MUC1 binding molecules and their applications

Abstract

The present invention relates to a MUC1 binding molecule and its application, and specifically provides a MUC1 binding molecule, comprising an anti-MUC1 single domain antibody, wherein the complementary determining region CDR of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3. The MUC1 binding molecule can bind to MUC1 with high specificity and has high affinity and biological activity.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine or biopharmaceutical technology, and more specifically to a MUC1 binding molecule and its application. The MUC1 binding molecule of the present invention can bind to the extracellular region of MUC1 with high specificity, has high affinity and biological activity, low immunogenicity, stable structure and good drugability. Background Art

[0002] MUC1 is a mucin expressed in a variety of epithelial cells and highly expressed in various solid tumors and hematological tumor cells. MUC1 is one of the most potential targets in the field of tumor treatment. Due to the differences in MUC1 glycosylation and the occurrence of breaks, the structure of MUC1 on the surface of tumor cells and normal cells is quite different. These differences determine that MUC1 will be a specific target for solid tumors.

[0003] Nanobodies have natural advantages such as easy expression, high stability, and high affinity. Based on the advantages of nanobodies themselves and the biological mechanism of MUC1, the development of MUC1 nanobodies has very broad application prospects. Summary of the invention

[0004] The object of the present invention is to provide MUC1 binding molecules and applications thereof.

[0005] In a first aspect, the present invention provides a MUC1 binding molecule comprising an anti-MUC1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO:1, CDR2 comprises the sequence shown in SEQ ID NO:2, and CDR3 comprises the sequence shown in SEQ ID NO:3.

[0006] In one or more embodiments, SEQ ID NO: 1 is GX1X2X3X4X5X6X7X8X9X 10 , wherein X1 is P, F, L, A or R, X2 is H, T, S or F, X3 is L, F, S, G, T or A, X4 is E, R, D, L or N, X5 is L, R, Y, N, D, Q, I or E, X6 is Y, H, L, E or I, X7 is A, Y, D, M, E or T, X8 is Y, E or none, X9 is Y or none, X 10 N or None.

[0007] In one or more embodiments, CDR1 comprises the sequence set forth in any one of SEQ ID NOs: 4-13.

[0008] SEQ ID NO:2 is IX1X2X3X4X5X6X7, wherein X1 is S, N or R, X2 is E, T, G, R or W, X3 is S, N, R, I, F or Y, X4 is G, D or N, X5 is D, G, S, A, E, T or none, X6 is D, T, S, R, P, L, W or none, and X7 is T, I or none.

[0009] In one or more embodiments, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 14-24.

[0010] In one or more embodiments, SEQ ID NO: 3 is

[0011] X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 , wherein X1 is A, T or N, X2 is A or T, X3 is C, I, E, G or V, X4 is T, G, R, V or D, X5 is F, Y, T, I, A, N or P, X6 is Y, P, R, G, L or A, X7 is G, S, F, R, L or H, X8 is S, Q, I, T, W, K or Y, X9 is T, L, F, P, S or none, X 10 F, S, G, C, T or none, X 11 R, Y, T, L, S, C or none, X 12 E, D, C, F, Y or None, X 13 M, Y, V, L or none, X 14 G, P, H, A, T or none, X 15 Y, S, Q, R, W, V or none, X 16 N, R, T, M, P or None, X 17 F, E, A, Q or none, X 18 A, G, Y or none, X 19 S, D, R or none, X 20 Is Y or None.

[0012] In one or more embodiments, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 25-35.

[0013] In one or more embodiments, the CDR1 of the single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-13, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 14-24, and the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 25-35.

[0014] In one or more embodiments, the single domain antibody comprises CDR1, CDR2 and CDR3 shown in SEQ ID NO of any one of the following groups a1 to a11:

[0015] Group CDR1 CDR2 CDR3 a1 4 14 25 a2 5 15 26 a3 6 16 27 a4 7 17 28 a5 8 18 29 a6 9 19 30 a7 10 20 31 a8 10 21 32 a9 11 22 33 a10 12 23 34 a11 13 24 35

[0016] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of any VHH of SEQ ID NOs: 36-46, the FR2 of the VHH can be selected from the FR2 of any VHH of SEQ ID NOs: 36-46, the FR3 of the VHH can be selected from the FR3 of any VHH of SEQ ID NOs: 36-46, and the FR4 of the VHH can be selected from the FR4 of any VHH of SEQ ID NOs: 36-46.

[0017] In one or more embodiments, the FR region of the single domain antibody is a FR region of any VHH selected from SEQ ID NOs: 36-46.

[0018] In one or more embodiments, the single domain antibody VHH is as shown in any one of SEQ ID NOs: 36-46.

[0019] In one or more embodiments, the MUCl binding molecule is a monovalent or multivalent single domain antibody, multispecific single domain antibody, heavy chain antibody or antigen binding fragment thereof, antibody or antigen binding fragment thereof comprising one, two or more anti-MUCl single domain antibodies described herein.

[0020] In one or more embodiments, the multivalent single domain antibody or multispecific single domain antibody is connected to multiple single domain antibodies via a linker. The linker consists of 1-15 amino acids selected from G and S.

[0021] In one or more embodiments, the antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody.

[0022] In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0023] In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region.

[0024] In one or more embodiments, the heavy chain constant region is a constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are CH2 and CH3 of human IgG Fc, such as CH2 and CH3 of IgG1 or IgG4. Preferably, the heavy chain constant region is CH2 and CH3 of IgG4, and its amino acid sequence is shown in SEQ ID NO:47.

[0025] In one or more embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0026] In one or more embodiments, the antibody is an antibody comprising the anti-MUCl single domain antibody as a heavy chain variable domain.

[0027] In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain.

[0028] In one or more embodiments, the antigen-binding fragment of an antibody is selected from Fab, F(ab')2, Fv, scFv.

[0029] In one or more embodiments, the binding molecule described in any embodiment of the present invention is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0030] The present invention also provides a polynucleotide selected from:

[0031] (1) the coding sequence of the single domain antibody described in any embodiment of the present invention or the antibody or antigen-binding fragment thereof described herein;

[0032] (2) the complementary sequence of (1);

[0033] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0034] In one or more embodiments, the fragment is a primer.

[0035] The present invention also provides a nucleic acid construct comprising the polynucleotide described herein.

[0036] In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector.

[0037] The present invention also provides a bacteriophage comprising a MUCl binding molecule as described in any of the embodiments herein.

[0038] In one or more embodiments, the MUCl binding molecule is displayed on the surface of the bacteriophage.

[0039] The present invention also provides a host cell selected from:

[0040] (1) expressing a MUCl binding molecule as described in any embodiment of the present invention;

[0041] (2) comprising a polynucleotide as described herein; and / or

[0042] (3) comprising the nucleic acid construct described herein.

[0043] The present invention also provides a method for producing a MUC1 binding molecule, comprising: culturing the host cells described herein under conditions suitable for producing a MUC1 binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof), and optionally purifying the MUC1 binding molecule from the culture.

[0044] The present invention also provides a pharmaceutical composition comprising the MUC1 binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any embodiment of the present invention, and a pharmaceutically acceptable excipient.

[0045] In one or more embodiments, the pharmaceutical composition is used to treat cancer.

[0046] In one or more embodiments, the cancer is a MUC1-related cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0047] The present invention also provides use of the MUCl binding molecule described in any embodiment herein in the preparation of a medicament for preventing or treating cancer.

