Genes controlling rice root elongation and tillering and uses thereof

Abstract

The present application relates to the field of plant growth and development molecular biology, and particularly relates to a gene OsARF14b and application thereof in controlling rice root elongation and tillering, the gene OsARF14b has the nucleotide sequence shown in SEQ ID NO:1, and the application of the gene OsARF14b in regulating rice root elongation and tillering traits.The present application obtains overexpression and knockout transgenic materials by cloning the gene OsARF14b, constructing a transgenic vector, and statistically analyzing the phenotype of the transgenic materials, and finds that the root length and tiller number in different materials change significantly, compared with the wild type (Zhonghua 11, ZH11), the root length of the knockout transgenic material (cas9) is significantly shortened, and the tiller number is significantly increased, the root length of the overexpression material (OE) is lengthened, and the tiller number is significantly reduced, which indicates that the OsARF14b gene plays an important regulatory function in the process of plant root elongation and tillering.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant growth and development molecular biology, and in particular, to a gene OsARF14b and the application of the gene in regulating plant root elongation and tillering. BACKGROUND

[0002] ARF (Auxin response factor) is a class of transcriptionally active auxin response factors. In the model plant Arabidopsis thaliana, there are 23 AtARF genes distributed on the chromosomes, and 13, 3, 1, 2 and 4 ARF genes are contained on each of the 5 chromosomes, respectively. In the figure, we can find that a gene cluster composed of AtARF12, AtARF13, AtARF14, AtARF15, AtARF20, AtARF21 and AtARF22 is formed on the first chromosome, and their nucleic acid sequences and amino acid sequences also show high similarity. Remington et al. found that AtARF1 and AtARF2, AtARF3 and AtARF4, AtARF6 and AtARF8, AtARF7 and AtARF19, AtARF11 and AtARF18, AtARF10 and AtARF16 are highly homologous, and there may be functional redundancy. In the model plant rice, there are 25 OsARF genes distributed on the chromosomes. ARFs are distributed in various tissues and organs of plants, and their expression occurs in various stages of plant growth and development, and is closely related to the growth and development process of plants. They are involved in many physiological processes such as the formation of floral organs and vascular tissues, the differentiation of xylem and phloem, the occurrence of root system, the senescence of leaves, the development of fruit ripening, the regulation of tropism movement and apical dominance. Therefore, the family genes play a very important regulatory role in the growth and development process of rice. The functions of the OsARF family genes in rice in regulating root development and tillering process need to be further discovered. SUMMARY

[0003] Rice OsARF14b encodes 399 amino acids with a molecular weight of 41.23016KD. By cloning the OsARF14b gene and connecting the CRISPR-Cas9 vector to construct a knockout mutant, it is found that the length of the rice root system is shortened, and the number of tillers is significantly increased. After connecting the overexpression vector to obtain overexpression plants, it is found that the rice root system is significantly lengthened, and the number of tillers is significantly reduced, etc. It is shown that the OsARF14b gene plays an important regulatory function in the process of rice root elongation and tillering.

[0004] The first aspect of the present application provides the following technical solutions:

[0005] The gene for controlling the elongation and tillering of rice root system and its application, the gene is OsARF14b, and has the nucleotide sequence shown in SEQ ID NO: 1, and the gene OsARF14b at least regulates one or more of the plant root length and tillering.

[0006] The present application obtains the overexpression and knockout transgenic materials by cloning the gene OsARF14b, constructing the transgenic vector, and obtaining the phenotype trait identification of the transgenic materials, and obtains the change of the root length and tillering in different materials. Compared with the wild rice material, the knockout transgenic material shows that the root length is shortened, and the tillering number is increased, and the overexpression material shows that the root length is increased, and the tillering number is reduced, which shows that the gene OsARF14b plays an important regulation function in the elongation and tillering of the rice root system.

[0007] The gene OsARF14b related in the present application has a significant regulation effect on the elongation and tillering of the plant root system, which shows that the gene OsARF14b is closely related to the elongation and tillering of the plant root system. Therefore, in practical application, the expression amount of the gene OsARF14b can be changed to change the plant root length and tillering.

[0008] In the present application, the gene for controlling the elongation and tillering of the rice root system and its application can make the gene OsARF14b as a molecular marker for the elongation and tillering of the plant root system, that is, by detecting whether the plant has the expression of the gene OsARF14b, the situation of the elongation and tillering of the plant root system is relatively explained, and then good technical support is provided for plant breeding.

