Molecular Markers Tightly Linked to the Major QTL for Ear Length in Maize and Their Applications

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a molecular marker closely linked to a major QTL for maize ear length, its primers, and applications. The molecular marker is located on chromosome 3 of maize and includes molecular marker M158 and molecular marker M0900; the nucleotide sequence of the molecular marker M158 is as shown in SEQ ID NO.21, and the nucleotide sequence of the molecular marker M0900 is as shown in SEQ ID NO.24. The primer sequences for amplifying the molecular marker M158 are: M158-F: 5'-CCGAGTGTGAGTGAGGACAA-3'; M158-R: 5'-CACGTGGATTGGTTACGATG-3'; the primer sequences for amplifying the molecular marker M0900 are: M0900-F: 5'-ACGATGCATGGTTGGAGTTG-3'; M0900-R: 5'-CCATCAAACAAAGTGGCCCA-3'. The molecular marker provided by the present invention is closely linked to the major QTL for maize ear length and can be applied to molecular marker-assisted breeding for ear length, screening of germplasm resources for ear length, and genetic improvement of maize ear length.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a molecular marker closely linked to the major ear length QTL of maize and its application. Background Art

[0002] Maize has diverse functions. It is not only a food crop on which humans depend for survival, but also a feed crop for the animal world and an industrial raw material for promoting economic development. Therefore, the yield of maize has an extremely important impact on China's agricultural production. As an important part of the yield components, the study of maize ear length is of great significance. The yield per unit of maize depends on the number of kernels per ear and the kernel weight, and the number of rows per ear and the number of kernels per row determine the number of kernels per ear, while the development integrity of the kernels determines the kernel weight. Therefore, screening and identifying ear length germplasm resources is an important way to cultivate new high-yield maize varieties.

[0003] The selection cycle of ear length germplasm resources by conventional breeding methods is long and the efficiency is low. However, molecular marker-assisted breeding shortens the breeding period, accelerates the breeding process, improves the breeding efficiency, and overcomes many difficulties in conventional breeding methods. Molecular marker-assisted selection requires analyzing the genotypes of molecular markers closely linked to the target gene and selecting the genotypes of target traits with the help of molecular markers.

[0004] Linkage analysis, also known as QTL mapping analysis, is based on the combination of the genotypes and phenotypes of target traits to continuously search for linked markers associated with the target traits, and draw a linkage genetic map through the integration of marker positions. A single segment substitution line refers to a line in which the rest of the chromosome is identical to the recipient except for the target segment. The characteristics of single segment substitution lines (SSSLs) are as follows: strong stability; the influence caused by the environment can be excluded; fewer factors are considered in the mapping, and the result accuracy is high.

[0005] Due to the high stability and small environmental impact of single segment substitution lines, they are widely used in QTL mapping, but the obtained mapping intervals are relatively large, and molecular markers cannot be applied to production. Therefore, it is necessary to develop a molecular marker closely linked to the target gene for genetic improvement of maize ear length. Summary of the Invention

[0006] The object of the present invention is to provide a molecular marker closely linked to the major ear length QTL of maize and its application. This molecular marker is closely linked to the major ear length QTL of maize and can be applied to molecular marker-assisted breeding of maize ear length.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] Molecular markers tightly linked to the major QTL for maize ear length, said molecular markers being located on maize chromosome 3, namely molecular marker M158 and molecular marker M0900.

[0009] Preferably, the molecular marker M158 is located on maize chromosome 3, specifically at position chr3: 231733871 - 231734353, and the molecular marker M0900 is located on maize chromosome 3, specifically at position chr3: 232377659 - 232377854.

[0010] Primers for the molecular markers tightly linked to the major QTL for maize ear length, the primer sequences for amplifying the molecular marker M158 are:

[0011] M158-F: 5’- CCGAGTGTGAGTGAGGACAA -3’ (Sequence 1);

[0012] M158-R: 5’- CACGTGGATTGGTTACGATG -3’ (Sequence 2);

[0013] The primer sequences for amplifying the molecular marker M0900 are:

[0014] M0900-F: 5’- ACGATGCATGGTTGGAGTTG -3’ (Sequence 3);

[0015] M0900-R: 5’- CCATCAAACAAAGTGGCCCA -3’ (Sequence 4).

[0016] Application of the molecular markers tightly linked to the major QTL for maize ear length in the genetic improvement of maize ear length.

