Application of 4CL gene in resistance to soybean cyst nematode

By overexpressing the Gm4CL3 and Gm4CL4 genes in soybeans, cell wall resistance is enhanced, and the shortcomings of soybean cystic nematode control methods in the prior art are solved, effective resistance to cystic nematodes is enhanced, and a cost-effective molecular biological means are provided.

CN116536350BActive Publication Date: 2025-08-15SHENYANG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310726128.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-19
Publication Date
2025-08-15
Estimated Expiration
2043-06-19

AI Technical Summary

Technical Problem

In the prior art, the control methods for soybean cyst nematodes mainly rely on crop rotation, biological control and molecular biological resistance breeding, but the crop rotation effect is limited and the biological control methods are relatively friendly, but there is a lack of biological response and function research on the 4CL gene under soybean cyst nematode stress.

Method used

Using the Gm4CL3 and Gm4CL4 genes, cell wall resistance is enhanced to improve resistance to cystic nematodes by constructing recombinant vectors and promoting their expression in soybeans. The specific method includes constructing a recombinant vector of PCAMBIA1302-GFP with Gm4CL3 or Gm4CL4 and validating in tobacco and soybeans by Agrobacterium-mediated transient expression.

Benefits of technology

It significantly enhances the resistance of soybeans to cystic nematodes, and through the thickening mechanism of cell walls, it improves the resistance to soybeans, providing a cost-effective molecular biology method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116536350B_ABST
    Figure CN116536350B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of plant genetic engineering and specifically relates to the use of a 4CL gene for resistance to soybean cyst nematodes. Experiments have shown that Gm4CL1 and Gm4CL2 in the 4CL gene family are insensitive to SCN inoculation, while Gm4CL3 and Gm4CL4 are relatively sensitive to SCN inoculation. Gm4CL3 and Gm4CL4 are located in the cytoplasmic membrane, and the cell wall of plants transformed with Gm4CL3 is thickened. It is speculated that Gm4CL3 participates in soybean cyst nematode stress by regulating cell wall resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and in particular relates to the use of a 4CL gene in resistance to soybean cyst nematodes. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.), a member of the Dicotyledons and Angiosperms, is the world's most important legume. With the increasing demand for soybeans, biotic and abiotic stressors affecting soybean production, such as pests and diseases (soybean cyst nematode), various microbial infections, and climate, soil conditions, and mechanical damage, require attention to increase soybean yields.

[0003] Soybean cyst nematode (SCN) is a soil-borne endoparasitic nematode belonging to the family Nematoda and genus Nematodes in the animal kingdom. Soybean cyst nematode disease occurs worldwide. It not only establishes feeding sites in soybean roots, affecting the physiological characteristics of the aboveground part of the plant, causing yellowing and stunted leaves, but also reduces root nodules, allowing other microorganisms to re-infect the wounds. Therefore, the prevention and control of soybean cyst nematodes is urgent.

[0004] The control of soybean cyst nematodes focuses on crop rotation, biological control, and resistance breeding using molecular biology. The effectiveness of crop rotation is affected by the plants in rotation, the number of years, and the order of planting. Furthermore, due to the nematodes' long-term residence in the soil, they cannot be fundamentally controlled in a short period of time. It is also not the best way to control nematodes and increase yields in soybean-producing areas. Biological control mainly includes nematode-feeding fungi, endoparasitic fungi, antibiotic-producing fungi, fungi that regulate plant responses, and fungi that induce systemic acquired resistance and defense responses in soybeans. It is a friendlier method than chemical control. Using molecular biology techniques to explore resistance mechanisms and conduct resistance breeding is also a method currently used by researchers to study soybean cyst nematode control and is one of the more cost-effective methods in the field of cyst nematode control.

[0005] 4CLs often exist as gene families and have been cloned and functionally analyzed in plants such as Osmanthus fragrans, Arabidopsis thaliana, Ginkgo biloba, soybean, honeysuckle, and rice. Soybean and Arabidopsis each have four 4CLs: Gm4CL1, Gm4CL2, Gm4CL3, and Gm4CL4, and At4CL1, At4CL2, At4CL3, and At4CL4. In Arabidopsis, At4CL1, At4CL2, and At4CL4 are closely homologous, while At4CL3 is more distantly homologous. Studies have shown that At4CL1, At4CL2, At4CL3, and At4CL4 all participate in lignin deposition, but At4CL1 is the primary player. Only in the absence of At4CL1 do At4CL2, At4CL3, and At4CL4 potentially participate in lignin biosynthesis, while At4CL3 is primarily responsible for flavonoid biosynthesis. Therefore, 4CLs have overlapping yet distinct functions in plants. They are important regulators of flavonoid and lignin monomer synthesis and may exert distinct biological functions under stress. Although 4CL has been cloned and the expression of related genes has been verified in different plants, there is no clear research on the biological response and function of 4CL in different resistant and susceptible soybean varieties under SCN stress. Summary of the Invention

[0006] In view of the above technical problems, the present invention provides a use of a 4CL gene in resisting soybean cyst nematode stress, wherein the 4CL gene is Gm4CL3 or Gm4CL4. Experiments have shown that Gm4CL3 or Gm4CL4 transgenic plants have significantly enhanced resistance to soybean cyst nematode stress.