[0009] In the present application, the plant includes monocotyledonous plants and dicotyledonous plants;

[0010] The monocotyledonous plant includes rice, corn, wheat;

[0011] The dicotyledonous plant includes soybean, cotton, tobacco.

[0012] Among them, the present application can detect whether the sample to be detected contains the gene OsARF14b by various ways, such as directly detecting whether it contains the gene OsARF14b itself, or detecting the product generated by the gene OsARF14b, the product includes direct product or indirect product or byproduct, etc., the product can be a gene, also can be a protein, also can be a certain compound, etc.

[0013] Directly detecting the gene OsARF14b can be detected by the specific primer pair of the gene OsARF14b, or the probe or chip designed for the gene OsARF14b. Further, the sample to be detected is detected by the primer pair or probe or chip of the gene OsARF14b.

[0014] The primer pair or probe or chip for the gene OsARF14b in the present application can be designed according to conventional methods.

[0015] Further, the nucleic acid sequences of the primer pair are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0016] However, the method for detecting the gene OsARF14b itself is not limited thereto, and any method that can be achieved in molecular biology is within the protection scope of the present application.

[0017] Similarly, the product generated by the gene OsARF14b can also be detected by various means, such as various ELISA detection kits.

[0018] Further, the sample to be detected includes material suitable for tissue culture of sexual reproduction, asexual reproduction or regenerative cells.

[0019] The sample to be detected can be material suitable for sexual reproduction, such as selected from pollen, ovary, ovule, embryo sac, etc.

[0020] The material suitable for asexual reproduction can be selected from roots, stems, cuttings, protoplasts, etc.

[0021] The material suitable for tissue culture of regenerative cells can be selected from leaves, pollen, meristem cells, roots, root tips, seeds, embryos, cotyledons, hypocotyls and stems, etc.

[0022] Specifically, the sample to be detected includes any one of the following materials: leaves, roots, stems, radicles, plumules, seeds.

[0023] The plants include monocotyledonous plants and dicotyledonous plants; for example, the monocotyledonous plants include rice, corn and wheat; and the dicotyledonous plants include soybean, cotton and tobacco.

[0024] The third aspect of the present application also provides application of the gene OsARF14b in plant population genetic diversity research.

[0025] The plants include monocotyledonous plants and dicotyledonous plants; for example, the monocotyledonous plants include rice, corn and wheat; and the dicotyledonous plants include soybean, cotton and tobacco.

[0026] Compared with the prior art, the present application has at least the following beneficial effects:

[0027] (1) The present application constructs knockout materials and overexpression materials of the OsARF14b gene, and researches that the knockout transgenic materials show a shorter root length and an increased tillering, and the overexpression of the OsARF14b gene increases the root length and reduces the tillering.

[0028] (3) The OsARF14b gene provided by the application can be applied to the aspects of plant root elongation and tillering performance, and the plants involved include rice, corn, wheat, soybean, cotton, tobacco, etc. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below.

[0030] Figure 1 Figure for molecular detection results of the OsARF14b gene overexpression material in the embodiment 1 of the application;

[0031] Figure 2 Figure for molecular detection results of the OsARF14b gene knockout material in the embodiment 2 of the application;

[0032] Figure 3 Figure for root phenotypes of the OsARF14b transgenic material and wild type material in the embodiment of the application;

[0033] Figure 4 Figure for tillering phenotypes of the OsARF14b transgenic material and wild type material in the embodiment of the application; DETAILED DESCRIPTION

[0034] The embodiments of the application will be described in detail below with reference to the embodiments, but those skilled in the art will understand that the following embodiments are only used to illustrate the application, and should not be regarded as limiting the scope of the application. If the specific conditions are not indicated in the embodiments, the conventional conditions or the conditions suggested by the manufacturer are used. If the manufacturers of the reagents or instruments are not indicated, they are all conventional products that can be purchased in the market.

