Identification and application of a new reporter gene hbpR

Abstract

The present invention relates to the technical field of reporter gene identification, and in particular to the identification of a visualized red protein encoding gene hbpR and its application. The inventor discovered a red protein HbpR in Mycobacterium smegmatis, which can bind to heme and appear red, and can be directly observed with the naked eye, with obvious visualization. The inventor successfully identified that the red protein encoding gene hbpR has the function of a reporter gene and constructed an hbpR reporter system, which can efficiently detect the promoter strength of the promoter. The reporter system reduces the operating steps in practical applications and reduces the experimental cost, retains the advantages of the original lacZ and gfp reporter systems and improves their shortcomings at the same time. The reporter system has the advantages of small reporter gene molecular weight, flexible operation, convenience and efficiency, low cost, etc., and has broad application prospects.

Description

[Technical field]

[0001] The present invention relates to the technical field of reporter genes, and in particular to the construction and application of a reporter system for visualizing a red protein encoding gene hbpR. [Background technology]

[0002] Reporter gene analysis is a very valuable tool in biomedical and pharmaceutical research for monitoring cellular events related to gene expression, regulation, and signal transduction. Based on the changes in reporter gene activity mediated by linking response elements to these reporter genes, a sensitive, reliable, and convenient assay can be provided to effectively report the activation of specific messenger cascades and their effects on gene expression and regulation in cells or living organisms. Reporter genes have the following characteristics: (1) the sequence is known; (2) there are no analogs in cells; (3) the detection is fast, simple, and highly sensitive; (4) the expression of genes can be dynamically observed; (5) it does not affect the physiological activity of the host, etc. Currently, commonly used reporter genes include chloramphenicol acetyltransferase (CAT), alkaline phosphatase (AP), β-galactosidase (β-gal), green fluorescent protein (GFP), luciferase, etc. Common reporter gene systems have the following characteristics: ① Chloramphenicol acetyltransferase has the advantages of no endogenous activity and stability, but it relies on radiochemicals; the linear range and sensitivity of the assay are not as good as other reporter genes; ② Alkaline phosphatase has the advantages of a variety of analytical methods, high sensitivity, and linear range, but most cells have endogenous activity; ③ β-galactosidase has the advantages of distinctive characteristics, stability, simple colorimetric readout, and providing sensitive bio- or chemiluminescent analysis, but it requires the presence of substrate ONPG / X-Gal, the fragment is about 3kb, which increases the vector burden, and there is endogenous activity in mammalian cells; ④ Green fluorescent protein has the advantages of autofluorescence (no substrate required), no endogenous activity, and mutants with altered spectral quality are available, but it requires post-translational modification; low sensitivity; and the defect of fluorescence quenching; ⑤ Luciferase has the advantages of high sensitivity; no endogenous activity; wide dynamic range; and convenient analysis, but it requires the presence of substrate (luciferin) and the defects of O2 and ATP. Therefore, in order to expand the application scope of reporter genes, continuously discovering new reporter genes and constructing new reporter systems are the current research focuses in this field. The present invention identifies a new reporter gene hbpR and successfully constructs a reporter system based on hbpR, which is more convenient, efficient and low-cost than existing reporter systems. [Summary of the invention]

[0003] In view of the above, the inventors have identified a more convenient and efficient reporter gene, the red protein expressed by which can be directly observed with the naked eye and is clearly visualized; it provides a faster and more convenient technical means for gene transcription regulation research and promoter screening.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is:

[0005] The reporter gene hbpR encodes a visualized red protein, and the nucleotide sequence of the reporter gene hbpR is shown in the sequence listing SEQ ID NO: 1.

[0006] The present invention also includes a reporter system comprising the reporter gene hbpR, wherein the reporter system comprises a recombinant plasmid pET28EXba-hbpR, and the nucleic acid sequence of the recombinant plasmid pET28EXba-hbpR is shown in Table SEQ ID NO:4.