[0048] In one or more embodiments, the cancer is a MUC1-related cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0049] The present invention also provides a method for treating or preventing cancer, comprising administering to a patient in need thereof a therapeutically effective amount of the MUCl binding molecule according to any embodiment of the present invention, or a pharmaceutical composition containing the MUCl binding molecule according to any embodiment of the present invention.

[0050] In one or more embodiments, the cancer is a MUC1-related cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0051] The present invention also provides a kit for detecting MUC1, which is used for evaluating the effect of drug treatment or diagnosing cancer, and the kit comprises the MUC1 binding molecule, polynucleotide, nucleic acid construct, bacteriophage, and host cell described in any embodiment of the present invention.

[0052] In one or more embodiments, the kit further comprises a reagent for detecting the binding of MUCl to the single domain antibody, antibody or antigen-binding fragment thereof, for example, a reagent for detecting the binding by enzyme-linked immunosorbent assay.

[0053] In one or more embodiments, the detection binding agent is a detectable label that can be linked to the MUCl binding molecule, such as biotin. The detectable label is linked to the MUCl binding molecule or exists separately in the kit.

[0054] The present invention also provides a non-diagnostic method for detecting the presence of MUC1 in a sample, the method comprising: incubating the sample with the MUC1 binding molecule described in any embodiment of the present invention, and detecting the binding of MUC1 to a single domain antibody, an antibody or an antigen-binding fragment thereof, thereby determining the presence of MUC1 in the sample. The detection is an enzyme-linked immunosorbent assay.

[0055] The present invention also provides use of the MUC1 binding molecule described in any embodiment herein in preparing a kit for detecting MUC1 in a sample, evaluating the effect of drug treatment or diagnosing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 This is the result of the alpaca antiserum titer test against MUC1 protein.

[0057] Figure 2 The ELISA test results of candidate antibodies and MUC1 protein.

[0058] Figure 3 The results of affinity testing of candidate antibodies to MUC1 protein.

[0059] Figure 4 The results of the binding test between the candidate antibody and the MB468 tumor cell line. DETAILED DESCRIPTION

[0060] The inventors have conducted extensive and in-depth research and found a class of MUC1 binding molecules including anti-MUC1 single domain antibodies after a large number of screenings. The MUC1 binding molecules of the present invention can bind to MUC1 with high specificity, have high affinity and biological activity, as well as low immunogenicity, stable structure, and good drugability. The single domain antibodies of the present invention are easy to generate.

[0061] Antibody

[0062] As used herein, a "MUC1 binding molecule" is a protein that specifically binds to MUC1, including but not limited to: antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding regions of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines.

[0063] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions having multiple epitope specificities, multispecific antibodies (e.g., bispecific antibodies), diabodies and single-chain molecules, as well as antibody fragments, especially antigen-binding fragments, e.g., Fab, F(ab')2 and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are used interchangeably.

[0064] The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). IgM antibodies consist of 5 basic heterotetrameric units and an additional polypeptide called J chain, containing 10 antigen binding sites; while IgA antibodies contain 2-5 basic 4-chain units, which can be combined with J chains to form multivalent assemblies. In the case of IgG, the 4-chain unit is usually about 150,000 Daltons. Each light chain is connected to the heavy chain by one covalent disulfide bond, while the two heavy chains are connected to each other by one or more disulfide bonds, the number of which depends on the isotype of the heavy chain. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable domain (VH) at the N-terminus, followed by three (CH1, CH2 and CH3 for each α and γ chain) and four (CH1, CH2, CH3 and CH4 for μ and ε isotypes) constant domains (CH) and a hinge region (Hinge) between the CH1 domain and the CH2 domain. Each light chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at the other end. VL is arranged with VH, while CL is arranged with the first constant domain (CH1) of the heavy chain. Specific amino acid residues are considered to form an interface between the light chain and heavy chain variable domains. Pairs of VH and VL together form an antigen binding site. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, ed., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6. Light chains from any vertebrate species can be assigned to one of two distinct types, called kappa and lambda, based on their constant domain amino acid sequences. Immunoglobulins can be assigned to different classes or isotypes based on their heavy chain constant domain (CH) amino acid sequences. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains called α, δ, ε, γ, and μ, respectively. Based on relatively minor differences in CH sequence and function, the γ and α classes can be further divided into subclasses, for example humans express the following subclasses: IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2.

[0065] The "heavy chain antibody" described herein is an antibody derived from a camelid or cartilaginous fish. Compared with the above-mentioned 4-chain antibody, the heavy chain antibody lacks the light chain and the heavy chain constant region 1 (CH1), and only contains 2 heavy chains consisting of a variable region (VHH) and other constant regions, and the variable region is connected to the constant region by a hinge region structure. Each heavy chain of the camelid heavy chain antibody contains 1 variable region (VHH) and 2 constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains 1 variable region and 5 constant regions (CH1-CH5). The antigen-binding fragment of the heavy chain antibody includes VHH and a single-chain heavy chain antibody. By fusion with the constant region of human IgG Fc, the heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0066] As used herein, the terms "single domain antibody", "anti-MUC1 single domain antibody", "heavy chain variable region domain of heavy chain antibody", "VHH", and "nanoantibody" are used interchangeably and all refer to single domain antibodies that specifically recognize and bind to MUC1. A single domain antibody is a variable region of a heavy chain antibody. Typically, a single domain antibody contains three CDRs and four FRs. Preferably, the single domain antibody of the present invention has CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:2, and CDR3 shown in SEQ ID NO:3. A single domain antibody is the smallest functional antigen-binding fragment. Usually, an antibody that naturally lacks the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0067] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more single domain antibodies of different specificities is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody connects multiple single domain antibodies via a linker. The linker is generally composed of 1-15 amino acids selected from G and S.

[0068] In this article, heavy chain antibodies and antibodies are intended to distinguish different combinations of antibodies. Due to the similarity between the two structures, the following structural description of antibodies is also applicable to heavy chain antibodies in addition to light chains.

[0069] The "variable region" or "variable domain" of an antibody refers to the amino terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL", respectively. These domains are usually the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen binding site.

[0070] The term "variable" refers to the situation that certain segments in the variable domain vary widely in the antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody to its specific antigen. However, the variability is not evenly distributed over all the amino acids spanned by the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVRs) (in both the light chain and heavy chain variable domains), namely, HCDR1, HCDR2, HCDR3 (heavy chain antibodies can be referred to as CDR1, CDR2, CDR3) of the heavy chain variable region and LCDR1, LCDR2 and LCDR3 of the light chain variable region. The more highly conserved parts of the variable domain are called framework regions (FRs). The variable domains of natural heavy and light chains each contain four FR regions (FR1, FR2, FR3 and FR4), most of which adopt a β-folded conformation, connected by three HVRs that form a loop connection and in some cases form a part of the β-folded structure. The HVR in each chain is held together in close proximity by the FR region and contributes to the formation of the antigen binding site of the antibody together with the HVR of the other chain. Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domain is not directly involved in the binding of the antibody to the antigen, but exhibits a variety of effector functions, such as the participation of the antibody in antibody-dependent cell-mediated cytotoxicity.

[0071] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of an immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (C1q) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the CH2 domain and the CH3 domain of the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as a sequence segment from an amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, wherein the numbering is according to the EU index, as in Kabat. As used herein, the Fc region may be a native sequence Fc or a variant Fc.

