshui active extract, in step A, the Huangshui is a yellow liquid byproduct produced during the starter dripping process of the brewing of a strong-flavor liquor.

[0010] In the above Huangshui active extract, in step A, the organic solvent is an alcohol-based organic solvent.

[0011] Preferably, in the above Huangshui active extract, in step A, the organic solvent is food-grade ethanol.

[0012] In the above Huangshui active extract, in step A, the volume ratio of the organic solvent to the Huangshui is 3-4:1.

[0013] In the above Huangshui active extract, in step A, the temperature of the first stationary refrigeration is 0-10℃.

[0014] In the above Huangshui active extract, in step A, the time of the first stationary refrigeration is 24-48h.

[0015] In the above Huangshui active extract, in step A, the temperature of the second stationary refrigeration is 0-10℃.

[0016] In the above Huangshui active extract, in step A, the time of the second stationary refrigeration is 24-48h.

[0017] In the above Huangshui active extract, in step A, the temperature of the centrifugation is 0-10℃.

[0018] In the above Huangshui active extract, in step A, the rotation speed of the centrifugation is 4000-8000r / min.

[0019] In the above Huangshui active extract, in step B, the molecular weight cut-off of the ultrafiltration membrane is 3000-10000Da.

[0020] In the above Huangshui active extract, in step B, the molecular weight cut-off of the nanofiltration membrane is 200-300Da.

[0021] In the above Huangshui active extract, in step B, the concentration temperature is 50-80℃.

[0022] After the Huangshui active extract is obtained by the above method, the Huangshui active extract obtained in step B is detected by ultra-high performance liquid chromatography-mass spectrometry, using TargetLynx quantitative software to calculate the target data peak area, and using a single-point internal standard method.

[0023] In the active extract of the Huangshui, the ultra-high performance liquid chromatography uses reverse phase chromatography when detected.

[0024] In the active extract of the Huangshui, the ultra-high performance liquid chromatography uses gradient elution when detected: mobile phase A: 0.1% formic acid aqueous solution; mobile phase B: methanol or acetonitrile; the elution program is as follows:

[0025]

[0026] In the active extract of the Huangshui, the high performance liquid chromatography uses a UPLC HSS T3 column when detected; preferably, the column length is 150 mm, the inner diameter is 2.1 mm, and the particle size is 1.8 μm.

[0027] In the active extract of the Huangshui, the high performance liquid chromatography uses a column with a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm when detected.

[0028] In the active extract of the Huangshui, the high performance liquid chromatography uses a column with a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm when detected.

[0029] In the active extract of the Huangshui, the high performance liquid chromatography uses a column with a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm when detected.

[0030] In the active extract of the Huangshui, the high performance liquid chromatography uses a column with a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm when detected.

[0031] In the active extract of the Huangshui, the high performance liquid chromatography uses a column with a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm when detected.

[0032] Based on the active extract of the Huangshui, the application also provides a pharmaceutical composition prepared by adding a pharmaceutically acceptable excipient to the active extract of the Huangshui.

[0033] The application also provides the use of the active extract of the Huangshui and the pharmaceutical composition in the preparation of a drug for preventing and treating BV2 nerve cell-related diseases.

[0034] Further, the active extract of the Huangshui and the pharmaceutical composition can be used for preventing and treating neuroinflammation, neurodegenerative diseases, or neuropathic pain.

[0035] The application has the following advantages:

[0036] The present application combines various separation technologies such as liquid-liquid extraction, membrane filtration, etc., uses food-grade ethanol and other organic solvents to precipitate and remove macromolecular polysaccharides and proteins, and then uses ultrafiltration membrane and nanofiltration membrane molecular cut-off to obtain active ingredients in yellow water; through ultra-high performance liquid chromatography-mass spectrometry detection, the yellow water active extract contains a large amount of amino acids and small molecule peptides and other amino acid derivatives, and such compounds have various biological activities. When the present application provides the active ingredients of yellow water, there is no participation of any toxic and harmful chemical reagents, the method is simple, and the safety is high.

