A SNP variation in the upstream regulatory region of land cotton ghhrk1 gene and application thereof

Abstract

The application belongs to the technical field of molecular markers and germplasm resource identification, and particularly relates to a SNP variation located on an upstream regulation region of a GhHRK1 gene of upland cotton and application thereof. The SNP variation is located on the upstream regulation region of the GhHRK1 gene, is closely linked with a high-temperature resistance phenotype, and a KASP marker is developed by using the SNP variation, so that the identification of high-temperature resistance of cotton germplasm can be realized, that is, only the genomic DNA of the cotton germplasm to be tested needs to be used as a template for PCR amplification, and then whether the cotton germplasm to be tested has high-temperature resistance can be accurately judged through a molecular marker band type, which is convenient and efficient, and provides a technical basis and support for cotton breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers and germplasm identification, and particularly relates to a SNP variation in an upstream regulatory region of a GhHRK1 gene of Gossypium hirsutum and application thereof. BACKGROUND

[0002] With the intensification of global warming in recent years, abnormal high temperature weather has occurred in many cotton areas in China and even around the world, causing male sterility of cotton and reducing yield, which restricts the development of the cotton industry. Cultivating high-temperature-resistant cotton varieties and improving the high-temperature resistance of existing cotton varieties are one of the needs of the current cotton industry system in China.

[0003] Molecular markers are DNA sequences with different information, which are a kind of genetic markers and can be used to distinguish genetic differences between different materials and evaluate genetic characteristics of loci. However, the phenotype of cotton high-temperature resistance is complex, the results of investigation are unstable, and the identification of genetic loci is difficult, so there are few cotton varieties resistant to high temperature, and few molecular markers can be used to evaluate and detect the high-temperature resistance of cotton, which needs to be developed and enriched. SUMMARY

[0004] The purpose of the application is to provide a SNP variation in an upstream regulatory region of a GhHRK1 gene of Gossypium hirsutum, which has been reported to negatively regulate the high-temperature resistance of cotton, and the SNP variation can be used to efficiently distinguish high-temperature-resistant cotton germplasm and high-temperature-sensitive cotton germplasm.

[0005] The application provides a SNP variation in an upstream regulatory region of a GhHRK1 gene, and the nucleotide sequence containing the SNP variation is shown as SEQ ID NO. 1; the SNP variation is located at 9094715bp of chromosome A01 of the Gossypium hirsutum genome, and there is an allelic variation of G->A compared with the reference genome.

[0006] The application also provides a KASP marker based on the SNP variation in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the KASP marker primer are shown as SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0007] The application also provides a kit, which comprises the KASP marker primer and the PCR amplification reagent in the above technical solution.

[0008] Preferably, the PCR amplification reagent comprises Taq DNA polymerase, dNTPs and buffer reagent.

[0009] The application further provides application of the SNP variation, the KASP marker or the kit in cotton breeding.

[0010] Preferably, the cotton breeding comprises identifying high temperature resistance of cotton.

[0011] Preferably, the cotton comprises Gossypium hirsutum.

[0012] The application further provides a method for detecting high temperature resistance of cotton, comprising the following steps:

[0013] The primer pair amplifies the genomic DNA of the cotton germplasm to be detected by PCR to obtain a PCR amplification product;

[0014] The PCR amplification product is detected by electrophoresis, when the PCR amplification product can specifically amplify a band, and contains a 300bp band type, the cotton germplasm to be detected is a high temperature resistant cotton germplasm;

[0015] When the PCR amplification product cannot specifically amplify a band or the amplified band type does not contain a 300bp band type, the cotton germplasm to be detected is a high temperature sensitive cotton germplasm.

[0016] Preferably, the annealing temperature during the PCR amplification is 59-60℃.

[0017] Preferably, the PCR amplification program is 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 59-60℃ annealing for 30s, 70-72℃ extension for 30s, 35 cycles; 72℃ final extension for 30s.

[0018] Beneficial effects:

[0019] The application provides a SNP variation located in an upstream regulatory region of a GhHRK1 gene of Gossypium hirsutum, a nucleotide sequence containing the SNP variation is shown in SEQ ID NO. 1; the SNP variation is located at 9094715bp of chromosome A01 of the Gossypium hirsutum genome, and an allelic variation of G->A exists compared with a reference genome. The SNP variation in the application is located in the upstream regulatory region of the GhHRK1 gene, is closely linked with a high temperature resistance phenotype, and a KASP marker is developed based on the SNP variation, so that rapid identification of high temperature resistance of cotton germplasm can be realized, i.e. only the genomic DNA of the cotton germplasm to be detected is needed as a template for PCR amplification, and whether the cotton germplasm to be detected has high temperature resistance can be accurately judged through a molecular marker band type, which is convenient and efficient, and provides a technical basis and support for cotton breeding. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows.