[0072] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding region and / or variable region of an intact antibody. Antibody fragments are preferably antigen binding fragments of antibodies. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragments that should be able to increase half-life by chemical modification or by incorporation into liposomes. Digestion of antibodies with papain produces two identical antigen binding fragments, called "Fab" fragments, and a residual "Fc" fragment, which has the ability to readily crystallize. Fab fragments consist of a complete light chain and heavy chain variable domain (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent in terms of antigen binding, i.e., it has a single antigen binding site. Pepsin treatment of antibodies produces a larger F(ab')2 fragment, which is roughly equivalent to two Fab fragments linked by disulfide bonds, with different antigen binding activities and still able to cross-link antigen. Fab' fragments differ from Fab fragments by the addition of some additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments were originally generated as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The Fc fragment contains the carboxyl terminal portions of the two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on certain types of cells.

[0073] "Fv" is the smallest antibody fragment that contains a complete antigen recognition and binding site. The fragment consists of a dimer of a heavy chain variable domain and a light chain variable domain in tight, non-covalent association. Six hypervariable loops (3 loops each in the heavy chain and light chain) protrude from the folding of these two domains, contributing the amino acid residues for antigen binding and giving the antibody antigen binding specificity. However, even a single variable domain (or half an Fv containing only three HVRs specific for an antigen) has the ability to recognize and bind to an antigen, although the affinity is lower than that of a complete binding site. "Single-chain Fv", also abbreviated as "sFv" or "scFv", is an antibody fragment comprising the antibody VH and VL domains connected into one polypeptide chain. Preferably, the sFv polypeptide also contains a polypeptide linker between the VH and VL domains so that the sFv forms a desired antigen binding structure.

[0074] Herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, that is, except for possible natural mutations and / or post-translational modifications (e.g., isomerization, amidation) that may exist in small amounts, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific and are directed to a single antigenic site. Compared with polyclonal antibody preparations (which typically include different antibodies directed to different determinants (epitopes)), each monoclonal antibody is directed to a single determinant on the antigen. In addition to their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture without being contaminated by other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be interpreted as requiring the production of antibodies by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be generated by a variety of techniques, including, for example, hybridoma method, phage display method, recombinant DNA method, and technology, single cell sequencing method for generating human or human-like antibodies from animals with part or all of the human immunoglobulin locus or genes encoding human immunoglobulin sequences.

[0075] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0076] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that contains at least a sequence derived from a non-human immunoglobulin. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with a sequence found in a human antibody. Typically in a humanized antibody, the entire antibody (except for the CDR) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDR). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-folded skeleton of the variable region of a human antibody to produce an antibody, the specificity of which is determined by the transplanted CDR. The production methods of such antibodies are well known in the art, for example, using mice with a genetically engineered immune system. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0077] "Human antibody" refers to an antibody having an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or produced using any of the techniques disclosed herein for producing human antibodies. This definition of human antibody explicitly excludes humanized antibodies comprising non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries.

[0078] In some embodiments, the present invention also provides a single domain antibody, heavy chain antibody, antibody or antigen-binding fragment thereof that binds to the same epitope of MUC1 as any anti-MUC1 single domain antibody of the present invention, that is, a single domain antibody, heavy chain antibody, antibody or antigen-binding fragment thereof that can cross-compete with any single domain antibody of the present invention for binding to MUC1.

[0079] In the present invention, the CDR1 of the single domain antibody comprises the sequence shown in SEQ ID NO: 1, wherein SEQ ID NO: 1 is GX1X2X3X4X5X6X7X8X9X 10 , wherein X1 is P, F, L, A or R, X2 is H, T, S or F, X3 is L, F, S, G, T or A, X4 is E, R, D, L or N, X5 is L, R, Y, N, D, Q, I or E, X6 is Y, H, L, E or I, X7 is A, Y, D, M, E or T, X8 is Y, E or none, X9 is Y or none, X 10 In one or more embodiments, CDR1 comprises a sequence as shown in any one of SEQ ID NOs: 4-13.

[0080] In the present invention, the CDR2 of the single domain antibody comprises the sequence shown in SEQ ID NO: 2, SEQ ID NO: 2 is IX1X2X3X4X5X6X7, wherein X1 is S, N or R, X2 is E, T, G, R or W, X3 is S, N, R, I, F or Y, X4 is G, D or N, X5 is D, G, S, A, E, T or none, X6 is D, T, S, R, P, L, W or none, and X7 is T, I or none. In one or more embodiments, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 14-24.

[0081] In the present invention, the CDR3 of the single domain antibody comprises the sequence shown in SEQ ID NO: 3, and SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 , wherein X1 is A, T or N, X2 is A or T, X3 is C, I, E, G or V, X4 is T, G, R, V or D, X5 is F, Y, T, I, A, N or P, X6 is Y, P, R, G, L or A, X7 is G, S, F, R, L or H, X8 is S, Q, I, T, W, K or Y, X9 is T, L, F, P, S or none, X 10F, S, G, C, T or none, X 11 R, Y, T, L, S, C or none, X 12 E, D, C, F, Y or None, X 13 M, Y, V, L or none, X 14 G, P, H, A, T or none, X 15 Y, S, Q, R, W, V or none, X 16 N, R, T, M, P or None, X 17 F, E, A, Q or none, X 18 A, G, Y or none, X 19 S, D, R or none, X 20 In one or more embodiments, CDR3 comprises a sequence as shown in any one of SEQ ID NOs: 25-35.

[0082] In one or more embodiments, the single domain antibody comprises CDR1, CDR2 and CDR3 shown in any group of SEQ ID NOs from Group a1 to Group a11 in Table 1:

[0083] Table 1

[0084] Group CDR1 CDR2 CDR3 a1 4 14 25 a2 5 15 26 a3 6 16 27 a4 7 17 28 a5 8 18 29 a6 9 19 30 a7 10 20 31 a8 10 21 32 a9 11 22 33 a10 12 23 34 a11 13 24 35

[0085] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of any VHH of SEQ ID NOs: 36-46, the FR2 of the VHH can be selected from the FR2 of any VHH of SEQ ID NOs: 36-46, the FR3 of the VHH can be selected from the FR3 of any VHH of SEQ ID NOs: 36-46, and the FR4 of the VHH can be selected from the FR4 of any VHH of SEQ ID NOs: 36-46.

[0086] In a preferred embodiment, the FR region of the single-domain antibody VHH of the present invention is a FR region of any VHH selected from SEQ ID NO: 36-46. Further preferably, the CDR of such an antibody is selected from any of the aforementioned groups a1 to a11. In one or more embodiments, the single-domain antibody VHH is as shown in any of SEQ ID NO: 36-46.

[0087] The MUCl binding molecules described herein can be monovalent or multivalent single domain antibodies, multispecific single domain antibodies, heavy chain antibodies or antigen binding fragments thereof, antibodies or antigen binding fragments thereof comprising one, two or more anti-MUCl single domain antibodies described herein.

[0088] In some embodiments, the MUC1 binding molecules herein comprise an anti-MUC1 single domain antibody and an immunoglobulin Fc region. The Fc region that can be used in the present invention can be from immunoglobulins of different subtypes, for example, IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM. In some embodiments, the immunoglobulin Fc region is IgG4Fc, the amino acid sequence of which is shown in SEQ ID NO:47.