[0035] Example 1

[0036] The transgenic plants are obtained, including the following steps:

[0037] 1) Extraction of total RNA

[0038] The seeds of rice Zhonghua 11 were sterilized by 30% NaClO, and then germinated. When the plants reached two-leaf-one-heart stage, the plants with uniform size were selected, and then transplanted into 1 / 2 IRRI nutrient solution with pH 5.5. When the plants reached four-leaf-one-heart stage, the plants were transplanted into IRRI nutrient solution. After one week, the roots and leaves were quickly frozen in liquid nitrogen, and then ground into powder. About 0.1 g of the powder was added into a 1.5 ml centrifuge tube, and then 1 ml Trizol reagent and 0.2 mL chloroform were quickly added. After centrifugation, the supernatant was collected, and then 0.5 mL isopropanol was added. After centrifugation, the supernatant was discarded, and then the precipitate was washed with 70% ethanol. The RNA was dissolved in DEPC water (volume ratio 1:‰), and then the quality of the RNA was detected by agarose gel electrophoresis. The concentration and purity of the total RNA were detected by spectrophotometer. The qualified sample was used for the next step.

[0039] 2) Total cDNA synthesis

[0040] 2 μg of each RNA sample was added into 50 μmol·L -1 Oligo dT18, 1‰ DEPC water was added to 10 μL, and then the mixture was placed in water bath at 70 °C for 5 min, and then placed on ice for 5 min. RNase inhibitor 0.5 μL, 5x RT buffer 5 μL, 10 mmol dNTPs 2.5 μL, and M-MLV reverse transcriptase 1 μL were sequentially added, and then 1‰ DEPC water was added to 25 μL. After water bath at 42 °C for 60 min, the reaction was terminated by water bath at 70 °C for 10 min (Oligo dT18 was synthesized by Nanjing Jin Sui Company; the reverse transcription kit was purchased from Fermentas Company, Canada).

[0041] 3) Obtaining the full-length cDNA of OsARF14b gene

[0042] The total cDNA of rice Zhonghua 11 obtained above was used as template, and PCR primers were designed. The PCR product contained the complete OsARF14b reading frame (from the start codon ATG to TAG), and the primer sequences were as follows:

[0043] OsARF14b-F: 5'-ATGAGGTTCAGAGTTTGCTATGAGA-3';

[0044] OsARF14b-R: 5'-TCACATTCCCAGGGGAGCA-3'

[0045] PCR program was as follows: 95°C pre-denaturation 3 min, 95°C denaturation 30 s, 56°C annealing 45 s, 72°C recombination extension 2 min, 35 cycles, 72°C 7 min, the amplified PCR product was detected by 1% agarose gel electrophoresis, and the size was 1146 bp fragment. The target PCR product was separated by agarose electrophoresis and cut and recovered, and the recovered fragment was connected with P-easy blunt vector, and the total volume of enzyme connection system was 5 μL (containing 1 μL of vector and 4 μL of PCR purified product), and after adding the sample, it was mixed uniformly, centrifuged to the bottom of the tube, and placed at 28°C for 15 min;

[0046] The enzyme connection system was 42°C heat shock into E. coli DH5α competent cells, 500-700 μL of LB liquid medium without antibiotics was shaken for 1 h, then low speed centrifugation, enrichment of bacterial cells, and then coated on LB solid medium containing kanamycin 100 μg·mL -1 After 12-14 h growth, positive colonies were picked for DNA sequencing, and the OsARF14b gene accession number was AK240660. The open reading frame (ORF) of OsARF14b was 1164 bp in length; the sequencing correct bacterial liquid was added to an equal volume of 50% glycerol and stored at -70°C for standby, and the P vector containing the open reading frame of OsARF14b was named as pOsARF14b in P.

[0047] 4) Construction of overexpression vector pUbi-OsARF14b

[0048] According to the cDNA sequence of rice auxin transport protein gene OsARF14b, PCR primers were designed, the PCR product contained the complete OsARF14b gene reading frame (from the start codon ATG to the stop codon TAG), and the restriction enzyme sites KpnI and SpeI were introduced on the upstream and downstream primers, respectively. The primer sequence was:

[0049] overOsARF14b-F: 5'-ga CGGGGTACC ATGAGGTTCAGAGTTTGCTATG-3' KpnI overOsARF14b-R: 5'-at GGACTAGT TCACATTCCCAGGGGAGCAG-3' SpeI