[0037] The present application creatively evaluates the activity of the yellow water active extract in the treatment of BV2 nerve cells, uses an ATP (adenosine triphosphate) induced in vitro nerve pain model, and uses cell viability, P2X4 and P2X7 mRNA expression as activity evaluation indexes, finds that the yellow water active extract has a certain therapeutic effect on BV2 nerve cells, provides a data basis for the value of yellow water in medicinal use, improves the application value of yellow water, and expands the use of yellow water. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 It is a TIC graph of 23 amino acid standard samples and the yellow water active extract HC in Example 1; wherein the left is the standard sample, and the right is the yellow water active extract HC.

[0039] Figure 2 It is a column chart of the influence of different concentration HC sample groups on cell viability.

[0040] Figure 3 It is a comparison graph of BV2 cell viability of different concentration HC sample groups and ATP model groups in Example 2.

[0041] Figure 4 It is an EC50 calculation graph of HC samples in Example 2.

[0042] Figure 5 It is a P2X4 receptor expression graph of different concentration HC samples in Example 2.

[0043] Figure 6 It is a P2X7 receptor expression graph of different concentration HC samples in Example 2. DETAILED DESCRIPTION

[0044] The present application firstly selects a high-safety organic solvent (such as food-grade ethanol), and through a suitable material-liquid ratio, macromolecular polysaccharides and proteins in yellow water can be removed by precipitation to obtain an active small molecule part; then, a 3000-10000 Da specification ultrafiltration membrane is used to filter and remove components with a molecular weight higher than 10000 Da in the active small molecule part of the yellow water, and a 200-300 Da specification nanofiltration membrane is used to filter and remove a large amount of water molecules, ethanol and lactic acid components, so that the clear liquid of the yellow water active extract is obtained, and then ethanol is removed by distillation to obtain the yellow water active extract.

[0045] The present application uses a high-resolution ultra-high performance liquid chromatography-tandem quadrupole mass spectrometry system to qualitatively detect the active extract of yellow water and determine the active components therein.

[0046] The present application evaluates the activity of the active extract of yellow water in the treatment of BV2 nerve cells. An in vitro nerve pain model is induced by ATP (adenosine triphosphate), and cell viability, P2X4 and P2X7 mRNA expression are used as activity evaluation indexes to verify that the active extract of yellow water has a therapeutic effect on BV2 nerve cells.

[0047] The present application will be further described in detail by the following examples, but the scope of protection of the present application is not limited in the range of the examples. The raw materials and equipment used in the examples of the present application are known products, which are obtained by purchasing commercially available products.

[0048] Example 1

[0049] (1) Take 10 L of yellow water of Wuliangye, and store it at 4℃ for 24 h. Take 8 L of supernatant, add 30 L of 95% ethanol, mix well, and store it at 4℃ for 24 h. Centrifuge at 4000 r / min and 0-10℃ to remove the precipitate, and obtain 36 L of clear liquid.

[0050] (2) Take the clear liquid, and filter it with a 3000 Da specification ultrafiltration membrane to remove the residual macromolecular components in the clear liquid, and obtain 34 L of filtrate. Filter the filtrate with a 200 Da specification nanofiltration membrane to remove water, ethanol and lactic acid and other small molecular components, and obtain 4 L of extract. Concentrate and remove the solvent from the extract at 50℃ by rotary evaporation, and obtain 260 g of yellow water active extract HC2.

[0051] (3) Sample pretreatment:

[0052] Sample HC solution configuration: take HC 100 mg, add 900 uL 50% methanol as mother liquor. Respectively take 5 times dilution, dilution 10 times. Take 10 uL diluent, place in 1.5 mL centrifuge tube, add 10 uL water, 5 uL internal standard and 40 uL isopropyl alcohol (0.1% formic acid), vortex oscillation 20 min. Place the centrifuge tube in the low temperature centrifuge, 4℃, 12000 rpm centrifugation 10 min. Take 10 uL supernatant, place in 1.5 mL centrifuge tube, add 70 uL boric acid buffer salt, 20 uL AccQ Tag derivatization reagent (Kairos amino acid kit, USA), immediately shake 10 s. After 1 min, the excess derivatization agent is hydrolyzed, and the derivatization reaction is completed; place the centrifuge tube in 55℃ for 10 min; then, dilute with 400 uL water and measure.