[0007] The present invention also includes a method for constructing a reporter system comprising the reporter gene hbpR, the method comprising the following steps:

[0008] (1) Using Mycobacterium smegmatis as a template, a primer pair hbpR-EcoRI-F / hbpR-XbaI-R was designed to amplify the hbpR gene fragment, wherein the nucleic acid sequence of the hbpR gene is shown in SEQ ID NO:1 in the sequence listing; the nucleic acid sequence of the hbpR-EcoRI-F is shown in SEQ ID NO:2 in the sequence listing; and the nucleic acid sequence of the hbpR-XbaI-R is shown in SEQ ID NO:3 in the sequence listing;

[0009] (2) detecting by agarose gel electrophoresis, and recovering the fragments from step (1) after the fragment size and concentration meet expectations;

[0010] (3) The pET28EXba vector digested with EcoRI and XbaI was ligated with the fragment recovered in step (2) to obtain a recombinant plasmid pET28EXba-hbpR; the nucleic acid sequence of the recombinant plasmid pET28EXba-hbpR is shown in Table SEQ ID NO:4;

[0011] (4) Designing a pair of reverse amplification primers on both sides of the original inducible promoter T7-lac of the pET28EXba-hbpR recombinant plasmid in step (3): cm1-hbpR-F-NheI / cm1-hbpR-R-HindIII, performing reverse amplification using the pET28EXba-hbpR recombinant plasmid as a template, recovering the amplified fragment, and digesting it with restriction endonucleases HindIII and NheI to obtain a linearized vector containing a reporter gene, which is named pET28EXba-hbpR (HindIII / NheI); the nucleic acid sequence of the cm1-hbpR-F-NheI is shown in the sequence listing SEQ ID NO: 5; the nucleic acid sequence of the cm1-hbpR-R-HindIII is shown in the sequence listing SEQ ID NO: 6.

[0012] The present invention also includes the application of the reporter system in detecting the promotion activities of different promoters.

[0013] Furthermore, the promoter is a commonly used promoter in the Escherichia coli expression system.

[0014] The present invention also includes a method for evaluating the promotion activity of different promoters using the reporter system, the method comprising the following steps:

[0015] (1) Select promoters of different strengths and design primers containing HindIII and NheI restriction sites;

[0016] (2) Annealing to obtain a promoter fragment containing HindIII and NheI restriction sites, connecting the promoter fragment with pET28EXba-hbpR (HindIII / NheI) and transforming it into the Escherichia coli BL21 (DE3) strain, and obtaining recombinant strains with different promoters after successful verification;

[0017] (3) Inoculate equal amounts of the bacterial suspension of the recombinant strain into the culture medium. After culturing for the same period of time, compare and determine the strength of the promoter by visual inspection or by quantitative detection of red protein.

[0018] Furthermore, the promoters of different strengths in step (1) are: trc , P lacUV5 , P T7 , P trp , P tac , P BAD , P lac and P L ; The promoter P trc The primer pair is shown in the sequence listing SEQ ID NO: 7 and SEQ ID NO: 8; the promoter P lacUV5 The primer pair is shown in the sequence listing SEQ ID NO: 9 and SEQ ID NO: 10; the promoter P T7 The primer pair is shown in the sequence listing SEQ ID NO: 11 and SEQ ID NO: 12; the promoter P trp The primer pairs are shown in the sequence listing

[0019] As shown in SEQ ID NO: 13 and SEQ ID NO: 14; the promoter P tac The primer pair is shown in the sequence listing SEQ ID NO: 15 and

[0020] As shown in SEQ ID NO: 16; the promoter P BAD The primer pair is shown in the sequence listing SEQ ID NO: 17 and SEQ ID NO: 18; the promoter Plac The primer pair is shown in the sequence listing SEQ ID NO: 19 and SEQ ID NO: 20; the promoter P L The primer pair is shown in the sequence listing as SEQ ID NO:21 and SEQ ID NO:22.