[0007] In a first aspect, the present invention provides a use of a 4CL gene in resisting soybean cyst nematode stress, wherein the 4CL gene is Gm4CL3 or Gm4CL4.

[0008] Preferably, the Gm4CL3 or the Gm4CL4 is used to improve soybean cell wall resistance.

[0009] Preferably, improving soybean cell wall resistance refers to thickening of the cell wall.

[0010] Preferably, the soybeans are gray-skinned black beans, small-grain black beans or Harbin small black beans.

[0011] In a second aspect, the present invention provides a vector comprising the Gm4CL3 and / or the Gm4CL4.

[0012] Preferably, the vector is a recombinant vector of PCAMBIA1302-GFP and the Gm4CL3; or a recombinant vector of PCAMBIA1302-GFP and the Gm4CL4.

[0013] The third aspect of the present invention provides a recombinant cell containing the vector.

[0014] In a fourth aspect, the present invention provides a use of the vector or the recombinant cell for enhancing the resistance of soybean to cyst nematodes.

[0015] In a fifth aspect, the present invention provides a method for enhancing the resistance of soybean to cyst nematodes, the method comprising promoting the expression of Gm4CL3 and / or Gm4CL4 in soybean.

[0016] In a sixth aspect, the present invention provides a method for breeding soybeans resistant to cyst nematode stress, the breeding method comprising promoting the expression of Gm4CL3 and / or Gm4CL4 in soybeans.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides the use of Gm4CL3 or Gm4CL4 for resistance to soybean cyst nematode stress. Experiments have shown that Gm4CL1 and Gm4CL2 in the 4CL gene family are insensitive to SCN inoculation, while Gm4CL3 and Gm4CL4 are relatively sensitive to SCN inoculation. Gm4CL3 and Gm4CL4 are located in the cytoplasmic membrane, and the cell wall thickened after conversion to Gm4CL3. It is speculated that Gm4CL3 participates in soybean cyst nematode stress by regulating cell wall resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the phylogenetic tree of 4CL;

[0020] Figures 2 to 5 These are the tissue-specific expressions of Gm4CL1, Gm4CL2, Gm4CL3, and Gm4CL4;

[0021] Figure 6 Results of acid fuchsin staining of soybean roots; A, Williams82 root staining, B, gray-skinned black bean root staining, C, Harbin small black bean root staining, D, small-grain black bean root staining;

[0022] Figure 7 is the gene expression level of Gm4CL1 under soybean cyst nematode stress;

[0023] Figure 8 is the gene expression level of Gm4CL2 under soybean cyst nematode stress;

[0024] Figure 9 is the gene expression level of Gm4CL3 under soybean cyst nematode stress;

[0025] Figure 10is the gene expression level of Gm4CL4 under soybean cyst nematode stress;

[0026] Figures 7-10 W82, HPZ, XLH, and HerB are Williams82, gray-skinned black beans, small-grain black beans, and Harbin small black beans, respectively;

[0027] Figure 11 Heat map analysis of the 4CL gene family;

[0028] Figure 12 Agarose gel electrophoresis of DNA fragments; M = 2000 bp, 1-2 represent Gm4CL3 and Gm4CL4, respectively;

[0029] Figure 13 E. coli bacterial solution PCR; M = 2000 bp, 1-2 represent Gm4CL3 and Gm4CL4, respectively;

[0030] Figure 14 Agrobacterium tumefaciens PCR; M = 5000 bp, 1-3 and 4-6 represent Gm4CL3 and Gm4CL4, respectively;

[0031] Figure 15 PCR results for transient expression in tobacco; M = 2000 bp, 1-4 are controls, 5-6 represent Gm4CL3 and Gm4CL4; from left to right: the first vertical column is the case field, the second vertical column is the overlay field, and the third vertical column is the bright field;

[0032] Figure 16 Subcellular localization of transiently expressed tobacco; (A)-(D) represent PCAMBIA1302-GFP, PCAMBIA1302-GFP-Gm4CL3, PCAMBIA1302-GFP-Gm4CL4, and suspension, respectively;

[0033] Figure 17 Transmission electron microscopy results; scale bar 500 nm, (A)-(D) represent PCAMBIA1302-GFP, suspension, PCAMBIA1302-GFP-Gm4CL3 and PCAMBIA1302-GFP-Gm4CL4, respectively. DETAILED DESCRIPTION

[0034] The following describes embodiments of the present invention in detail, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, and are not to be construed as limiting the present invention.