[0089] In some embodiments, the MUCl binding molecule described herein is a heavy chain antibody. The heavy chain antibody further comprises a heavy chain constant region, such as a constant region of a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody. Preferably, the heavy chain constant region is as shown in SEQ ID NO:47.

[0090] The present invention also includes the antibody derivatives and analogs. "Derivatives" and "analogs" refer to polypeptides that substantially maintain the same biological function or activity as the antibodies of the present invention. The derivatives or analogs of the present invention may be (i) polypeptides having a substitution group in one or more amino acid residues, or (ii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iii) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these derivatives and analogs are within the scope known to those skilled in the art.

[0091] Without substantially affecting the activity of the antibody, a person skilled in the art may change one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acids in the sequence of the present invention to obtain variants of the antibody or its functional fragment sequence. These variants include (but are not limited to): one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acid deletions, insertions and / or substitutions, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. In the art, conservative substitutions with amino acids with similar or similar properties generally do not change the function of the protein. For example, amino acids with similar properties are substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For another example, adding one or more amino acids to the C-terminus and / or N-terminus will generally not change the function of the protein. They are all considered to be included in the scope of protection of the present invention.

[0092] Variant forms of the antibodies described herein include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibodies of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibodies of the present invention.

[0093] In some embodiments, the sequence of the variant of the present invention may have at least 95%, 96%, 97%, 98% or 99% identity to its source sequence. The sequence identity of the present invention can be measured using sequence analysis software. For example, the computer program BLAST, especially BLASTP or TBLASTN, using default parameters is used. The present invention also includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have more than 90% (preferably more than 95%, and most preferably more than 98%) homology with the CDRs identified herein.

[0094] The antibodies of the present invention can be prepared by conventional methods in the art, such as hybridoma technology well known in the art. The heavy chain antibodies of the present invention can be prepared by conventional methods in the art, such as phage display technology well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present invention can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding antibodies of the present invention. Transformation can be carried out by any known method, for example, including packaging the polynucleotide in a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the nucleus. Mammalian cell lines that can be used as hosts for expression are well known in the art and include, but are not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by determining which cell lines have high expression levels and produce antibodies with substantial MUCl binding properties.

[0095] Nucleic Acids

[0096] The present invention also provides polynucleotides encoding the above-mentioned antibodies or fragments thereof. Provided herein are polynucleotides encoding heavy chain variable regions, light chain variable regions, heavy chains, light chains, and each CDR. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0097] As will be appreciated by those skilled in the art, due to the degeneracy of the genetic code, a very large number of nucleic acids can be produced, all of which encode the antibodies or antigen-binding fragments thereof of the present invention. Thus, once a specific amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not alter the amino acid sequence encoding the protein. Therefore, the present invention also relates to polynucleotides that hybridize with the above-mentioned polynucleotide sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refers to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0098] The full-length nucleotide sequence of the antibody of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Usually, a fragment with a very long sequence can be obtained by synthesizing multiple small fragments first and then connecting them. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein.

[0099] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0100] Therefore, the present invention also relates to nucleic acid constructs, such as expression vectors and recombinant vectors, comprising the above-mentioned appropriate DNA sequences and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to enable them to express proteins. The vectors usually contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. The sequences (collectively referred to as "flanking sequences" in certain embodiments) usually include one or more of the following nucleotide sequences: promoters, one or more enhancer sequences, replication origins, transcription termination sequences, complete intron sequences containing donor and acceptor splice sites, sequences encoding leader sequences for polypeptide secretion, ribosome binding sites, polyadenylation sequences, multiple linker regions for inserting nucleic acids encoding antibodies to be expressed, and selectable marker elements.

[0101] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS7, 293 cells, etc.

[0102] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0103] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0104] The polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0105] Therapeutic uses and pharmaceutical compositions

[0106] By constructing a nanobody library, the inventors discovered and expressed and purified multiple nanobodies that can bind to the MUC1 protein. All aspects of the antibodies described herein can be used to prepare drugs for preventing or treating various conditions and diseases described herein, especially diseases or conditions associated with cells expressing MUC1. In some embodiments, the conditions and diseases are cancers, including but not limited to: breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer or glioblastoma.

[0107] The pharmaceutical compositions herein contain binding molecules as described herein, and pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, preservatives and / or adjuvants. Excipients are preferably non-toxic to the recipient at the dose and concentration used. Such excipients include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are known in the prior art. The optimal pharmaceutical composition can be determined based on the expected route of administration, delivery method, and required dosage.

[0108] Pharmaceutical compositions for in vivo administration are usually provided in the form of sterile preparations. Sterilization is achieved by filtering through a sterile filtration membrane. When the composition is freeze-dried, this method can be used for sterilization before or after freeze-drying and rehydration. The pharmaceutical composition of the present invention can be selected for parenteral delivery. The composition for parenteral administration can be stored in a freeze-dried form or in a solution. For example, it is prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. Parenteral compositions are usually placed in a container with a sterile access hole, such as an intravenous solution strip or a vial with a stopper that can be pierced by a hypodermic injection needle. Alternatively, the composition can be selected for inhalation or delivery through the digestive tract (such as oral). The preparation of the pharmaceutically acceptable composition is within the technology of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing antibodies in sustained or controlled release delivery formulations. Technologies for preparing a variety of other sustained or controlled delivery methods (such as liposome carriers, bioerodible microparticles or porous beads and accumulated injections) are also known to those skilled in the art.

[0109] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal or in the form of a dehydrated or lyophilized powder. The formulation can be stored in a ready-to-use form or in a form of rehydration before administration (e.g., lyophilization). The present invention also provides a kit for producing a single-dose administration unit. The kit of the present invention can each contain a first container with a dried protein and a second container with an aqueous formulation. In certain embodiments of the present invention, a kit containing a single-chamber and multi-chamber prefilled syringe (e.g., a liquid syringe and a lyophilized syringe) is provided.

[0110] The present invention also provides a method for treating a patient (especially a patient's MUC1-related disease) by administering a binding molecule or a pharmaceutical composition thereof as described in any embodiment of the present invention. As used herein, the terms "patient," "subject," "individual," and "object" are used interchangeably herein and include any organism, preferably an animal, more preferably a mammal (e.g., rats, mice, dogs, cats, rabbits, etc.), and most preferably a human. "Treatment" refers to the use of a treatment regimen described herein to a subject to achieve at least one positive therapeutic effect (e.g., a decrease in the number of cancer cells, a decrease in tumor volume, a decrease in the rate of cancer cell infiltration into peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth). The treatment regimen that is effective in treating a patient may vary depending on a variety of factors, such as the patient's disease state, age, weight, and the ability of the therapy to stimulate an anti-cancer response in the subject.

[0111] The therapeutically effective amount of the pharmaceutical composition containing the binding molecules of the present invention that will be adopted will depend on, for example, the degree of treatment and the target. It will be appreciated by those skilled in the art that the appropriate dosage level for the treatment of will depend in part on the size (body weight, body surface or organ size) and / or condition (age and general health status) of the delivered molecule, indication, route of administration and the patient and change. In certain embodiments, the clinician can titrate the dosage and change the route of administration to obtain the best therapeutic effect. For example, about 10 micrograms / kg body weight-about 50 milligrams / kg body weight every day.