[0050] PCR program as follows: 95℃ pre-denaturation 3min, 95℃ denaturation 30s, 56℃ annealing 45s, 72℃ extension 2min, 35 cycles, 72℃ 7min, the amplified PCR product was detected by 1% agarose gel electrophoresis, and the size of the PCR product was about 1200bp. The target PCR product was separated by agarose electrophoresis and recovered by cutting the gel, and the recovered product was digested with restriction enzymes KpnI and SpeI. At the same time, the plant overexpression vector pTCK303 plasmid was double-digested with KpnI and SpeI, and then the digested PCR fragment and the vector were recovered. After dephosphorylation of the vector, it was recovered again; after recovery, the linearized vector and the digested PCR fragment were ligated at 16℃ overnight by T4 ligase, and then transformed into E. coli DH5a competent cells, and then grown on LB solid medium containing kanamycin 50μg·mL -1 After 12h, positive colonies were picked, and plasmids were extracted and digested with KpnI and SpeI to verify the size of the fragment. After the correct cloning was verified by DNA sequencing, the bacterial liquid containing the correct sequencing clone was stored at -70℃ in an equal volume of 50% glycerol. The positive clone plasmid was extracted and named pUbi-OsARF14b;

[0051] Finally, the pUbi-OsARF14b plasmid was transformed into the competent cells of Agrobacterium tumefaciens EHA105 by electroporation, and then grown on YEP solid medium containing kanamycin and streptomycin both at 50μg·mL -1 After 48h, positive colonies were picked, and plasmids were extracted and digested with KpnI and SpeI to verify the size of the fragment. After the correct cloning was verified by DNA sequencing, the bacterial liquid containing the correct sequencing clone was stored at -70℃ in an equal volume of 50% glycerol. The positive clone plasmid was extracted and named pUbi-OsARF14b;

[0052] 5) Obtaining of transgenic plants

[0053] To avoid the plant cytoplasmic gene mutation caused by the transgenic process, we carried out different batches of transgenic experiments. In October 2020-December 2020 and January 2021-May 2021, the above-obtained Agrobacterium containing the 35S-OsARF14b plasmid was used to infect rice callus, and the callus was co-cultured for 3 days. After selection culture, differentiation, rooting, and seedling of the resistant callus, T0 generation transgenic plants were obtained. To avoid changes in plant traits caused by cytoplasmic chimeras caused by non-genomic insertion, we propagated all transgenic materials twice to obtain stable T2 generation and performed physiological measurements on the stable T2 generation materials.

[0054] The specific preparation of transgenic plants is as follows:

[0055] 5.1) Agrobacterium-mediated rice transformation

[0056] Callus induction: Peeled rice seeds (14 seeds per dish) are placed in an Erlenmeyer flask and soaked in 70% ethanol for 1 minute (enough to submerge the seeds). The 70% ethanol is then discarded, and the seeds are rinsed 5-6 times with sterile water. Next, the seeds are soaked in 30% sodium hypochlorite solution for 30 minutes, followed by rinsing with sterile water 5-6 times until the solution is clear. The seeds are then transferred to sterile filter paper with tweezers to absorb excess moisture. Finally, the seeds are placed on the induction medium and cultured in a 32℃ light incubator for 5 days.

[0057] Preparation of Agrobacterium: Agrobacterium strain EHA105 with the appropriate vector was streaked onto AB medium (50 mg / L Kan) and incubated in the dark at 28°C for 3 days. The Agrobacterium colonies were scraped off with a sterile spoon and resuspended in AAM medium (containing As), with an OD600 of approximately 0.1.

[0058] Infection and co-culture of callus: Pick rice callus from the subculture medium and place it into a centrifuge tube, ensuring the callus tissue covers the conical portion of the 50ml centrifuge tube (select pale yellow, round, and resilient callus tissue). Transfer 1ml of the cultured bacterial solution to a 1.5ml centrifuge tube, centrifuge at 5000rpm for 1 min at 4℃, and discard the supernatant. Use a solution containing 200μmol·L⁻¹... -1 Prepare a suspension of collected bacterial cells using 30 ml of acetylsylgenin (As) inoculation solution. Pour this suspension into the selected callus tissue and infect for 5 minutes. Discard the liquid, remove the callus tissue, and place it on a sterile culture dish lined with absorbent paper to drain for 30-40 minutes. Place the callus tissue on a co-culture medium (with a 9 cm layer of sterile filter paper on top) and incubate in the dark at 25°C for 3 days.