[0017] Preferably, the method for identifying maize ear length traits in the process of maize ear length molecular marker-assisted breeding includes the following steps:

[0018] Extract genomic DNA from maize leaves;

[0019] Using the genomic DNA of maize leaves as a template, perform PCR amplification respectively with the primers M158-F / M158-R, M0900-F / M0900-R;

[0020] Identification of PCR amplification results by agarose gel electrophoresis: When the primers used are M158-F / M158-R, if the size of the molecular marker M158 is detected to be 321 bp, it indicates that the ear length of the sample to be tested is longer; if the size of the molecular marker M158 is detected to be 502 bp, it indicates that the ear length of the sample to be tested is shorter; when the primers used are M0900-F / M0900-R, if the size of the molecular marker M0900 is detected to be 215 bp, it indicates that the ear length of the sample to be tested is longer; if the size of the molecular marker M0900 is detected to be 205 bp, it indicates that the ear length of the sample to be tested is shorter.

[0021] Preferably, the PCR amplification system is 8 μL, and the components include: 2 μL of DNA, 1 μL of each of the left and right primers, and 4 μL of 2×Taq Master Mix (Novoprotein P112).

[0022] Preferably, the Touchdown PCR amplification program is used: 95°C for 5 min; 95°C for 30 s, 65°C for 30 s, with a decrease of 1°C for each cycle, 72°C for 45 s, for a total of 8 cycles; 95°C for 30 s, 58°C for 30 s, 72°C for 45 s, for a total of 28 cycles; 72°C for 10 min.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] The molecular marker of the present invention that is closely linked to the major ear length QTL in maize is closely linked to the major ear length QTL in maize, and can be applied to molecular marker-assisted breeding for ear length, screening of germplasm resources for ear length, and genetic improvement of maize ear length. Description of the Drawings

[0025] Figure 1 Photos of the mature ears of Xu 178 and SSSL3 in Example 1, with a scale of 1 cm;

[0026] Figure 2 Phenotypic analysis of the mature ears of Xu 178 and SSSL3 in Example 1;

[0027] Figure 3 Polyacrylamide gel electrophoresis diagram of the molecular marker in Example 1;

[0028] Among them, A and B are the electrophoresis diagrams of umc1639 and umc1136 respectively; in A and B, the samples in lanes 1-4 are SSSL3, Xu 178, dominant pool, and recessive pool respectively;

[0029] Figure 4 Primary mapping of the qEL3 gene in Example 1;

[0030] Figure 5Fine mapping of qEL3 in Example 1. Detailed implementation manners

[0031] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings.

[0032] In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0033] Example 1

[0034] This example provides the positioning process of the major QTL for maize ear length, which is as follows:

[0035] (1) Identification of the single-segment substitution line SSSL3 for ear length

[0036] 1.1 Construction of the maize single-segment substitution line population

[0037] The experimental materials were selected from more than 150 homozygous single-segment substitution lines constructed by multi-generation backcrossing and selfing in the laboratory with Xu 178 as the recipient parent and Zong 3 as the donor parent.

[0038] 1.2 Field measurement of the ear phenotypes of the single-segment substitution line population

[0039] In 2013 and 2014, 150 single-segment substitution lines and their recipient material Xu 178 were planted in Xunxian, Xinxiang and Xuchang of Henan respectively. Two replicates were set for each material, with 2 rows in each replicate, 4 meters in row length, 0.65 meters in row spacing and 0.25 meters in plant spacing. After mature harvest, the ear length and ear diameter of the mature ears were measured using a seed grader (Jetion), and the number of ear rows and grains per row of the ears were counted manually.

[0040] 1.3 Phenotypic analysis of the mature ears

[0041] Through two-year field phenotypic measurements at four sites, it was found that compared with the background material Xu 178, the ear length and grains per row of the single-segment substitution line SSSL3 were significantly increased, and there was no obvious difference in ear diameter and number of ear rows. The results are shown in Figure 2 .

[0042] (2) Primary mapping of the major QTL qEL3 for maize ear length

[0043] 2.1 Construction of the mapping population: Using the single-segment substitution line SSSL3 as the female parent, cross it with Xu 178 to obtain F1 plants, and then backcross the F1 plants with Xu 178 to obtain the BC1F1 population.

[0044] 2.2 Identification of ear length phenotype: In Hainan in 2018, a BC1F1 population was constructed, planted in 45 rows with a row length of 4 meters. DNA was extracted from the leaves of individual plants in the BC1F1 population for cryopreservation, and individual plants were self-pollinated to save seeds. In the spring of 2019, the self-pollinated seeds (BC1F2) of individual plants were planted in Yuanyang, with 2 replicates, 2 rows in each replicate, a row length of 4 meters, a row spacing of 0.65 meters, and a plant spacing of 0.25 meters. After mature harvest, the ear length of the BC1F2 population was measured, and the genotype of individual plants in BC1F1 was judged based on the ear length phenotype of the BC1F2 population.