[0021] Furthermore, the method of visual determination in step (3) is: after culturing for the same period of time, the color of the bacterial solution or cells of different recombinant strains is observed by the naked eye; the more obvious the red color of the bacterial solution or cells, the stronger the promoter activity; the less obvious the red color, the weaker the promoter activity.

[0022] Furthermore, the quantitative detection method of step (3) is: after culturing for the same period of time, the bacteria are lysed and the OD of the supernatant is measured. 410 (Characteristic absorption peak of HbpR protein) absorbance value, the higher the value, the more red protein content, indicating that the promoter activity is stronger; the lower the absorbance value, the less red protein content, indicating that the promoter activity is weaker.

[0023] Furthermore, the method for preparing the lysis solution for lysing the bacteria is to prepare 5M urea and 10mg / ml lysozyme in a volume ratio of 9:1, mix well, and use it immediately after preparation.

[0024] The present invention has the following beneficial effects:

[0025] The inventors have discovered a red protein HbpR in Mycobacterium smegmatis. This protein can bind to heme and make it appear red. At the same time, this red protein can be directly observed with the naked eye, and the visualization is obvious. The inventors have successfully verified that the red protein encoding gene hbpR has the function of a reporter gene. The expression level of the reporter gene can be preliminarily judged by naked eye observation, and its specific results can also be quickly detected by ultraviolet spectrophotometer or microplate reader. The reporter system was verified using promoters of different strengths, and it was found that the reporter system can effectively evaluate the promoter's activation activity. The reporter system retains the advantages of the original lacZ and gfp reporter systems, and at the same time improves their shortcomings. The reporter system has the advantages of small reporter gene molecular weight, flexible operation, convenience and efficiency, low cost, etc., and has broad application prospects.

Brief Description of the Drawings

[0026] Figure 1 This is a PCR verification diagram of the pET28EXba-hbpR recombinant plasmid. In the figure, M is the DL2000 marker; lanes 1-3 are respectively the pET28EXba-hbpR recombinant plasmid as template and the Mycobacterium smegmatis genome as template (CK + ), using water as template (CK -), the product obtained by amplification using specific primers of the hbpR gene (SEQ ID NO: 2 and SEQ ID NO: 3).

[0027] Figure 2 This is a PCR verification diagram of recombinant plasmids with promoters of different strengths. In the figure, M is DL2000 marker; lanes 1-8 are promoters of 8 different strengths, respectively. trc , P lacUV5 , P T7 , P trp , P tac , P BAD , P lac and P L Lane 9 is the PCR verification diagram of the recombinant plasmid; Lane 9 is the verification diagram of the irrelevant control; Lane 10 is the verification diagram of the blank control.

[0028] Figure 3 This is a bacterial culture picture of recombinant strains with different promoter strengths.

[0029] Figure 4 Figure 2 shows the bacterial cells before lysis (a) and the supernatant after lysis (b) of recombinant strains with different promoter strengths.

[0030] Figure 5 The growth curves of recombinant strains with different promoter strengths (OD 600 ) (left) and the OD of the supernatant after lysis 410 Absorbance curve (right). [Specific implementation method]

[0031] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0032] The inventors have discovered a red protein HbpR in Mycobacterium smegmatis. This protein can bind to heme and make it appear red. At the same time, this red protein can be directly observed with the naked eye, and the visualization is obvious. The inventors have successfully verified that the red protein encoding gene hbpR has the function of a reporter gene. The expression level of the reporter gene can be preliminarily judged by naked eye observation, and its specific results can also be quickly detected by ultraviolet spectrophotometer or microplate reader. The present invention reduces the operating steps and experimental costs of the promoter reporter system in practical applications, retains the advantages of the original lacZ and gfp reporter systems and improves their shortcomings at the same time. The reporter system has the advantages of small reporter gene molecular weight, flexible operation, convenience and efficiency, low cost, etc., and has a wide range of application prospects.

[0033] Embodiment 1:

[0034] The visualized red protein is encoded by the reporter gene hbpR, and the nucleic acid sequence of the gene hbpR is shown in the sequence listing SEQ ID NO: 1.