[0035] Example 1

[0036] Temporal expression of the 4CL gene family and stress responses in nematodes

[0037] 1. Phylogenetic tree analysis of 4CL gene family members

[0038] The NCBI official website (https: / / www.ncbi.nlm.nih.gov / ) and soybean genome database (https: / / www.soybase.org / ) were used to search and download the Gm4CL1 (NC_038253.1), Gm4CL2

[0039] (NC_038249.1), Gm4CL3 (NC_038247.1), and Gm4CL4 (NC_016088.3) and the corresponding amino acid sequences.

[0040] In order to analyze the systematic classification and functional differentiation of genes, MEGAX was used to perform phylogenetic analysis on soybean, Arabidopsis, corn, switchgrass, tobacco, ash, ginkgo, etc. The results showed that ( Figure 1 ), Gm4CL3, Gm4CL4, Gm4CL1, and Gm4CL2 belong to different branches but have high homology with each other. Therefore, it can be predicted that 4CLs in soybean also perform different biological functions by synthesizing different products.

[0041] 2. Tissue-specific expression of soybean 4CL gene family members

[0042] The soybean 4CL gene family member Gm4CL1 was identified using http: / / bar.utoronto.ca /

[0043] (Glyma.17g064600), Gm4CL2 (Glyma.13g372000), Gm4CL3 (Glyma.11g010500), and Gm4CL4 (Glyma.01g232400) were analyzed for tissue-specific expression. Figures 2 to 5 As shown, Gm4CL1 was most significantly expressed in leaves, while Gm4CL2 was most significantly expressed in roots. Gm4CL3 was most significantly expressed in roots, with no significant changes in root hairs before and after treatment. Gm4CL4 was most significantly expressed in roots, with increased expression in the root tips and root hairs after infection. Based on these tissue-specific expression results and the fact that soybean cyst nematode infests the root, stress responses of this gene family can be analyzed, and it is preliminarily hypothesized that these genes play a role in soybean cyst nematode stress.

[0044] 3. Expression of 4CL gene family members under soybean cyst nematode stress

[0045] 3.1. Preparation and inoculation of soybean cyst nematode egg suspension

[0046] Pathogen soil was collected from the cyst breeding base in the back mountain of the Northern Nematode Research Institute at Shenyang Agricultural University. A certain amount of pathogenic soil was added to a basin, along with an appropriate amount of water to approximately 3 / 4 of the total volume. The soil was thoroughly mixed and allowed to stand for approximately 3 minutes, allowing the sand to sink while the nematode cysts remained in the water. The suspended aqueous solution was then poured through standard sieves arranged from top to bottom with 20, 40, and 80 mesh, respectively, to separate the cysts. The soybean cyst nematode eggs were then isolated using the Behmann funnel method.

[0047] Select appropriate amounts of soybean seeds of four different varieties, including Williams82, gray-skinned black beans, Harbin small black beans and small-grain black beans, disinfect them, and rinse them thoroughly with sterile water. Place the sterilized seeds in vermiculite that has been sterilized at 121℃ for 2h in advance, place them in a climate chamber, and wait until the seedlings grow to the two-leaf stage for inoculation.

[0048] Incubated soybean cyst nematodes were mixed with a 0.2% agar solution and inoculated at 2000 J² / mL onto the roots of different soybean varieties. Control and treatment groups were set up, with the control group inoculated with agar solution without cyst nematodes. At least three biological replicates were performed. On days 0, 1, 3, 5, 7, 9, 10, 15, and 20 after inoculation, normally grown seedlings were rinsed with clean water, labeled as control or treatment, and immediately placed in liquid nitrogen and stored at -80°C until use.

[0049] 3.2. Acid fuchsin staining of roots

[0050] Take the inoculated soybean plants, clean the diseased roots, cut them into small segments if they are too large, and disinfect them with a 5.5% NaClO solution. Rinse the roots and stain them with fuchsin. After rinsing the fuchsin, decolorize them in glycerol. Observe and photograph them under a stereomicroscope.

[0051] 3.3. Extraction of Total RNA from Soybean Roots

[0052] Soybean root tissues stored in a -80°C refrigerator were taken to extract total RNA from the roots.

[0053] 3.4. Obtaining cDNA

[0054] Prepare the following mixture in an RNase-free centrifuge tube: 4 μL 4×g DNA wiper mix and 1 μg template RNA, dilute to 16 μL with RNase-free ddH2O, mix gently by pipetting, and incubate at 42°C for 2 min.