[0053] Standard preparation: using gradient dilution method, prepare each amino acid solution with concentration of 400, 200, 100, 40, 20, 10, 4, 2, 1 umol / L in turn, add the same volume of isotope internal standard, mix well and measure.

[0054] Using ultra-high performance liquid chromatography-tandem quadrupole mass spectrometry system for detection.

[0055] (4) Ultra-high performance liquid chromatography-tandem quadrupole mass spectrometry system detection conditions:

[0056] Using Waters ACQUITY UPLC I-CLASS ultra-high performance liquid chromatography for chromatographic separation, the conditions are as follows:

[0057] Chromatographic column: Waters UPLC HSS T3 (1.8 um, 2.1 mm x 150 mm); mobile phase: A phase (water, 0.1% formic acid), B phase (acetonitrile), gradient elution program see table 1; flow rate: 0.5 mL / min; injection volume: 5.0 uL; column temperature: 50℃.

[0058] Using Waters XEVO TQ-S tandem quadrupole mass spectrometry system for mass spectrometry analysis, the conditions are as follows:

[0059] Positive ion source voltage 1.5 kV, cone hole voltage 20 V; desolvation temperature 600℃, desolvation gas flow rate 1000 L / h; cone gas flow rate 10 L / h.

[0060] Table 1 Gradient elution program

[0061]

[0062] The mass spectrometry qualitative detection results of the sample HC to be measured are shown in table 2, and the HPLC chromatogram and total ion flow chart are shown in Figure 1 .

[0063] Table 2 Detection results of HC of active extract of yellow water

[0064]

[0065]

[0066] Example 2: Protective effect of HC of active extract of yellow water on ATP-induced BV2 cells

[0067] Mouse microglial cells (BV2) were cultured in vitro, and an in vitro nerve pain model was induced by ATP. The blank control group (NC), the model control group (MC), and the HC administration group were set up. Cell viability, P2X4, and P2X7 mRNA receptor expression levels were used as evaluation indexes to investigate the effects of HC obtained in Example 1 on the indexes.

[0068] The primer sequence P2X4-F is shown in SEQ ID NO: 1: GACCAACACTTCTCAGCTTGG;

[0069] P2X4-R is shown in SEQ ID NO: 2: GTGACGATCATGTTGGTCATG.

[0070] P2X7-F is shown in SEQ ID NO: 3: TTATGGCACCGTCAAGTGG;

[0071] P2X7-R is shown in SEQ ID NO: 4: TCTCCGTCACCTCTGCTATG.

[0072] (1) Cell culture: BV2 cells were cultured in DMEM complete medium containing 10% fetal bovine serum and 1% antibiotic (100 U / ml penicillin and 100 lg / ml streptomycin), and then incubated in a 37°C humidified incubator with 95% air and 5% CO2.

[0073] (2) Drug toxicity range and efficacy detection: when the BV2 cells reached the logarithmic phase, they were digested with 0.25% trypsin, and then a cell suspension was prepared with complete culture medium. The cells were inoculated in a 96-well plate at a concentration of 1×10 5 -1 -1 ​​HC. Cell viability was detected by MTT Assay kit (Cell Proliferation) after incubation.

[0074] Results are shown in Figure 2 , HC had no cytotoxicity at 0-400 μg·mL -1 concentrations. Figure 3 It can be seen that compared with the MC model group, HC at each concentration had a certain protective effect on BV2 cells under ATP intervention. Figure 4 It can be seen that the half maximal effective concentration EC50 value of HC was 28.77 μg·mL -1 . The expression levels of P2X4 and P2X7 receptor mRNA were detected by Qrt-PCR method. As shown in Figure 5 and Figure 6 , the expression levels of P2X4 and P2X7 receptor mRNA in the MC group were significantly up-regulated, and HC at a concentration of 12.5 μg·mL -1 effectively reversed the up-regulation of P2X4 receptor mRNA expression level (#P<0.05), and HC at a concentration of 50 and 200 μg·mL -1 effectively reversed the up-regulation of P2X7 receptor mRNA expression level (##P<0.01). When P2X4 is activated, the release of brain-derived neurotrophic factor (BDNF) in BV2 cells increases, and the intracellular chloride ion concentration increases, thereby activating amino butyric acid and glycine, leading to excessive excitation of the spinal cord dorsal horn, thereby triggering pain. When P2X4 is activated, the activation of NLRP3 inflammasome releases pro-inflammatory cytokines and cell contents, leading to inflammatory cell death. HC can improve this situation to varying degrees.