[0035] Cloning of gene hbpR and construction of recombinant strain

[0036] (1) Amplification of hbpR gene

[0037] Using the Mycobacterium smegmatis genome as a template and hbpR-EcoRI-F / hbpR-XbaI-R designed by SnapGene software as primers, the hbpR gene fragment was amplified. The sequence of the fragment is shown in SEQ ID NO: 1:

[0038] Table 1 Primers for amplification of hbpR gene

[0039] Primer name Primer sequence 5'-3' Sequence Listing hbpR-EcoRI-F ATGCGAATTCACGTGACCGAGACACCAACCGC SEQ ID NO:2 hbpR-XbaI-R GTATTCTAGATCAGGACAGCCCTGCGCGCA SEQ ID NO:3

[0040] (2) Construction of recombinant plasmid pET28EXba-hbpR

[0041] Agarose gel electrophoresis was used for detection. When the fragment size and concentration were in line with expectations, the fragment was purified using a DNA purification kit. The purified fragment was digested with the corresponding restriction endonuclease at 37°C for 4 hours, and then the corresponding digested fragment was purified using a DNA recovery kit. The restriction endonucleases for the hbpR fragment were EcoRI and XbaI.

[0042] The recovered hbpR fragment was connected to the pET28EXba vector cut with EcoRI and XbaI, and the connection was carried out at 16°C overnight. The enzyme-linked product was then transformed into DH5α competent cells. The cells were cultured at 37°C for 1 day. The transformants were picked on the second day, and the plasmids were extracted after activation. The recombinant plasmids were verified by PCR ( Figure 1), confirm that the hbpR fragment was successfully connected, and purify and clone the correct recombinant plasmid, named pET28EXba-hbpR, wherein the gene sequence of the vector is shown in SEQ ID NO:4.

[0043] (3) Reverse amplification of recombinant plasmid pET28EXba-hbpR

[0044] SnapGene software was used to design reverse amplification primers on both sides of the original inducible promoter T7-lac of the pET28EXba-hbpR recombinant plasmid: cm1-hbpR-F-NheI / cm1-hbpR-R-HindIII, and pET28EXba-hbpR was used as a template for reverse amplification. Agarose gel electrophoresis was used to detect the fragment size and concentration as expected, and then purified with a DNA purification kit. The purified fragments were digested with the corresponding restriction endonucleases at 37°C for 6h, and then the corresponding digested fragments were purified with a DNA recovery kit. Among them, the restriction endonucleases of the reverse amplification fragments are HindIII and NheI. At this point, the construction of the vector containing the reporter gene was completed and named pET28EXba-hbpR (HindIII / NheI).

[0045] Table 2 Reverse amplification primers of pET28EXba-hbpR vector

[0046]

[0047]

[0048] Embodiment 2:

[0049] Qualitative detection experiment of promoter strength

[0050] Eight promoters with different strengths commonly used in E. coli expression systems were selected. trc , P lacUV5 , P T7 , P trp , P tac , P BAD , P lac and P L , used to detect the reporter system, designed primers containing HindIII and NheI restriction sites (sequences are shown in Table 3), and obtained the promoter fragment through annealing procedure. The promoter fragment (HindIII / NheI) was connected with the pET28EXba-hbpR (HindIII / NheI) vector after restriction digestion and transformed into Escherichia coli BL21 (DE3) competent cells, and then the plasmid was extracted for PCR verification ( Figure 2 ) to determine whether the construction of recombinant strains with different promoter strengths is successful. Figure 2 It can be seen that lanes 1-8 all have amplified products between 500-700 bp, while lanes 9-10 have no amplified products, indicating that the recombinant strains with different promoters were successfully constructed.