[0055] Reverse transcription reaction system: 16 μL of the reaction solution from step 1, 4 μL of 5×HiScript II qRT SuperMix II, mix, and gently pipette to mix.

[0056] Reverse transcription reaction: Perform reverse transcription reaction at 50℃ for 15 min and 85℃ for 5 s. The product can be used immediately for qPCR reaction or stored at -20℃. The cDNA should be protected from repeated freezing and thawing.

[0057] 3.5. Real-time fluorescence quantitative PCR primer design

[0058] (1) Primers of the 4CL gene family were designed using NCBI online to test the relative expression levels of the genes.

[0059] Primer sequence: Gm4CL1-F: TGCCGTTGTAGGCATGAAAGAT, as shown in SEQ ID NO. 5;

[0060] Gm4CL1-R: TCTTGATTTCATCCTCGGCG, as shown in SEQ ID NO. 6;

[0061] Gm4CL2-F: CTCCAAACAGGTGGTGTTTTACA, as shown in SEQ ID NO. 7;

[0062] Gm4CL2-R: GAACACTTGCCGCTATCTTTGC, as shown in SEQ ID NO. 8;

[0063] Gm4CL3-F: GACAACGGTAGCTGCTTCTC, as shown in SEQ ID NO. 9;

[0064] Gm4CL3-R: GAGGTGGTTGGAGATTGGGA, as shown in SEQ ID NO.10;

[0065] Gm4CL4-F: TTCGAGATCGGGACACTGC, as shown in SEQ ID NO. 11;

[0066] Gm4CL4-R: TCCCGTAACCCTGTCCCAAAA, as shown in SEQ ID NO. 12;

[0067] Gm POD-F: TTCTCTTCCCTTCAGAAGCTCA, as shown in SEQ ID NO. 13;

[0068] Gm POD-R: GGACGCATCACACCCATTGA, as shown in SEQ ID NO. 14;

[0069] Tubulin-motif-F: AGGGCAATGCGGTAACCA, as shown in SEQ ID NO.15.

[0070] Real-time fluorescence quantitative PCR reaction system: 10.0 μL 2X ChamQ Universal SYBR qPCR MasterMix, 0.4 μL Primer 1 (10 μM), 0.4 μL Primer 2 (10 μM), 2.0 μL cDNA, and ddH2O to 20 μL. Reaction procedure: initial denaturation at 95°C for 30 s; 40 cycles of 95°C for 10 s, 60°C for 30 s, and 95°C for 15 s; melting curve at 60°C for 60 s; and 95°C for 15 s.

[0071] 3.6 Results and Analysis

[0072] 3.6.1. Acid fuchsin staining of roots

[0073] from Figure 6 It can be seen that after inoculation with nematodes, all soybean varieties were infected by SCN and the nematode infection status was normal and they could grow and develop normally.

[0074] 3.6.2. Expression analysis of the 4CL gene family in different resistant varieties

[0075] like Figure 7 As shown in the figure, the relative expression level of small black beans on the first day of inoculation was 0.4, which was significantly lower than that of Williams82. It is speculated that this may be caused by the slow resistance response of small black beans. On the 7th day of inoculation, the relative expression level of small black beans was different from that of Harbin small black beans, but the relative expression level of Gm4CL1 in gray-skinned branches and Harbin small black beans had no significant response compared with Williams 82, and there was no significant difference between the different time points, indicating that Gm4CL1 may not be an active member of the SCN response. Figure 8 As shown in the figure, the expression level of Gm4CL2 after inoculation with SCN was not significant between resistant and susceptible varieties and between resistant lines (P>0.05). Combined with the results of Gm4CL1, it is speculated that Gm4CL1 and Gm4CL2 are not sensitive to soybean cyst nematode stress. Figure 9As shown in the data, after inoculation with SCN, the 4CL3 of gray-skinned black beans showed significant differences compared with Williams2 on the 1st, 9th and 15th days after inoculation. The relative expression levels were 2.7, 2.6 and 2.3, respectively, which were 2.7, 2.1 and 5.0 times the relative expression levels of Williams82, with significant differences of P<0.01, P<0.05 and P<0.01, respectively. There was no significant difference between small-grain black beans and Harbin small black beans compared with Williams. Comparative analysis of Gm4CL3 expression levels among disease-resistant varieties showed that the expression of Gm4CL3 in gray-skinned black beans was significantly higher than that of the other two disease-resistant varieties. On the 1st and 9th days, the expression of Gm4CL3 in gray-skinned black beans was 2.7 and 2.6 times higher than that of small black beans and Harbin small black beans, respectively. On the 15th day, the expression of Gm4CL3 in gray-skinned black beans was 2.3 times higher than that of the other two varieties. The significant differences were P<0.01, P<0.01, and P<0.05, respectively. Therefore, Gm4CL3 was more sensitive in gray-skinned black beans, and the stress response appeared on the 1st, 9th, and 15th days. Figure 10 As shown in Figure 2, Gm4CL4 also produced relative expression differences after inoculation with soybean cyst nematodes. On the 9th and 15th days after inoculation, the relative expression levels of gray-skinned black beans were significantly different from Williams82, with relative expression levels of 5.6 and 4.8, respectively, which were 3.3 and 9.6 times higher than Williams82, showing significant differences. **** P < 0.0001. Gm4CL4 showed no significant difference in the small black bean and Harbin small black bean compared to the susceptible ones. In addition, only the disease-resistant variety, the gray-skinned black bean, showed significant differences on the 9th and 15th days. The gray-skinned black bean was 4, 4.6 times and 6, 6 times that of the small black bean and Harbin small black bean on the 9th and 15th days of inoculation, respectively. The significant differences were **** P<0.0001, so Gm4CL4 is more sensitive to stress in gray-skinned black beans and mainly responds to stress on days 9 and 15.