[0112] The frequency of administration will depend on the pharmacokinetic parameters of the binding molecule in the formulation used. The clinician typically administers the composition until a dose is achieved to achieve the desired effect. The composition can therefore be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implant device or catheter.

[0113] The route of administration of the pharmaceutical composition is according to known methods, for example, orally, by injection via intravenous, intraperitoneal, intracerebral (intracerebroparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional routes; by sustained release systems or by implant devices.

[0114] Diagnostics, Tests and Kits

[0115] The binding molecules of the present invention can be used in assays, such as binding assays, to detect and / or quantify MUC1 expressed in tissues or cells due to their high affinity for MUC1. Binding molecules such as single domain antibodies can be used in studies to further investigate the role of MUC1 in disease. The method for detecting MUC1 is generally as follows: obtaining a cell and / or tissue sample; detecting the level of MUC1 in the sample.

[0116] The MUC1 binding molecules of the present invention can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with MUC1. The present invention provides for detecting the presence of MUC1 in a sample using classical immunohistological methods known to those skilled in the art. Detection of MUC1 can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of MUC1 include ELISA, FACS, RIA, etc.

[0117] For diagnostic applications, binding molecules such as single domain antibodies are typically labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents. Various methods for labeling proteins are known in the art and can be used to perform the present invention.

[0118] Another aspect of the invention provides a method for detecting the presence of a test molecule that competes with the antibodies of the invention for binding to MUC1. An example of such an assay would involve detecting the amount of free antibody in a solution containing a certain amount of MUC1 in the presence or absence of the test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to MUC1) would indicate that the test molecule is able to compete with the antibody for binding to MUC1. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0119] The present invention also provides a detection kit for detecting MUC1 levels, which includes an antibody that recognizes MUC1 protein, a lysis medium for dissolving a sample, and common reagents and buffers required for detection, such as various buffers, detection markers, detection substrates, etc. The detection kit can be an in vitro diagnostic device.

[0120] The present invention will be described below in the form of specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The methods and materials used in the examples are, unless otherwise stated, materials and methods conventional in the art.

[0121] Example

[0122] Example 1, Alpaca Immunization

[0123] 1.1 Preparation of immunogens:

[0124] According to the MUC1 protein sequence queried on NCBI, it was fused with the human IgG Fc fragment sequence and commissioned to Suzhou GeneWeizhi Company to synthesize and construct a eukaryotic expression vector of the pCDNA3.4 (Thermo) plasmid. The synthesized plasmid was expressed using the EXpiCHOTM (Thermo Fisher) expression system. After expression, a 5 mL Protein A pre-packed column (GE) was used for one-step affinity purification. The purified sample was replaced into PBS buffer, and the purity was identified by SDS-PAGE electrophoresis gel and HPLC. After the activity was identified by ELISA, it was aliquoted and frozen in a -80 degree refrigerator for subsequent immunization.

[0125] 1.2 Alpaca Immunity:

[0126] The first immunization antigen (MUC1-hFc) was 1000 μg, mixed with adjuvant (GERBU FAMA), and injected subcutaneously at four points on the back of the alpaca for immunization, with a dose of 1 mL at each point. The second immunization was performed 3 weeks apart. From the 2nd to the 9th immunization: the immunization antigen was 500 μg, injected subcutaneously at four points on the back of the alpaca for immunization, with a dose of 1 mL at each point, and the interval between each immunization was one week.

[0127] 1.3 Immune serum titer detection:

[0128] 1.3.1 Protein level titer detection

[0129] MUC1-His antigen was coated overnight at 4°C, blocked and washed, and then the gradient diluted serum was added to the ELISA plate for incubation, and then anti-llama IgG HRP (Abcam) antibody was used for incubation. After washing, TMB colorimetric solution was added for color development, and the reaction was terminated with 2M HCl. Then, the absorbance at OD450 nanometers was detected with an enzyme reader. The experimental results are shown in Figure 2. Figure 1 As shown, the titer of alpaca reached a high level (>72,9000) after 5 immunizations.

[0130] Example 2: Construction and screening of nanoantibody immune library against MUC1

[0131] (1) After the five immunizations, 50 mL of peripheral blood lymphocytes were extracted from camels and total RNA was extracted. RNA extraction was performed according to the instructions of TAKARA RNAiso reagent.

[0132] (2) Using RNA as template and oligo dT as primer, synthesize the first strand of cDNA according to the instruction manual of TAKARA reverse transcriptase.

[0133] (3) Using PrimeSTAR high-fidelity DNA polymerase, nested PCR was used to obtain the variable region encoding gene of the heavy chain antibody. Nested PCR was used to amplify the variable region fragment of the heavy chain antibody:

[0134] First round of PCR:

[0135] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 48)

[0136] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 49)

[0137] The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55°C for 30 cycles; a DNA fragment of about 600 bp was recovered and used as a template for the second round of PCR.

[0138] Second round of PCR:

[0139] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 50)

[0140] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID NO: 51)

[0141] The fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long fragments and short fragments) were amplified, annealed at 55°C for 30 cycles, and the target fragment was recovered. The results showed that the size of the fragment was about 500 bp, that is, the electrophoresis band of the nanobody gene was about 500 bp.

[0142] (4) The phagemid pME207 and the PCR amplification product were double-digested with Sfi I and Not I (NEB), respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16°C overnight.

[0143] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water and electroporated to transform E. coli TG1 ten times. Take 100 μL of the bacterial solution after electroporation and culture, dilute it in multiple proportions, spread it on the ampicillin LB culture plate, calculate the reservoir capacity, and spread the rest on the ampicillin 2×YT culture plate, invert and culture at 37°C for 13 to 16 hours. Use 10 mL of 2×YT culture medium to scrape the bacterial moss on the culture plate, add glycerol at a final concentration of 25%, divide it into aliquots, and store it at -80°C for later use. The reservoir capacity is 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0144] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 r / min until OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The culture was allowed to stand at 37°C for 30 min and then incubated at 37°C, 200 r / min for 30 min. The culture was centrifuged and the precipitate was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After culturing at 37°C, 250 r / min overnight, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the solution was placed on ice for 60 min, and the solution was centrifuged at 8000 rpm for 30 min. The precipitate was resuspended in 5 mL of PBS to obtain an anti-MUC1 single domain antibody (VHH) immune library. 10 μL was taken for titer determination and the rest was aliquoted and stored at -80°C for later use.

[0145] (7) MUC1 protein was coated on the ELISA plate at 5 μg / mL, 100 μL per well, and placed at 4°C overnight. A negative control was also set up. The next day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing, 100 μL of phage (2-3×10 60 70 90 70 90 70 90 70 90 70 90 70 90 70 90 70 90 70 90 11tfu immune camel nanoantibody phage display gene library), act at room temperature for 1.5 hours, then transfer the supernatant after negative screening to the target antigen coated well and act at room temperature for 1.5 hours. Wash 12 times with PBST (PBS contains 0.05% Tween 20) to wash away the unbound phage. Use Glycine (SIGMA) to dissociate the phage that specifically binds to MUC1, and the eluted phage is neutralized with Tris (Invitrogen, 1M, PH 8.0) and then infects TG1 in the logarithmic phase. After reproduction and amplification, the next round of "adsorption-elution" is carried out. Finally, the eluted phage is infecting TG1, and IPTG (Thermo) is used to induce TG1 to express nanoantibodies, and the supernatant expressed by TG1 is taken for ELISA binding detection and blocking activity detection. The secondary antibody used for ELISA binding detection was anti-c-myc Antibody HRP (Bethyl), and the secondary antibody used for blocking Biotinylated Human B7-1 / CD80 Protein, Fc molecule (Acrobiosystem) binding detection was HRP-labeled streptavidin (Thermo). At the same time, the supernatant of TG1 expression was taken for FACS binding detection on MUC1 cells overexpressing 293T, and the primary antibody used was biotin-anti-his antibody (GenScript), and the fluorescent antibody used was PE Streptavidin (Biolegend).