[0059] Bacterial washing and antibiotic screening culture: The callus tissue was removed from the co-culture medium and rinsed 5 times with sterile water, shaking continuously for 5 minutes each time. Then it was rinsed with a solution containing 500 mg / L... -1 Soak the callus tissue in sterile water with carbenicillin (CAR) for 40-60 minutes. Finally, drain on sterile filter paper for 2 hours. First round of screening: Transfer the dried callus tissue into a solution containing 400 mg / L... -1 Carbenicillin (CAR) and 50 mg / L -1 The first selection was carried out on hygromycin (Hyg) selective medium, and cultured at 32°C under light for two weeks;

[0060] Second round of screening: Vigorously growing callus was transferred to differentiation medium containing 50 mg / L hygromycin B and 250 mg / L carboxybenzyl to induce differentiation, and then continuously irradiated at 28°C for about two weeks.

[0061] Induction of differentiation and rooting of resistant callus: pick the bright yellow resistant callus into the differentiation culture medium, put it into the constant temperature culture room, wait for the differentiation into seedlings (about 30d, the culture conditions in the tissue culture room are 24-30°C, 14h light / 8h dark), and put it into the rooting culture medium when the seedlings grow to about 5cm.

[0062] Training and transplanting of transgenic seedlings: pick out the test tube with well-differentiated roots and stems and leaves (the seedlings grow to the top of the test tube, and the cover should be opened in time), open the sealing film, add appropriate amount of sterile water (to prevent the growth of bacteria in the culture medium), and train the seedlings for about 3-7d, then wash off the agar, and transplant them to the greenhouse for water culture or soil culture growth and detection.

[0063] 5.2) Rapid detection of transgenic seedlings to obtain T0 generation plants

[0064] Cut and collect fresh green leaves (both ends have incisions) about 1cm long from the seedlings to be detected, and place them flat on the hygromycin (80mg·L -1 ) culture medium, and cultivate at 30°C for 48h under 16 / 8h (light / dark). The leaves remain fresh green, which is a positive plant, while the leaves of negative seedlings appear massive necrosis (Zheng Ye. Establishment and application of high-efficiency transgenic system of rice. 2008). Through hygromycin screening, 60 positive T0 plant lines are obtained. T0 generation seeds are obtained by planting overexpression materials from June to October 2021.

[0065] 5.3) Molecular identification of OsARF14b overexpression lines

[0066] T0 generation seeds are germinated and expanded twice to obtain T2 generation transgenic seedlings. At the tillering initiation stage of transgenic material OsARF14b-OE and wild type material Hua 11, the root system is extracted to obtain RNA, which is reverse transcribed to perform qRT-PCR for quantitative PCR identification. The results are shown in Figure 1 , and stable genetic OE-4, OE-12, and OE-14 transgenic lines are obtained.

[0067] Example 2

[0068] Obtaining of gene OsARF14b knockout plants:

[0069] 1) Selection of target:

[0070] According to the NCBI OsARF14b gene sequence, a target site is designed at the first exon of the gene

[0071] Target: ACCAAATTGCACTTTCCTCA

[0072] The primers are denatured and annealed to obtain a gRNA fragment. The PCR reaction system is as follows: 5 μL of forward and reverse primers, respectively, and 40 μL of water are added to make up to 40 μL. The PCR reaction program is as follows: denaturation at 95°C for 10 min, annealing at 55°C for 10 min, and cooling at 14°C for 5 min.

[0073] 2) Construction of target enzyme cutting connection

[0074] The annealed self-ligation system and the sgRNA vector are cut by thermofisher slow cutting enzyme, and the enzyme cutting is carried out in a water bath at 37°C for 10-14 h. The enzyme cutting and ligation system is as follows: 10×buffer AarⅠ: 5 μL, 50×olignucleotide for AarⅠ: 1 μL, AarⅠscissors: 1 μL, vector plasmid: 5-8 μL, H2O: make up to 50 μL. Take the enzyme cutting KOOsARF14b system: 2.5 μL, vector sgRNA: 2.5 μL T4-ligase: 0.5 μL, T4-buffer: 1 μL, H2O: 3.5 μL, and place the prepared enzyme cutting system in a 37°C incubator for 2 h. After transformation, sequencing is carried out. The sequencing correct plasmid is named as OsARF14b, and the positive agrobacterium is used to infect rice callus to obtain OsARF14b gene knockout material. The transformation steps are the same as in Example 1.