[0076] 3.6.3. Heatmap analysis of the specific expression of the 4CL gene family in a single disease-resistant variety

[0077] like Figure 11 As shown, Gm4CL3 and Gm4CL4 in the 4CL gene family have significant changes. According to the color change, it can be seen that the expression level of Gm4CL3 is weaker than that of Gm4CL4, while the change of Gm4CL4 is more obvious on the 9th and 15th days, and the 9th day after inoculation is significantly better than the 15th day. It is speculated that since the disease-resistant variety gray-skinned black bean cannot grow and develop normally after 9 days, the expression level is reduced on the 15th day due to insensitivity.

[0078] According to the above results and combined with real-time fluorescence quantitative PCR comprehensive analysis, Gm4CL3 and Gm4CL4 responded to soybean cyst nematode stress, and the gene expression of Gm4CL3 and Gm4CL4 mainly showed time differences at 1, 9, and 15 days.

[0079] Example 2

[0080] Cloning of Gm4CL3 and Gm4CL4 and construction of overexpression vectors

[0081] Gm4CL3 and Gm4CL4 amplification: Based on the cDNA sample in Example 1, upstream and downstream primers with restriction sites and complementary sequences were designed according to the TAKARA infusion seamless cloning technology. The target gene was amplified according to the corresponding reaction system and reaction procedure. The overexpression vector used was PCAMBIA1302-GFP. The upstream and downstream primers were designed and verified using primers and NCBI. NcoⅠ (5'-C↓CATGG-3') and SpeⅠ (5'-A↓CTAGT-3') were introduced into the vector respectively.

[0082] Primer sequence: Gm4CL3-F:

[0083] ACGGGGGACTCTTGA CCATGG ATGACAACGGTAGCTGCTTCTCT, as shown in SEQ ID NO. 1;

[0084] Gm4CL3-R:AAGTTCTTCTCCTTT ACTAGT AGGCGTCTGAGTGGCGG, as shown in SEQ ID NO. 2;

[0085] Gm4CL4-F:

[0086] ACGGGGGACTCTTGA CCATGG ATGATAACTCTAGCTCCTTCTCTTGATAC, as shown in SEQ ID NO. 3;

[0087] Gm4CL4-R: AAGTTCTTCTCCTTTACTAGTAGGCGTCTGAGTGGCGG, as shown in SEQ ID NO.4.

[0088] PCR reaction system: 25 μL PrimeSTAR Max Premix (2x), 2 μL Primer F (10 μM), 2 μL Primer R (10 μM), 4 μL Template, and make up to 50 μL with sterile distilled water. PCR reaction program (50 μL reaction system): 98°C for 10 s, 55°C for 5 s, 72°C for 5 s; 35 cycles, 4°C forever.

[0089] According to the principle of seamless connection, the restriction enzyme sites NcoⅠ and SpeⅠ were selected, and the PCAMBIA1302-GFP vector was linearized using the fast-cut enzyme purchased from Sangon. It was then separated and purified using agarose gel electrophoresis and a gel recovery kit for subsequent ligation. Enzyme digestion system: 6μL Nuclease-free water, 2μL 10X SpeedyOne Buffer, 10μL plasmid DNA, 1μL SpeedyCut NcoⅠ, 1

[0090] μLSpeedyCut SpeⅠ.

[0091] Construction and identification of overexpression vectors: The target fragments Gm4CL3 and Gm4CL4 recovered from the gel were ligated with the linearized vector fragment according to the In-fusion seamless cloning technology, incubated at 50°C for 15 min, and stored at -20°C.