[0146] (8) After sequence analysis, combined with the results of ELISA and FACS detection, 11 nanobodies with blocking activity were selected as candidate antibodies.

[0147] Example 3, Expression and purification of candidate antibodies

[0148] The nanobody was constructed into the pCDNA3.4-IgG4 vector and constructed into the VHH-IgG4 format, and then expressed by the EXpiCHOTM (Thermo Fisher) expression system. After one week of expression, the supernatant was collected for Protein A (GE) purification. The protein quality was then detected using Nanodrop and the protein purity was detected using HPLC. The purity and yield of the obtained protein met the needs of subsequent experiments.

[0149] Example 4, Characterization of Candidate Antibodies

[0150] (1) Protein level ELISA test:

[0151] Use enzyme-linked immunosorbent assay (ELISA) to measure the affinity of the antibody for the human MUC1-His antigen. Dilute the MUC1 antigen to 2 μg / mL with coating solution, add 100 μL / well to a 96-well plate, and incubate at 37°C for 2 hours. Wash 3 times. After washing, add 100 μL of 3% BSA blocking solution to each well and incubate at 37°C for 2 hours. Wash 3 times. Add 100 μL / well MUC1 antibody, the starting concentration of the antibody dilution is 4 μg / mL, 8 gradients of 4-fold dilution, and incubate at 37°C for 1 hour. Wash each plate 3 times. Add 100 μL of enzyme-labeled secondary antibody to each well and incubate for 30 minutes. Wash 3 times. Add 100 μL of TMB to each well and color for 5 minutes. Add 100 μL of hydrochloric acid stop solution to each well to terminate the reaction, and read the plate at a wavelength of 450 nm. The test results are as follows Figure 2 As shown, the MUC1 antibody has good binding activity with the MUC1 antigen, and the EC50 is less than 1 nM as shown in the fitting curve.

[0152] (2) Protein level affinity detection:

[0153] The binding kinetics and affinity of the antibody to the human MUC1-His antigen were determined using surface plasmon resonance (SPR). The purified antibody was passed through a sensor chip pre-fixed with protein A, and the antibody was captured by protein A. Then, 5 different concentrations of MUC1.his protein were used as the mobile phase, and the binding time and dissociation time were 30 min and 60 min, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd), and equilibrium constant (KD). BMK1 is an IgG4 antibody in the form of scFv (VH-VL) prepared according to the antibody sequences SEQ ID NO: 73 and SEQ ID NO: 75 in the US 2016 / 0340442 A1 patent of GENUS oncology, and BMK2 is an IgG4 antibody in the form of scFv (VH-VL) prepared according to the sequences SEQ ID NO: 24 and SEQ ID NO: 25 in the US20200024361A1 patent of Peptron. The amino acid sequences of the candidate antibodies are shown in Table 4, and the CDR sequences of the candidate antibodies are shown in Table 5. The protein level affinity test results are shown in Table 2 below, and the binding kinetic curves are shown in Figure 3 .

[0154] Table 2. Affinity test results of different antibodies

[0155]

[0156] (3) Cell-level binding activity detection

[0157] MB468 tumor cells expressing MUC1 protein were plated in 96-well plates, with 3×10 5 Cells, and then the gradient diluted candidate antibodies were incubated with MB468 cells at 2-8°C; after half an hour, they were washed and incubated with the detection antibody anti-human IgGPE (Jackson Immuno Research, Code: 109-117-008), and then detected using CytoFLEX flow cytometer. Isotype is the isotype control (negative control, the sequence is derived from SEQ ID NO: 2 of patent CN 106146653A). The results of the candidate antibodies are shown in Figure 4 As shown, from Figure 4 It can be seen that the candidate antibodies have high, medium and low binding activities to tumor cells MB468. Among them, NBL502-1-C4, NBL502-EFP-B02, NBL502-EFP-B03, NBL502-1D2-2, and NBL502-AI-201 have higher binding activities to tumor cells MB468, and the positive rates are all greater than 90%. The binding activities of NBL502-1-A2, NBL502-AI-120, NBL502-AI-121, NBL502-AI-181, and NBL502-A12-6-LST-D5-2 to tumor cells MB468 are relatively weak, and the positive rates are between 45% and 90%. NBL502-AI212 has the weakest binding activity to tumor cells MB468.

[0158] Example 5, VHH antibody specificity verification

[0159] 1) Tissue cross-reactivity

[0160] 34 tissues were selected for frozen sections, dried at room temperature and fixed with acetone. The samples were blocked with reagents A and B of the endogenous biotin blocking kit (Sangong, E674001), incubated with biotin-labeled antibody samples for 30 minutes, washed, and incubated with horseradish peroxidase-labeled streptavidin (Abcam, ab7403) for 15 minutes. DAB was used for color development and hematoxylin counterstaining, and the slides were sealed with neutral plastic and air-dried for microscopic examination. The two positive controls were Anti-MUC1 antibody [SM3] (ab22711 from Abcam) and BMK2, and the negative control was IgG4 isotype control.

[0161] The test results are shown in Table 3, which show that: in all 34 tissues tested, the level of tissue binding of the candidate antibody is no higher than that of the positive controls SM3 and BMK2. The MUC1 candidate antibody has no obvious strong binding to normal tissues, and the results are negative or no obvious binding in a variety of key tissues such as lungs, kidneys, pancreas, stomach, brain, etc. These data indicate that the candidate antibody has good tissue safety.

[0162] Table 3. Summary of the results of cross-reactivity tests on 34 human tissues

[0163]

[0164]

[0165]

[0166] Example 6, sequence summary

[0167] Table 4. Summary of antibody sequences

[0168]

[0169]