[0075] (3) The experimental data were processed using GraphPad Prism 8, and the data results were expressed as mean and standard deviation (S.D.). Statistical comparison between three groups or more than three groups of data used one-way analysis of variance (ANOVA). P<0.05 was considered statistically significant.

Claims

1. Use of an active extract of yellow water or a pharmaceutical composition thereof in the preparation of a drug for preventing and treating BV2 nerve cell-related diseases, characterized in that: The preparation method of the yellow water active extract comprises the following steps: A. Take yellow water, let it stand and refrigerate for the first time, take the supernatant and mix it with the organic solvent, let it stand and refrigerate for the second time, and then centrifuge to remove the precipitate to obtain a clear liquid; B. Take the clear solution obtained in step A, filter it through an ultrafiltration membrane to remove macromolecules, and then filter it through a nanofiltration membrane to remove water and organic reagents to obtain an extract, and concentrate the extract to obtain the yellow water active extract; In step A, the yellow water is a yellow liquid by-product produced when the lees are removed from the cellar during the brewing process of Luzhou-flavor liquor; In step A, the temperature of the first refrigeration is 0-10°C; In step A, the first refrigeration time is 24 to 48 hours; In step A, the organic solvent is food grade ethanol; In step A, the volume ratio of the organic solvent to yellow water is 3-4:1; In step A, the second refrigeration temperature is 0-10°C; In step A, the second refrigeration time is 24 to 48 hours; In step A, the centrifugation temperature is 0-10°C; In step A, the centrifugal speed is 4000-8000 r / min; In step B, the molecular weight cut-off of the ultrafiltration membrane is 3000-10000 Da; In step B, the molecular weight cut-off of the nanofiltration membrane is 200-300 Da; In step B, the concentration temperature is 50-80°C; The pharmaceutical composition is prepared by using the yellow water active extract as the active ingredient and adding pharmaceutically acceptable excipients; The BV2 nerve cell-related disease is neuroinflammation or neuropathic pain.

2. The use according to claim 1, characterized in that: The yellow water active extract obtained in step B was detected by ultra-high performance liquid chromatography-mass spectrometry.

3. The use according to claim 2, characterized in that: The ultra-high performance liquid chromatography adopts reverse phase chromatography.

4. The use according to claim 2, characterized in that: The ultra-high performance liquid chromatography (UPLC) uses a gradient elution method: mobile phase A: 0.1% formic acid aqueous solution; mobile phase B: methanol or acetonitrile; the elution procedure is as follows: 。 5. The use according to claim 2, characterized in that: The chromatographic column of the ultra-high performance liquid chromatography is a UPLC HSST3 column.

6. The use according to claim 5, characterized in that: The chromatographic column of the ultra-high performance liquid chromatography has a column length of 150 mm, an inner diameter of 2.1 mm, and a particle size of 1.8 μm.

7. The use according to claim 2, characterized in that: The column temperature of the ultra-high performance liquid chromatography is 30-50° C., the flow rate is 0.1-0.5 mL / min, and the injection volume is 1-10 uL.

8. The use according to claim 7, characterized in that: The column temperature of the ultra-high performance liquid chromatography was 50° C., the flow rate was 0.5 mL / min, and the injection volume was 5 uL.

9. The use according to claim 2, characterized in that: The mass spectrometer was a tandem quadrupole mass spectrometer system using positive mode detection.

10. The use according to claim 2, characterized in that: The mass spectrometry detection conditions are as follows: positive ion source voltage 1.5 kV, cone voltage 20 V; desolvation temperature 600° C., desolvation gas flow rate 1000 L / h; cone gas flow rate 10 L / h.

Images