[0051] Table 3P trc , P lacUV5 , P T7 , P trp , P tac , P BAD , P lac and P L Amplification primers

[0052]

[0053] 100 μL of the glycerol suspension of the recombinant strain was inoculated into 5 mL of LB medium supplemented with 30 μg / mL kanamycin, and activated and cultured at 37°C and 160 rpm / min for 10 h. Then, the cells were collected by centrifugation at 6000 rpm / min for 5 min, resuspended in the culture medium, and inoculated into 100 mL of the culture medium, and the OD was maintained at 1. 600 =0.1, and cultured at 37°C, 160 rpm / min in a shaking incubator for 18 h. The differences in the color of the bacterial liquid and the color of the bacterial cells of the recombinant strains with different promoter strengths, as well as the color of the supernatant after lysis were observed.

[0054] The results are as follows Figure 3 and Figure 4 As shown in the figure, it can be seen that the color of the bacterial solution and cells of the recombinant strains with different promoters is significantly different. As the promoter activity increases, the red color of the bacterial solution and cells becomes more and more obvious. This shows that the reporter system constructed based on hbpR can be used to conveniently evaluate strong and weak promoters.

[0055] Embodiment 3:

[0056] Promoter strength quantitative detection experiment

[0057] Select P trc , P lacUV5 , P T7 , P trp , P tac , P BAD , P lac and P L For 8 promoters with different strengths, primers containing HindIII and NheI restriction sites were designed (sequences are shown in Table 3), and promoter fragments were obtained through annealing procedures. The promoter fragment (HindIII / NheI) was connected and transformed with the pET28EXba-hbpR (HindIII / NheI) vector after restriction digestion, and then the plasmid was extracted for PCR verification to confirm that the recombinant strains with different promoter strengths were successfully constructed.

[0058] 100 μL of the glycerol suspension of the recombinant strain was inoculated into 5 mL of LB medium supplemented with 30 μg / mL kanamycin, and activated and cultured at 37°C and 160 rpm / min for 10 h. The cells were collected by centrifugation at 6000 rpm / min for 5 min, resuspended in the culture medium, and inoculated into 100 mL of the culture medium. The OD 600 =0.1, three sets of parallel were set for each sample;

[0059] The strain was cultured in a shaking incubator at 37°C and 160 rpm / min for 24 h. Samples were taken every 2 h to measure the OD of the bacterial solution. 600 At the same time, take 3.5mL of bacterial solution and centrifuge at 8000rpm / min for 1min and collect it in a 1.5mL centrifuge tube, discard the supernatant, and carefully absorb the remaining liquid for cell lysis. Among them, the preparation method of cell lysis solution: prepare 5M urea and 10mg / ml lysozyme according to the volume ratio of 9:1, mix thoroughly, and use it now. (5M urea: dissolve 300.3g urea in deionized water and make up to 1L; 10mg / mL lysozyme: dissolve 100mg lysozyme in deionized water and make up to 10mL).

[0060] Add 400 μL of lysis buffer to the bacteria collected in the above 1.5 mL centrifuge tube, and vortex for 7 min to fully lyse the bacteria; after centrifugation at 12000 rpm / min for 5 min, take 300 μL of the supernatant and add it to the ELISA plate, and measure its OD with an ELISA reader. 410 The absorbance at 4 °C was measured, and the lysate was used as a blank control.

[0061] like Figure 5 As shown in the left figure, the OD of the recombinant strains with different promoters 600 The growth curves are basically the same; Figure 5 As shown in the right figure, the OD of the bacterial lysate of the recombinant strains with different promoters 410 The curves are significantly different. The OD of the cell lysate of the strong promoter recombinant strain is 410 The curve grows rapidly and has a high peak value, while the OD of the cell lysate of the weak promoter recombinant strain is 410 The curve grows slowly, which is due to the different promoter activities in the reporter system, resulting in differences in the expression of the red protein. This shows that hbpR can be used as a reporter gene, and the hbpR gene reporter system is feasible and efficient, and can conveniently evaluate the promoter activity of different promoters by visualizing the level of red protein expression.

[0062] In summary, the hbpR gene expresses a red protein that can be distinguished by the naked eye, and a visual red protein-encoding gene reporter system was successfully constructed. The reporter system was verified using promoters of different strengths, indicating that the reporter system is feasible and efficient, and can be used to conveniently evaluate the promoter activity of different promoters, with broad application prospects.