[0170] Table 5. Summary of antibody CDR sequences

[0171] SEQUENCE LISTING <110> Zhejiang Nano-Antibody Technology Center Co., Ltd. <120> MUC1 binding molecules and their applications <130> 220699 <160> 51 <170> PatentIn version 3.5 <210> 1 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <220> <221> MISC_FEATURE <222> (2) <223> Xaa is Pro, Phe, Leu, Ala, or Arg <220> <221> MISC_FEATURE <222> (3)..(3) <223> Xaa is His, Thr, Ser, or Phe <220> <221> MISC_FEATURE <222> (4)..(4) <223> Xaa is Leu, Phe, Ser, Gly, Thr, or Ala <220> <221> MISC_FEATURE <222> (5)..(5) <223> Xaa is Glu, Arg, Asp, Leu, Asn <220> <221> MISC_FEATURE <222> (6)..(6) <223> Xaa is Leu, Arg, Tyr, Asn, Asp, Gln, Ile, or Glu <220> <221> MISC_FEATURE <222> (7)..(7) <223> Xaa is Tyr, His, Leu, Glu, or Ile <220> <221> MISC_FEATURE <222> (8)..(8) <223> Xaa is Ala, Tyr, Asp, Met, Glu, or Thr <220> <221> MISC_FEATURE <222> (9)..(9) <223> Xaa is Tyr, Glu, or null <220> <221> MISC_FEATURE <222> (10)..(10) <223> Xaa is Tyr, or null <220> <221> MISC_FEATURES <222> (11)..(11) <223> A stone is Asn, or null. <400> 1 Gly Influorescence Influorescence Influorescence 1 5 10 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <220> <221> MISC_FEATURES <222> (2)…(2) <223> Stone is Ser, Asn, or Arg <220> <221> MISC_FEATURES <222> (3)…(3) <223> Stone is Glu, Thr, Gly, Arg, or Trp <220> <221> MISC_FEATURES <222> (4)..(4) <223> When either Ser, Asn, Arg, Ile, Phe, or Tyr <220> <221> MISC_FEATURES <222> (5)…(5) <223> Stone is Gly, Asp, or Asn <220> <221> MISC_FEATURES <222> (6)…(6) <223> A stone is Asp, Gly, Ser, Ala, Glu, Thr, or null. <220> <221> MISC_FEATURE <222> (7)..(7) <223> Xaa is Asp, Thr, Ser, Arg, Pro, Leu, Trp, or null <220> <221> MISC_FEATURE <222> (8)..(8) <223> Xaa is Thr, Ile, or null <400> 2 Ile Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 <210> 3 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <220> <221> MISC_FEATURE <222> (1)..(1) <223> Xaa is Ala, Thr, or Asn <220> <221> MISC_FEATURE <222> (2)..(2) <223> Xaa is Ala, or Thr <220> <221> MISC_FEATURE <222> (3)..(3) <223> Xaa is Cys, Ile, Glu, Gly, or Val <220> <221> MISC_FEATURE <222> (4)..(4) <223> Xaa is Thr, Gly, Arg, Val, or Asp <220> <221> MISC_FEATURE <222> (5)..(5) <223> Xaa is Phe, Tyr, Thr, Ile, Ala, Asn, or Pro <220> <221> MISC_FEATURE <222> (6)..(6) <223> Xaa is Tyr, Pro, Arg, Gly, Leu, or Ala <220> <221> MISC_FEATURE <222> (7)..(7) <223> Xaa is Gly, Ser, Phe, Arg, Leu, or His <220> <221> MISC_FEATURE <222> (8)..(8) <223> Xaa is Ser, Gln, Ile, Thr, Trp, Lys, or Tyr <220> <221> MISC_FEATURE <222> (9)..(9) <223> Xaa is Thr, Leu, Phe, Pro, Ser, or null <220> <221> MISC_FEATURE <222> (10)..(10) <223> Xaa is Phe, Ser, Gly, Cys, Thr, or null <220> <221> MISC_FEATURE <222> (11)..(11) <223> Xaa is Arg, Tyr, Thr, Leu, Ser, Cys, or null <220> <221> MISC_FEATURE <222> (12)..(12) <223> Xaa is Glu, Asp, Cys, Phe, Tyr, or null <220> <221> MISC_FEATURE <222> (13)..(13) <223> Xaa is Met, Tyr, Val, Leu, or null <220> <221> MISC_FEATURE <222> (14)..(14) <223> Xaa is Gly, Pro, His, Ala, Thr, or null <220> <221> MISC_FEATURE <222> (15)..(15) <223> Xaa is Tyr, Ser, Gln, Arg, Trp, Val, or null <220> <221> MISC_FEATURE <222> (16)..(16) <223> Xaa is Asn, Arg, Thr, Met, Pro, or null <220> <221> MISC_FEATURE <222> (17)..(17) <223> Xaa is Phe, Glu, Ala, Gln, or null <220> <221> MISC_FEATURE <222> (18)..(18) <223> Xaa is Ala, Gly, Tyr, or null <220> <221> MISC_FEATURE <222> (19)..(19) <223> Xaa is Ser, Asp, Arg, or null <220> <221> MISC_FEATURES <222> (20)..(20) <223> Stone is Tyr, or null <400> 3 Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes 1 5 10 15 Blood Blood Blood Blood! 20 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 4 Gly Pro His Leu Glu Leu Tyr Ala 1 5 <210> 5 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 5 Gly Phe Thr Phe Arg Arg Tyr Tyr 1 5 <210> 6 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 6 Gly Phe Thr Leu Asp Tyr Tyr Ala 1 5 <210> 7 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 7 Gly Leu Thr Ser Asp Asn His Ala 1 5 <210> 8 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 8 Gly Phe Ser Gly Leu Asp Leu Asp Tyr Tyr Asn 1 5 10 <210> 9 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 9 Gly Ala Phe Thr Leu Gln Glu Met Glu 1 5 <210> 10 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 10 Gly Phe Thr Leu Asp Gln Ile Glu 1 5 <210> 11 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 11 Gly Leu Thr Ser Asp Asn Tyr Ala 1 5 <210> 12 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 12 Gly Arg Thr Ala Asn Ile Tyr Thr 1 5 <210> 13 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR1 <400> 13 Gly Phe Thr Leu Asp Glu Ile Glu 1 5 <210> 14 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 14 Ile Ser Glu Ser Gly 1 5 <210> 15 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 15 Ile Asn Thr Asn Gly Asp Asp Thr 1 5 <210> 16 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 16 Ile Asn Gly Arg Gly Gly Thr Thr 1 5 <210> 17 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 17 Ile Asn Thr Ile Asp Ser Ser Thr 1 5 <210> 18 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 18 Ile Ser Arg Ile Asn Gly Arg Thr 1 5 <210> 19 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 19 Ile Ser Arg Arg Asp Ala Thr 1 5 <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 20 Ile Ser Arg Phe Asp Glu Thr 1 5 <210> 21 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 21 Ile Ser Arg Arg Gly Thr Pro Ile 1 5 <210> 22 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 22 Ile Asn Thr Arg Asp Gly Leu Ile 1 5 <210> 23 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 23 Ile Arg Trp Ser Gly Gly Trp Thr 1 5 <210> 24 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> CDR2 <400> 24 Ile Ser Arg Tyr Asp Ala Thr 1 5 <210> 25 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 25 Ala Ala Cys Thr Phe Tyr Gly Ser Thr Phe Arg Glu Met Gly Tyr 1 5 10 15 <210> 26 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 26 Thr Ala Ile Gly Tyr Tyr Ser Gln Leu Ser Tyr Asp Tyr 1 5 10 <210> 27 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 27 Ala Ala Glu Arg Thr Pro Phe Ile Phe Gly Thr Cys Val Pro Tyr Asn 1 5 10 15 Phe Ala Ser <210> 28 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 28 Ala Ala Glu Arg Ile Arg Phe Thr Leu Ser Leu Cys Val Pro Tyr Asn 1 5 10 15 Phe Gly Ser <210> 29 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 29 Ala Thr Gly Gly Ala Gly Arg Trp Pro Cys Ser Asp Leu His Ser Arg 1 5 10 15 Glu Tyr Asp Tyr 20 <210> 30 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 30 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Phe Leu Gly Gln Thr 1 5 10 15 Ala Tyr Arg Tyr 20 <210> 31 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 31 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Gly Arg Thr 1 5 10 15 Ala Tyr Arg Tyr 20 <210> 32 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 32 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Ala Gln Met 1 5 10 15 Gln Tyr Arg Tyr 20 <210> 33 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 33 Ala Ala Glu Arg Ile Ala Leu Ser Leu Ser Leu Cys Val Pro Trp Asn 1 5 10 15 Phe Ala Ser <210> 34 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 34 Asn Ala Val Asp Pro Ala His Tyr 1 5 <210> 35 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> CDR3 <400> 35 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Thr Val Pro 1 5 10 15 Ala Tyr Arg Tyr 20 <210> 36 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 36 Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Pro His Leu Glu Leu Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Glu Ser Gly Ala Tyr Val Glu Gly Val Lys Gly Arg 50 55 60 Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn Thr Val Tyr Leu Gln Met 65 70 75 80 Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala Cys 85 90 95 Thr Phe Tyr Gly Ser Thr Phe Arg Glu Met Gly Tyr Arg Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 37 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 37 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val 35 40 45 Ser Gly Ile Asn Thr Asn Gly Asp Asp Thr Arg Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Leu Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Thr Ala Ile Gly Tyr Tyr Ser Gln Leu Ser Tyr Asp Tyr Arg Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 38 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 38 Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Thr Leu Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Val Cys Ile Asn Gly Arg Gly Gly Thr Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Glu Arg Thr Pro Phe Ile Phe Gly Thr Cys Val Pro Tyr Asn Phe Ala 100 105 110 Ser Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 39 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 39 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Leu Thr Ser Asp Asn His 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Pro Glu Arg Val 35 40 45 Ser Cys Ile Asn Thr Ile Asp Ser Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Thr Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Glu Arg Ile Arg Phe Thr Leu Ser Leu Cys Val Pro Tyr Asn Phe Gly 100 105 110 Ser Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 40 <211> 130 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 40 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Gly Leu Asp Leu 20 25 30 Asp Tyr Tyr Asn Gln Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg 35 40 45 Glu Val Val Ser Cys Ile Ser Arg Ile Asn Gly Arg Thr Trp Tyr Arg 50 55 60 Asp Ser Val Lys Gly Arg Phe Ala Ile Ser Arg Asp Asn Ala Lys Asn 65 70 75 80 Thr Val Phe Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Thr Gly Gly Ala Gly Arg Trp Pro Cys Ser Asp Leu 100 105 110 His Ser Arg Glu Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 115 120 125 Ser Ser 130 <210> 41 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 41 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Phe Thr Leu Gln Glu 20 25 30 Met Glu Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly 35 40 45 Ile Ser Cys Ile Ser Arg Arg Asp Ala Thr Ile Tyr Asp Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Phe Leu Gly Gln Thr 100 105 110 Ala Tyr Arg Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 42 <211> 126 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 42 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Gln Ile 20 25 30 Glu Ile Gly Trp Phe Arg Gln Ala Pro Gly Gln Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Arg Phe Asp Glu Thr Ile Tyr Asp Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Leu Ser Lys Asp Ile Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Gly Arg Thr Ala 100 105 110 Tyr Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 43 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 43 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Gln Ile 20 25 30 Glu Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Arg Arg Gly Thr Pro Ile Leu Tyr Asp Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn Ala Lys Ser Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Ala Gln Met 100 105 110 Gln Tyr Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 44 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 44 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Ala Arg Leu Ser Cys Thr Ala Ser Gly Leu Thr Ser Asp Asn Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Pro Glu Arg Val 35 40 45 Ser Cys Ile Asn Thr Arg Asp Gly Leu Ile Asp Val Ala Asp Ser Ala 50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Glu Arg Ile Ala Leu Ser Leu Ser Leu Cys Val Pro Trp Asn Phe Ala 100 105 110 Ser Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 45 <211> 115 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 45 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys Thr Ala Ser Gly Arg Thr Ala Asn Ile Tyr 20 25 30 Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Arg Ile Arg Trp Ser Gly Gly Trp Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Ala Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Gln Pro Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ala Val Asp Pro Ala His Tyr Trp Gly Gln Gly Thr Gln Val Thr 100 105 110 Val Ser Ser 115 <210> 46 <211> 126 <212> PRT <213> Artificial Sequence <220> <223> VHH <400> 46 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Glu Ile 20 25 30 Glu Ile Gly Trp Phe Arg Gln Gly Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Arg Tyr Asp Ala Thr Ile Tyr Asp Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Lys Asp Arg Thr Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Thr Leu Lys Pro Gln Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Val Val Asn Leu Phe Lys Ser Thr Cys Tyr Leu Thr Val Pro Ala 100 105 110 Tyr Arg Tyr Trp Gly Gln Gly Ile Gln Val Thr Val Ser Ser 115 120 125 <210> 47 <211> 229 <212> PRT <213> Artificial Sequence <220> <223> CH <400> 47 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 1 5 10 15 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 210 215 220 Read Be Read Gly Lys 225 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> first <400> 48 gtcctggctg ctcttctaca aggc 24 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> first <400> 49 ggtacgtgct gttgaactgt tcc 23 <210> 50 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> first <400> 50 gatgtgcagc tgcaggagtc tggrggagg 29 <210> 51 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> first <400> 51 ggactagtgc ggccgctgga gacggtgacc tgggt 35