[0092] Reaction system: 4μL 5X In-Fusion HD Enzyme Premix, 5μL Linearized vector, 5μL Purified PCR fragment, 6μL ddH2O.

[0093] (1) After taking out the competent E. coli cells from the -80℃ refrigerator, quickly insert them into the ice box to dissolve them. Add the recombinant DNA sample on the clean bench and mix gently. Place it on ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, quickly return it to ice and place it for about 2 minutes. Be careful not to shake it. Add 700μL of sterile culture medium without antibiotics and mix evenly. Incubate at 37℃ with shaking for 1 hour (160-225rpm). After taking it out, place it in a low-speed centrifuge at 5000rpm / min and centrifuge it for 1 minute. Take 500μL of supernatant and mix it evenly. Take 50-100μL of volume and spread it evenly on the LB agar medium plate containing kanamycin antibiotics. Place it upright at 37℃ until the liquid is absorbed, then invert it and culture it overnight for 12-16 hours. Pick up a positive single colony and add it to the culture medium containing the corresponding antibiotics. Incubate it with shaking at 37℃ overnight. Take the bacterial solution that has been cultured overnight for PCR identification. The PCR procedure and system are the same as those for the target fragment cloning.

[0094] (2) Plasmid extraction

[0095] (3) Before use, please confirm whether RNase A solution has been added to Buffer P1 and the corresponding volume of anhydrous ethanol has been added to Buffer PW.

[0096] (4) Take 5 mL of overnight culture solution and add it to the prepared centrifuge tube. Centrifuge at 13,000 × g for 1 min to collect the bacteria and discard the supernatant.

[0097] (5) Add 250 μL of Buffer P1 to the centrifuge tube and vortex to fully suspend the bacterial pellet.

[0098] (6) Add 250 μL of Buffer P2 to the centrifuge tube, gently invert it upside down 8 to 10 times, and let it stand at room temperature for 2 to 5 minutes to allow the bacteria to fully lyse. At this time, the solution should become clear and viscous (Note: This step should be done gently to avoid violent shaking that may cause genomic contamination. The lysis time should not exceed 5 minutes).

[0099] (7) Add 350 μL of Buffer N3 to the centrifuge tube and gently invert it 8 to 10 times. A white flocculent precipitate will appear in the solution. Centrifuge at 13,000 × g for 5 min. (After adding Buffer N3, invert the tube immediately to mix thoroughly to avoid local precipitation. If a small amount of white precipitate is still in the supernatant after 5 min of centrifugation, extend the centrifugation time to 10 min.)

[0100] (8) Place the adsorption column in the collection tube, then transfer the supernatant from step 5 to the adsorption column, centrifuge at 13,000 × g for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.

[0101] (9) Add 500 μL of Buffer PB to the adsorption column, centrifuge at 13,000 × g for 30 s, and discard the waste liquid in the collection tube.

[0102] (10) Add 600 μL of Buffer PW to the column and centrifuge at 13,000 × g for 30 s. Discard the waste liquid in the collection tube. Repeat step 8.

[0103] (11) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 13,000 × g for 2 min to completely remove the residual Buffer PW (Note: The ethanol in Buffer PW may affect downstream experiments. It is recommended that after centrifugation, the adsorption column be opened and placed at room temperature for 3–5 min to allow the ethanol to evaporate completely).

[0104] (12) Place the adsorption column in a clean centrifuge tube (self-prepared), add 50-100 μL of Buffer EB to the middle part of the adsorption membrane, incubate at room temperature for 2 minutes, and centrifuge at 13,000 × g for 1 minute. The collected plasmid solution can be used immediately or stored at -20°C for long-term storage. The bacterial solution of the PCR-positive clones is subjected to plasmid mini-extraction, and the positive reaction is sent to the company for sequencing verification. The recombinant plasmid that has been successfully sequenced and multiple verifications is stored at -20°C or mixed with 30% glycerol for storage and used for transformation of Agrobacterium.

[0105] 5. Agrobacterium-mediated transient expression

[0106] (1) Take the competent Agrobacterium cells stored at -80℃ and place them on an ice box to partially melt them. When they are in the state of ice-water mixture, insert them into ice.

[0107] (2) Transform the cells at a ratio of 1 μg (no more than 10 μL) of positive recombinant plasmid per 100 μL of competent medium. Mix thoroughly by shaking the tube bottom. Place on ice for 5 min, in liquid nitrogen for 5 min, in a 28°C water bath for 5 min, and in an ice bath for 5 min. Add 700 μL of LB liquid medium without antibiotics and incubate at 28°C with shaking for 2–3 h.