[0075] 3) Identification of gene knockout material

[0076] The roots of transgenic materials and wild type materials at the 11th seedling stage are taken, and after DNA extraction, the forward and reverse primers are designed according to the target site (target ACCAAATTGCACTTTCCTCA) at both ends,

[0077] KO-OsARF14b-F: TGTGTCATGGAAGTTGATTTG

[0078] KO-OsARF14b-R: CCAGGTGATTCAGAGCATACAA

[0079] The PCR amplification product is subjected to sanger first-generation sequencing, and the sequencing results are compared with the amplification product sequencing results of Zhonghua 11 to determine whether the gene knockout is successful.

[0080] The detection results are shown in Figure 2 .

[0081] In order to avoid the change of plant traits caused by cytoplasmic chimeras caused by non-genomic insertion, all the T0 generation transgenic knockout plants obtained are expanded twice to obtain stable T2 generation, and the stable T2 generation materials are subjected to physiological determination.

[0082] Test example

[0083] T2 generation transgenic materials and wild type materials Zhonghua 11 were sterilized, then germinated at 28℃ for 1 day, then cultured at 28℃ for 5 days under 16h light and 8h darkness, then the root length of the rice was measured by using a ruler. The rice was planted in a test field, and the tiller number of the rice was determined at the filling stage, with eight repeats for each strain. The results are shown in Figure 3 and Figure 4 .

[0084] As can be seen from Figure 3 , compared with the wild type (Zhonghua 11), the root length of the T2 generation knockout mutants (cas9-1, cas9-2) is significantly shortened, and the root length of the T2 generation OsARF14b gene overexpression materials (OE-2, OE-14, OE-16) is significantly lengthened.

[0085] As can be seen from Figure 4 , compared with the wild type (Zhonghua 11), the tiller number of the T2 generation knockout mutants (cas9-1, cas9-2) is significantly increased, and the tiller number of the T2 generation OsARF14b gene overexpression materials (OE-2, OE-14, OE-16) is significantly reduced.

[0086] In summary, the OsARF14b gene has obvious effects on the root elongation and tillering of plants.

[0087] In the present application, the reagents and solutions involved are as follows:

[0088] 1. Induction medium

[0089]

[0090]

[0091] pH 5.8, 115℃ high pressure sterilization for 20min.

[0092] 2. Co-culture medium

[0093]

[0094] pH 5.2, 115℃ high pressure sterilization for 20min.

[0095] 3. Selection medium

[0096]

[0097]

[0098] pH 5.8, 115℃ high pressure sterilization for 20min.

[0099] 4. Differentiation medium

[0100]

[0101] pH 5.8, 115°C autoclave 20 min.

[0102] 5. Rooting medium

[0103]

[0104]

[0105] pH 5.8, 115°C autoclave 20 min.

[0106] 6. AAM medium

[0107]

[0108] pH 5.2, 115°C autoclave 20 min.

[0109] 7. AB medium

[0110]

[0111] pH 7.2, 115°C autoclave 20 min.

[0112] 8. Medium stock solution formula:

[0113] N6 macroelements (20X)

[0114]

[0115] Dissolve the above reagents one by one, then add distilled water at room temperature, mark the preparation person and preparation date, and store at 4°C.

[0116] N6 microelements (1000X)

[0117]

[0118] Dissolve the above reagents at room temperature and add distilled water to volume, mark the preparation person and preparation date, and store at 4°C.

[0119] N6 organic matter (100X)

[0120]

[0121] Add distilled water to volume, mark the preparation person and preparation date, and store at 4°C for no more than 1 month.

[0122] MS macroelements (20X)

[0123]

[0124]

[0125] Dissolve the above reagents one by one, then make up with distilled water at room temperature, mark the preparer and preparation date, and store at 4°C.

[0126] MS trace elements (1000X)

[0127]

[0128] Dissolve the above reagents at room temperature and make up with distilled water, mark the preparer and preparation date, and store at 4°C.

[0129] MS organic matter (100X)

[0130]

[0131] Make up with distilled water, mark the preparer and preparation date, and store at 4°C for no more than 1 month.