Claims

1. A MUC1 binding molecule, comprising an anti-MUC1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein the sequence of CDR1 is shown in SEQ ID NO:5, the sequence of CDR2 is shown in SEQ ID NO:15, and the sequence of CDR3 is shown in SEQ ID NO:

26.

2. The MUC1 binding molecule according to claim 1, wherein The single domain antibody VHH is as shown in SEQ ID NO: 37, and / or The MUCl binding molecule is a monovalent or multivalent single domain antibody or heavy chain antibody comprising one or more of the single domain antibodies.

3. A polynucleotide, characterized in that The polynucleotide is selected from: (1) The coding sequence of the MUC1 binding molecule according to any one of claims 1 to 2; (2) The complementary sequence of (1).

4. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide of claim 3.

5. The nucleic acid construct according to claim 4, wherein The nucleic acid construct is a recombinant vector.

6. The nucleic acid construct according to claim 4, wherein The nucleic acid construct is an expression vector.

7. A bacteriophage comprising the MUCl binding molecule of any one of claims 1-2.

8. The bacteriophage according to claim 7, characterized in that The MUCl binding molecule is displayed on the surface of the bacteriophage.

9. A host cell, characterized in that The host cell: (1) expressing the MUC1 binding molecule according to any one of claims 1 to 2; and / or (2) comprising the polynucleotide according to claim 3; and / or (3) A nucleic acid construct comprising any one of claims 4 to 6.

10. A method for producing a MUCl binding molecule, comprising: The host cell of claim 9 is cultured under conditions suitable for producing the MUCl binding molecule.

11. The method according to claim 10, characterized in that The method further includes purifying the MUCl binding molecule from the culture.

12. A kit for detecting MUC1, said kit comprising the MUC1 binding molecule according to any one of claims 1-2.

13. The kit according to claim 12, characterized in that The kit also includes reagents for detecting binding of MUCl to a MUCl binding molecule.

14. The kit according to claim 12, wherein The reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

15. A non-diagnostic method for detecting the presence of MUC1 in a sample, the method comprising: The MUC1 binding molecule of any one of claims 1 to 2 is incubated with a sample, and the binding of MUC1 to the MUC1 binding molecule is detected, thereby determining the presence of MUC1 in the sample.

16. Use of the MUCl binding molecule of any one of claims 1-2 in the preparation of a kit for detecting MUCl in a sample.

Images