[0045] 2.3 DNA extraction and molecular marker development

[0046] The genomic DNA of maize leaves was extracted using the CTAB method and stored at -20 °C in the refrigerator for later use.

[0047] SSR markers: 1000 pairs of SSR markers covering the entire maize genome available in the laboratory (IBM database of MaizeGDB (http: / / www.maizegdb.org / )).

[0048] InDel marker development: Using the known InDel primers in the laboratory, Indels within the selected intervals were synthesized, and the synthesized sequences are shown in Table 1.

[0049] 2.4 PCR procedure and genotype analysis of amplification products

[0050] The components of the PCR amplification system (8 μL) include: 2 μL of DNA, 2 μL of primers (1 μL each of the forward and reverse primers), and 4 μL of 2×Taq Master Mix (Novizan P112). The Touchdown PCR amplification program was used: 95 °C for 5 min; 95 °C for 30 s, 65 °C for 30 s (decreasing 1 °C in each cycle), 72 °C for 45 s, for a total of 8 cycles; 95 °C for 30 s, 58 °C for 30 s, 72 °C for 45 s, for a total of 28 cycles; 72 °C for 10 min. The PCR amplification products were subjected to 6% polyacrylamide gel electrophoresis and 4% agarose gel electrophoresis for genotype analysis.

[0051] 2.5 Primary mapping of major QTL for maize ear length

[0052] Extract the DNA of the parental material Xu 178 and the single segment substitution line material SSSL3 to form two parental pools. Select 10 plants with dominant traits (long ears) (Aa genotype plants in the BC1F1 population) and 10 plants with recessive traits (short ears) (aa genotype plants in the BC1F1 population) in the segregating population, and mix the DNA of these plants in equal amounts to form two near-isogenic line pools. Use 1000 pairs of SSR markers covering the entire maize genome to analyze the genotypes of the parental pools. A total of 2 pairs of polymorphic molecular markers were screened, namely umc1639 and umc1136. The electrophoresis patterns of these 2 pairs of molecular markers are shown as Figure 2 shown. Continue to develop markers and screen for polymorphic molecular markers to the left of 3.09 bin. The primer information of the molecular markers is shown in Table 1.

[0053] Table 1 Sequence information of 19 pairs of linked differential markers screened

[0054]

[0055] Use the polymorphic molecular markers in Table 1 to analyze the genotypes of the individual plants in the BC1F1 population in 2015 and 2016. Combining the phenotypes of the progeny of the individual plants, 106 exchange individual plants were classified into 8 different types (4 types of long ear individual plants and 4 types of short ear individual plants) of recombinant individual plants. Through overlapping mapping, the target gene was located between the molecular markers Chr3.09-14 and Chr3.09-176 on chromosome 3, and the physical distance was 4.5 Mb. The results are shown in Figure 4 . Figure 4 The white box in represents the genomic fragment from Xu 178, and the black box represents the fragment of SSSL3.

[0056] (3) Fine mapping of the major QTL qEL3 for maize ear length

[0057] 3.1 Construction of the mapping population: Select individual plants with heterozygous target segments in the BC1F1 population and self-cross them to construct the BC1F2 population.

[0058] 3.2 Identification of ear length phenotypes: Plant the BC1F2 population in Sanya, Hainan in the winter of 2019, and self-cross the individual plants to save seeds. In the spring of 2020 and the late summer of 2020, plant the seeds of the self-crossed progeny of the individual plants in Yuanyang, Xinxiang for phenotype identification. Plant 2 replicates, with 2 rows planted in each 4-meter row length, row spacing 0.65 meters, and plant spacing 0.25 meters. Use a seed grader to measure the ear length of the harvested population, and use the ear length phenotype results of the population to judge the genotypes of the BC1F2 individual plants.

[0059] 3.3 DNA extraction and molecular marker development

[0060] Use the CTAB method to extract the genomic DNA of maize leaves and store it in a -20°C refrigerator.

[0061] InDel Marker Development: Use the InDel markers existing within the development intervals of the 10 chromosomes in the laboratory, and screen for differential markers using the parents SSSL3 and Xu 178.