[0132]

[0133]

[0134] Among them, iron salt (100X): dissolve 3.73 g of ethylenediamine tetraacetic acid disodium salt (Na2EDTA·2H2O) and 2.78 g of FeSO4·7H2O respectively, mix and make up to 1000 ml with distilled water, warm at 70°C for 2 hours, mark the preparer and preparation date after cooling, and store at 4°C.

[0135] 50 mg / ml myo-inositol: dissolve 5 g of myo-inositol in 100 ml of distilled water, mark the concentration, preparer and preparation date, and store at 4°C.

[0136] 5 mg / ml copper sulfate (CuSO4·5H2O): dissolve 0.5 g of CuSO4·5H2O in 100 ml, mark the concentration, preparer and preparation date, and store at 4°C.

[0137] 5 mg / ml cobalt chloride (CoCl2·6H2O): dissolve 0.5 g of CoCl2·6H2O in 100 ml, mark the concentration, preparer and preparation date, and store at 4°C.

[0138] 2,4-D (1 mg / ml): place 100 mg of 2,4-D in a 100 ml beaker, first add 20 ml of water, then add 3 ml of 1N KOH, completely dissolve, then make up to 100 ml with water, mark the concentration, preparer and preparation date, and store at 4°C.

[0139] KT (1 mg / ml): 100 mg Kinetin (KT) was put in a 100 ml beaker, first add 20 ml water, then add 5 ml 1 N HCl, completely dissolved, add water to constant volume to 100 ml, mark the concentration, the person who prepared and the preparation date, and store at -20 °C.

[0140] NAA (1 mg / ml): 100 mg NAA was put in a 100 ml beaker, first add 20 ml water, then add 3 ml 1 N KOH, completely dissolved, add water to constant volume to 100 ml, mark the concentration, the person who prepared and the preparation date, and store at 4 °C.

[0141] 1 N KOH: 5.6 g KOH was dissolved in 100 ml water, marked the concentration, the person who prepared and the preparation date, and stored at room temperature.

[0142] 1 N NaOH: 4 g NaOH was dissolved in 100 ml water, marked the concentration, the person who prepared and the preparation date, and stored at room temperature.

[0143] 1 N HCl: 12.5 ml concentrated hydrochloric acid was added to constant volume to 100 ml with water, marked the concentration, the person who prepared and the preparation date, and stored at room temperature.

[0144] Kan (50 mg / ml): Kanamycin (Kan) was dissolved in sterile water, 50 mg / ml, filtered to sterilize, marked the concentration, the person who prepared and the preparation date, and stored at -20 °C.

[0145] Rif (50 mg / ml): Rifampicin (Rif) was dissolved in DMSO to make a mother liquor of 50 mg / ml, marked the concentration, the person who prepared and the preparation date, and stored at -20 °C.

[0146] Cb (500 mg / ml): 1 g Carbenicillin was dissolved in 2 ml sterile water in a super-clean bench, filtered to sterilize, marked the concentration, the person who prepared and the preparation date, and stored at -20 °C.

[0147] AS (100 mM): 0.196 g AS was dissolved in 10 ml DMSO, divided into 1 ml small tubes, marked the concentration, the person who prepared and the preparation date, and stored at -20 °C.

[0148] The abbreviations used in the medium of the present application are as follows: Cb (Carbenicillin, carbenicillin); NAA (Napthalene acetic acid, naphthalene acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4-dichlorophenoxyacetic acid); AS (Acetosringone, acetosringone); CH (Casein Enzymatic Hydrolysate, hydrolyzed casein); L-pro (L-proline); L-Glu (L-glutamine); MES (2-(N-Morpholino)Ethane Sulfonic Acid); N6 (N6 macroelement component solution); B5 (B5 microelement component solution).

[0149] While the application has been illustrated and described in detail in the drawings and foregoing description, the same should be considered as illustrative and not restrictive in character. It is understood that only the preferred embodiments have been described and all changes and modifications that come within the spirit of the application are desired to be protected.

Claims

1. The application of genes in controlling root elongation and tillering in rice, characterized by: The gene is OsARF14b and has the nucleotide sequence shown in SEQ ID NO:

1. Knockout material of the gene OsARF14b inhibits rice root elongation and / or promotes tillering, while overexpression material of the gene OsARF14b promotes rice root elongation and / or inhibits tillering.

Images