[0108] (3) Collect the cells by centrifugation at 6000 rpm / min for 1 min, take about 100 μL of the supernatant and gently pipette to resuspend the cells. Spread the cells on LB medium plates containing the corresponding antibiotics and incubate them upside down at 28°C for 2-3 days until a single colony grows. Pick a single colony and place it on liquid culture medium containing the corresponding antibiotics. Incubate with shaking for 12-16 hours for subsequent bacterial liquid PCR and Agrobacterium-mediated transient expression. Mix the positive bacterial liquid with 30% glycerol and store at -80°C for later use.

[0109] 6. Results and Analysis

[0110] 6.1. Clones Amplified from Gm4CL3 and Gm4CL4

[0111] like Figure 12 Using In-Fusion seamless cloning, the CDS regions of the genes used for vector construction were successfully amplified. The lengths were 1713 bp for Gm4CL3 and 1689 bp for Gm4CL4, respectively. These fragments were subsequently purified by gel extraction and ligated with the purified linearized vector.

[0112] 6.2. PCR of Escherichia coli

[0113] like Figure 13 As shown, the PCR fragment of E. coli transformed with the recombinant plasmid is about 2000 bp, which is basically consistent with the fragment length of the target gene, indicating that the recombinant vector was successfully transformed into E. coli. The bacterial solution of the positive reaction was selected for plasmid miniprep sequencing for verification, and the expression vector was successfully constructed.

[0114] 6.3. Agrobacterium tumefaciens PCR

[0115] like Figure 14 As shown, the recombinant overexpression vector successfully verified by sequencing was transformed into Agrobacterium and subjected to bacterial liquid PCR, and the positive clones were retained and stored or subjected to Agrobacterium transient transformation.

[0116] Example 3

[0117] Transient transformation of Gm4CL3 and Gm4CL4 in tobacco

[0118] 1. Reagent and culture medium configuration

[0119] 50 mg / mL Rifampicin (Rif): Weigh 0.5 g of rifampicin reagent and dissolve it in 10 mL of methanol. Filter through a 0.22 μm filter membrane and store at -20°C until use.

[0120] 50 mg / mL kanamycin (Kan): Weigh 0.1 g of dry powder, dilute to 2 mL with sterile water, filter through a 0.22 μm filter, and store at -20°C until use.

[0121] YEP liquid medium: Weigh 5 g of yeast extract powder, 10 g of tryptone, and 5 g of NaCl, add to a container containing distilled water, stir evenly until the reagents are dissolved, make up to 1 L, and dispense into Erlenmeyer flasks of different sizes. Stir and sterilize by high-pressure moist heat at 121°C for 30 min.

[0122] 10mmol / LMES: Weigh 2.132g of the reagent powder and dilute to 1L with water. Set aside.

[0123] 10mmol / L MgCl2·6H2O: Weigh 2.033g of the reagent powder and dilute to 1L with water. Reserve the solution for later use.

[0124] 200 mmol / L acetosyringone: Weigh 0.1962 g of acetosyringone dry powder, dissolve it in dimethyl sulfoxide (DMSO) to 5 mL, filter sterilize, and store at -20°C until use.

[0125] 2. Agrobacterium-mediated transient transformation of tobacco

[0126] (1) Tobacco culture: Sterilize the substrate at 160°C for 30 minutes and place it in trays for later use. Sprinkle an appropriate amount of tobacco seeds on the substrate and gently water it. Cultivate the tobacco, replenishing water every other day or when water is scarce. When the tobacco has 6 to 7 leaves, approximately 6 to 7 weeks, perform Agrobacterium-mediated transformation.

[0127] (2) Agrobacterium-mediated transformation: Transient expression of the positive Agrobacterium strain prepared in Example 2 and preserved in glycerol was performed in tobacco. The suspension, empty vector, and recombinant plasmid vector were injected separately. The positive strain was inoculated into YEP liquid medium containing Rif and Kan and cultured at 28°C with shaking at 200 rpm until OD600 = 1.0.

[0128] (3) Centrifuge at 4500 rpm / min for 15 min, discard the supernatant, and suspend the bacteria in a suspension prepared by mixing 10 mmol / L MES and 10 mmol / L MgCl2·6H2O.

[0129] (4) Centrifuge at 4500 rpm / min for 5-10 min, discard the supernatant, adjust the bacterial suspension OD to 0.4 using a suspension (containing 200 mmol / L acetosyringone), and let it stand at 28°C for 4 h.

[0130] (5) Use a syringe to draw up 1 mL of the bacterial suspension and inject it into the back of a tobacco leaf. The injected tobacco leaves are incubated in the dark for 1 day. After 2 days of normal incubation, they can be used for subcellular localization.

[0131] 3. PCR detection of transient expression in tobacco

[0132] RNA was extracted from tobacco leaves transiently transfected with the target gene fragment and reverse transcribed. The primers were based on the primer sequences used during cloning. Leaves injected with suspension and empty vector were used as controls to verify whether the transient transfection was successful.