[0063] The above-described embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the attached claims.

Claims

1. Contains reporter gene HkDJ The application of the reporter system in detecting the promotion activity of different promoters is characterized in that: The reporter gene HkDJ The nucleic acid sequence is shown in the sequence listing SEQ ID NO: 1; The reporter system contains the recombinant plasmid pET28EXba- hbpR, The recombinant plasmid pET28EXba- HkDJ The nucleic acid sequence is shown in the sequence listing SEQ ID NO:

4.

2. The reporter gene according to claim 1 HkDJ A method for constructing a reporting system, characterized in that: The method comprises the following steps: (1) Using Mycobacterium smegmatis as a template, design primer pairs HkDJ -EcoRI-F / HkDJ -XbaI-R amplified HkDJ Gene fragment, the HkDJ The gene nucleic acid sequence is shown in the sequence table SEQ ID NO: 1; HkDJ - The nucleic acid sequence of EcoRI-F is shown in the sequence listing SEQ ID NO: 2; HkDJ -XbaI-R nucleic acid sequence is shown in the sequence listing SEQ ID NO: 3; (2) Detection by agarose gel electrophoresis. When the fragment size and concentration meet expectations, the fragments in step (1) are recovered; (3) The pET28EXba vector digested with EcoRI and XbaI was ligated with the fragment recovered in step (2), transformed, and purified to obtain the recombinant plasmid pET28EXba- HkDJ ; The recombinant plasmid pET28EXba- HkDJ The nucleic acid sequence is shown in Table SEQ ID NO:4; (4) pET28EXba- HkDJ Reverse amplification primer pairs were designed on both sides of the original inducible promoter T7-lac of the recombinant plasmid: cm1- HkDJ -F-NheI / cm1- HkDJ -R-HindIII, in pET28EXba- HkDJ The recombinant plasmid was used as a template for reverse amplification. After the amplified fragment was recovered, it was digested with restriction endonucleases HindIII and NheI to obtain a linearized vector containing a reporter gene, which was named pET28EXba- HkDJ (HindIII / NheI); the cm1- HkDJ -F-NheI nucleic acid sequence is shown in the sequence table SEQ ID NO: 5; said cm1- HkDJ The nucleic acid sequence of -R-HindIII is shown in the sequence listing as SEQ ID NO:

6.

3. A method for evaluating the activation of different promoters using the reporter system as claimed in claim 1, characterized in that: The method comprises the following steps: (1) Select promoters of different strengths and design primers containing HindIII and NheI restriction sites; (2) Annealing to obtain a promoter fragment containing HindIII and NheI restriction sites, and annealing the promoter fragment to the pET28EXba- HkDJ (HindIII / NheI) for ligation and transformation into Escherichia coli BL21 (DE3); after successful verification, recombinant strains with different promoters were obtained; (3) Inoculate equal amounts of the bacterial suspension of the recombinant strain into the culture medium. After culturing for the same period of time, compare and determine the strength of the promoter by visual inspection or by quantitative detection of the red protein.

4. The method according to claim 3, characterized in that The method of visual determination in step (3) is: after culturing for the same period of time, the color of the bacterial solution or bacterial cells of different recombinant strains is observed by the naked eye. The more obvious the red color of the bacterial solution or bacterial cells is, the stronger the promoter activity is; the less obvious the red color is, the weaker the promoter activity is.

5. The method according to claim 3, characterized in that The quantitative detection method of step (3) is: after culturing for the same period of time, the bacteria are lysed and the OD of the supernatant is measured. 410 The absorbance value, the higher the value, the more red protein content, indicating that the promoter activity is stronger; the lower the absorbance value, the less red protein content, indicating that the promoter activity is weaker.

6. The method according to claim 5, characterized in that The method for preparing the lysis solution for lysing the bacteria is as follows: 5M urea and 10mg / ml lysozyme are prepared in a volume ratio of 9:1 and mixed evenly.

Images