[0062] 3.4 PCR Procedure and Genotype Analysis of Amplification Products

[0063] The components of the PCR amplification system (8 μL) include: 2 μL of DNA, 2 μL of primers (1 μL each for the forward and reverse primers), and 4 μL of 2× Taq Master Mix (Novizan P112). Use the Touchdown PCR amplification procedure: 95°C for 5 min; 95°C for 30 s, 65°C for 30 s (decreasing 1°C per cycle), 72°C for 45 s, for a total of 8 cycles; 95°C for 30 s, 58°C for 30 s, 72°C for 45 s, for a total of 28 cycles; 72°C for 10 min. Genotype analysis of the PCR amplification products is performed by agarose gel electrophoresis.

[0064] 3.5 Fine Mapping of the Major QTL for Maize Ear Length

[0065] Use the InDel markers existing within the development intervals of the 10 chromosomes in the laboratory, and screen for differential markers using the parents SSSL3 and Xu 178. The primer information of the polymorphic molecular markers screened is shown in Table 2.

[0066] Table 2 Primer Information of Molecular Markers

[0067]

[0068] Extract the DNA from the leaves of individual plants in the population planted in Hainan in 2019, and screen using the molecular markers at both ends to obtain 123 recombinant individuals. Through the ear length phenotypic identification in two years at two locations with two replicates and genotype analysis using the markers within the interval, the target gene is mapped between the markers M158 and M0900 through a contig map, with a distance of 643 Kb. The white box represents the genomic fragment from Xu 178, the black box represents the genomic fragment of SSSL3, and the gray box represents the heterozygous fragment of Xu 178 and SSSL3. The bar chart on the right indicates the average ear length of the selfed progeny of the recombinant individuals, and the asterisks are obtained by t-test with Xu 178. ** represents a P value < 0.01, and *** represents a P value < 0.001. The molecular marker M158 is located on maize chromosome 3, with the specific position chr3: 231733871 - 231734353, and the molecular marker M0900 is located on maize chromosome 3, with the specific position chr3: 232377659 - 232377854.

[0069] The amplified sequence size of M158 in Xu 178 is 502bp, and the amplified sequence is:

[0070] CCGAGTGTGAGTGAGGACAAAGTGTATAGAGGTGAACTGTGACTTCATAGGCCAATGTTTAGAGGGTGTTTGGTTTCTAAGGACTAATTTTTAGTCCCTATATTTTATTCTATTTTAGTTCAAAATTGTCAAATATAGAAACTAAAATTCTATTTTAATTTCTATATTTGGCAATTTATAGACTAAAATGAATAAAAATAAAGGGACTAAACATTAGTCCCTATAAACCAAACACCCCCTTAATATGATTCATATAATACCAATGCCATCAAGTGCACCTTATTTTTGGGAAGTTTATCTAAAAACAATCTGGATTAAATGTGTTTAGCTTAGATTTTTTTTTTTGGGGATGTGACAAAAATTCCCCTCGAGAGTAATCACTGCTGATCGTACTGTCCGTGAGAGACTGAAGTGTTACAAATTAACTTGAAGTTCTGTTACGAATTAACTTAAAAGTATAACTTCGAGTAGCAACCTTTCTACATCGTAACCAATCCACGTG;

[0071] The amplified sequence size of M158 in SSL3 is 321bp, and the amplified sequence is:

[0072] CCGAGTGTGAGTGAGGACAAAGTGTATAGAGGTGAACTGTGACTTCATAGGCCAATGCTTAATATGATTCATATAATACCAATGCCATCAAGTGCACCTTATTTTTGGGAAGTTTATCTAAAAACAATCTGGATTAAATGTGTTTAGCTTAGATTTTTTTTTTTGGGGATGTGACAAAAATTCCCCTCGAGAGTAATCACTGCTGATCGTACTGTCCGTGAGAGACTGAAGTGTTACAAATTAACTTGAAGTTCTGTTACGAATTAACTTAAAAGTATAACTTCGAGTAGCAACCTTTCTACATCGTAACCAATCCACGTG;

[0073] The amplified sequence size of M0900 in Xu 178 is 205bp, and the amplified sequence is:

[0074] ACGATGCATGGTTGGAGTTGGAGGGCTGAACGGTTCGGGCCTGGGTCAAATTCAACTACGTACCACGGAGTAGCAACACATCAGTTGCAATTTGCAAATACGCAGCCGACACGTTACCCCTTTTTTTTTGCACCCTTTTTGGTATCGCCTTAAACCGCCGCTTGAAGCATAAACGGAAACCATATGGGCCACTTTGTTTGATGG;

[0075] The amplified sequence size of M0900 in SSL3 is 215bp, and the amplified sequence is:

[0076] ACGATGCATGGTTGGAGTTGGAGGGCTGAACGGTTCGGGCCTGGGTCAAATTCAACTACGTACCACGGAGTAGCAACACATCAGTTGCAATTTGCAAATACGCAGCCTCTGGGCAGCCGACACGTTACCCCTTTTTTTTTGCACCCTTTTTGGTATCGCCTTAAACCGCCGCTTGAAGCATAAACGGAAACCATATGGGCCACTTTGTTTGATGG.