[0133] 4. Experimental observation

[0134] Subcellular localization analysis of Agrobacterium-transformed tobacco leaves was performed using fluorescence confocal microscopy. Transmission electron microscopy was performed on Agrobacterium-transformed tobacco leaves.

[0135] 5. Results and Analysis

[0136] 5.1 PCR Analysis of Tobacco Transient Expression

[0137] like Figure 15 The results showed that 1 to 4 were controls injected with suspension and empty vector, respectively, and no target fragments appeared. However, target gene-injected tobacco leaves showed target bands (5 to 6), with a band size of approximately 2000 bp, consistent with the size of the target gene, indicating that the target gene had been transferred into the tobacco leaves.

[0138] 5.2 Subcellular Localization of Transiently Expressed Proteins in Tobacco

[0139] Subcellular localization analysis was performed using fluorescence confocal microscopy. Figure 16 As shown, the results showed that Gm4CL3 and Gm4CL4 were located in the cytoplasmic membrane, so it was speculated that the 4CL gene family members played their catalytic role in the cytoplasmic membrane.

[0140] 5.3 Transmission Electron Microscopy Analysis of Tobacco Transient Expression

[0141] Transmission electron microscopy analysis of tobacco showed that Figure 17 shown. Figure 17 (A-B) are tobacco leaves transformed with empty plasmid and suspension. Figure 17 (C~D) converted Gm4CL3 and Gm4CL4 respectively. As can be seen from the figure, Figure 17There is no significant difference in cell wall thickness among A, B, and D. Figure 17 The cell wall thickness of C increased, and the transformed Gm4CL3 may affect the cell wall development.

[0142] In summary, it is speculated that 4CL responds to soybean cyst nematode stress through cell wall resistance.

[0143] Example 4

[0144] Application of Gm4CL3 and Gm4CL4 in resistance to soybean cyst nematode stress

[0145] Axillary buds of sterilized soybean Williams82 seeds were taken and infected with Agrobacterium solutions containing Gm4CL3 and Gm4CL4 in Example 3, respectively. Soybean plants were screened and cultured, and identified as Gm4CL3 transgenic plants and Gm4CL4 transgenic plants.

[0146] The resistance of the transgenic plants was assessed using Williams 82 soybean plants as a control. Resistance was graded according to the IP index (IP) for soybean disease resistance, proposed by Shannon in 1992: highly resistant (0-9%), moderately resistant (10-30%), moderately susceptible (31-60%), and highly susceptible (>60%). The IP index is calculated as (average cyst count of the test variety / average cyst count of the susceptible control variety) × 100. The resistance test was repeated three times, with 10 plants tested in each replicate.

[0147] Results showed that compared with the control group, the average number of cysts in Gm4CL3 and Gm4CL4 transgenic plants was significantly reduced, indicating moderate resistance. The non-transgenic soybean control, Williams82, showed moderate susceptibility. This suggests that introducing recombinant expression vectors containing Gm4CL3 and Gm4CL4 into plants can significantly improve plant resistance to soybean cyst nematodes.

[0148] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

Claims

1. A use of a 4CL gene in resisting soybean cyst nematode stress, characterized in that: Overexpression of 4CL gene is used to resist soybean cyst nematode stress. Gm4CL3 or Gm4CL4 The soybeans are gray-skinned black beans, small black beans or Harbin small black beans, Gm4CL3 Used to improve the resistance of soybean cell walls, improving the resistance of soybean cell walls is to thicken the cell walls, Gm4CL 3 is located on the chromosome with accession number NC_038247.1, and its amplification primers are shown in SEQ ID NO.1 and SEQ ID NO.2; Gm4CL4 It is located on the chromosome with accession number NC_016088.3, and its amplification primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

2. A carrier, characterized in that It includes the one described in claim 1 Gm4CL3 and / or Gm4CL4 .

3. The carrier according to claim 2, characterized in that The vector is PCAMBIA1302-GFP and the vector according to claim 1 Gm4CL3 recombinant vector; or PCAMBIA1302-GFP and the one described in claim 1 Gm4CL4 recombinant vector. A recombinant cell containing the vector according to claim 2.

5. Use of the vector according to claim 2 or the recombinant cell according to claim 4 in enhancing soybean resistance to cyst nematodes.

6. A method for enhancing soybean resistance to cyst nematodes, characterized in that: The method comprises the steps of claim 1 Gm4CL3 and / or the Gm4CL4 Overexpression of 。 7. A method for breeding soybeans resistant to cyst nematode stress, characterized in that: The breeding method comprises the method according to claim 1 in soybean Gm4CL3 and / or the Gm4CL4 overexpression.