[0077] Example 2

[0078] The application of the molecular markers and their primers closely linked to the major QTL of maize ear length obtained in Example 1 in the genetic improvement of maize ear length, and the method for identifying the maize ear length trait in the process of maize ear length molecular marker-assisted breeding includes the following steps:

[0079] Extract the genomic DNA of maize leaves;

[0080] Using the genomic DNA of maize leaves as a template, perform PCR amplification respectively with the primers M158-F / M158-R and M0900-F / M0900-R;

[0081] Identification of PCR amplification results by agarose gel electrophoresis: When the primers used are M158-F / M158-R, if the size of the molecular marker M158 is detected to be 321 bp, it indicates that the spike length of the sample to be tested is longer; if the size of the molecular marker M158 is detected to be 502 bp, it indicates that the spike length of the sample to be tested is shorter; when the primers used are M0900-F / M0900-R, if the size of the molecular marker M0900 is detected to be 215 bp, it indicates that the spike length of the sample to be tested is longer; if the size of the molecular marker M0900 is detected to be 205 bp, it indicates that the spike length of the sample to be tested is shorter.

[0082] In this example, the PCR amplification system is 8 μL, and the components include: 2 μL of DNA, 1 μL of each of the left and right primers, and 4 μL of 2×Taq Master Mix (Novoprotein P112). The Touchdown PCR amplification program is used: 95°C for 5 min; 95°C for 30 s, 65°C for 30 s, with a decrease of 1°C for each cycle, 72°C for 45 s, for a total of 8 cycles; 95°C for 30 s, 58°C for 30 s, 72°C for 45 s, for a total of 28 cycles; 72°C for 10 min.

[0083] It should be noted that since the steps and methods used are the same as those in the examples, in order to prevent repetition, the preferred embodiments of the present invention are described. Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0084] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.

Claims

1. Use of primers for amplifying molecular markers tightly linked to the major QTL for maize ear length in genetic improvement of maize ear length, characterized in that, The molecular markers are located on chromosome 3 of maize, and are molecular marker M158 and molecular marker M0900; The primers for amplifying the molecular markers are: The primer sequences for amplifying the molecular marker M158 are: M158-F: 5’- CCGAGTGTGAGTGAGGACAA -3’; M158-R: 5’- CACGTGGATTGGTTACGATG -3’; The primer sequences for amplifying the molecular marker M0900 are: M0900-F: 5’- ACGATGCATGGTTGGAGTTG -3’; M0900-R: 5’- CCATCAAACAAAGTGGCCCA -3’; The method for identifying the maize ear length trait in the genetic improvement of maize ear length includes the following steps: Extract the genomic DNA of maize leaves; Using the genomic DNA of maize leaves as a template, perform PCR amplification respectively with the primers M158-F / M158-R and M0900-F / M0900-R; Identify the PCR amplification results by agarose gel electrophoresis: When the primers used are M158-F / M158-R, if the detected size of the molecular marker M158 is 321bp, it indicates that the ear length of the sample to be tested is longer; if the detected size of the molecular marker M158 is 502bp, it indicates that the ear length of the sample to be tested is shorter; When the primers used are M0900-F / M0900-R, if the detected size of the molecular marker M0900 is 215bp, it indicates that the ear length of the sample to be tested is longer; if the detected size of the molecular marker M0900 is 205bp, it indicates that the ear length of the sample to be tested is shorter.

2. Use of primers for amplifying molecular markers tightly linked to the major QTL for maize ear length in genetic improvement of maize ear length according to claim 1, characterized in that, The PCR amplification system for performing PCR amplification respectively with the primers M158-F / M158-R and M0900-F / M0900-R is 8 μL, and the components include: 2 μL of DNA, 1 μL of each of the left and right primers, and 4 μL of 2×TaqMaster Mix.

3. Use of primers for amplifying molecular markers tightly linked to the major QTL for maize ear length in genetic improvement of maize ear length according to claim 1, characterized in that, Use the Touchdown PCR amplification program: 95℃ for 5min; 95℃ for 30s, 65℃ for 30s, with a decrease of 1℃ for each cycle, 72℃ for 45s, a total of 8 cycles; 95℃ for 30s, 58℃ for 30s, 72℃ for 45s, a total of 28 cycles; 72℃ for 10 min.

Images