[0021] Figure 1 For the candidate gene association analysis based on the natural variation of the GhHRK1 locus in Example 1;

[0022] Figure 2 For the verification of the SNP variation at the physical position 9094715bp based on the Emian 19 and Jimian 15 varieties in Example 2;

[0023] Figure 3 For the development of the annealing sensitive KASP marker for the SNP variation (G->A) at the physical position 9094715bp in Example 2;

[0024] Figure 4 For the verification results of the KASP marker in the natural population resistant / sensitive high temperature materials in Example 3. DETAILED DESCRIPTION

[0025] The present application provides a SNP variation located on the upstream regulatory region of the GhHRK1 gene of Gossypium hirsutum, and the nucleotide sequence containing the SNP variation is shown as SEQ ID NO. 1; the SNP variation is located at 9094715bp of the Gossypium hirsutum genome, and there is an allelic variation of G->A compared with the reference genome.

[0026] In the present application, the nucleotide sequence shown as SEQ ID NO. 1 is preferably the DNA sequence of the 2000bp regulatory sequence upstream of the GhHRK1 gene, specifically The bold and underlined position is the position of the SNP variation, which has a G->A mutation compared with the reference genome, and is located at 9094715bp of chromosome A01 of the Gossypium hirsutum genome, the version of the cotton genome is 'TM-1_HAU-AD1_v1.1', which can be obtained from the CottonGen database at https: / / www.cottongen.org / data / download / genome_tetraploid / AD1.

[0027] The application further provides a KASP marker based on the SNP variation, wherein the nucleotide sequences of the upstream primer and the downstream primer of the KASP marker are shown in SEQ ID NO. 3 and SEQ ID NO. 4, and specifically are 5'-AGAAAGTTAGAAATCAACAATCAG-3' and 5'-TTCTAGATCTGACAATAGCGACGT-3', respectively.

[0028] The application further provides a kit comprising the primer of the KASP marker and PCR amplification reagents. The PCR amplification reagents comprise Taq DNA polymerase, dNTPs and buffer reagents. The buffer reagents preferably comprise 10x Buffer. The source of the PCR amplification reagents is not particularly limited, and a conventional commercially available product can be used. The PCR amplification reagents preferably further comprise ultrapure water. The mother liquor concentrations of the upstream primer and the downstream primer in the kit are preferably 10-20 mM, and more preferably 10 mM. The total amount of the PCR amplification reagents and the total amount of the primers in the kit are not particularly limited, and can be set according to the conventional demand of the kit.

[0029] The SNP variation is located in the upstream regulatory region of the GhHRK1 gene, is closely linked to the high-temperature resistance phenotype, and is developed into a KASP marker based on the SNP variation, so that the cotton germplasm high-temperature resistance can be identified, and the high-temperature resistant cotton germplasm and the high-temperature sensitive cotton germplasm can be efficiently distinguished.

[0030] Based on the above technical advantages, the application further provides the SNP variation, the KASP marker or the kit in the cotton breeding. The cotton breeding preferably comprises identifying the cotton high-temperature resistance, more preferably identifying the cotton anther high-temperature resistance, and specifically preferably identifying and distinguishing the high-temperature resistant cotton germplasm and the high-temperature sensitive cotton germplasm. The cotton preferably comprises upland cotton.

[0031] The application further provides a method for detecting the cotton high-temperature resistance, comprising the following steps:

[0032] The genomic DNA of the cotton germplasm to be detected is subjected to PCR amplification by using the primer pair, and a PCR amplification product is obtained;

[0033] The PCR amplification product is subjected to electrophoresis detection, and when the PCR amplification product can specifically amplify a band and contains a 300 bp band type, the cotton germplasm to be detected is a high-temperature resistant cotton germplasm;

[0034] When the PCR amplification product cannot specifically amplify a band or the amplified band type does not contain a 476bp band type, the cotton germplasm to be tested is a sensitive high-temperature cotton germplasm.

[0035] The application preferably extracts the genomic DNA of the cotton germplasm to be tested. The method for extracting the genomic DNA is not specifically limited in the application, and any commonly used method or kit for extracting genomic DNA can be used, such as the CTAB extraction method used in the examples of the application.

[0036] After the extraction, the genomic DNA of the cotton germplasm to be tested is subjected to PCR amplification by using the primer pair described in the technical solution of the application, to obtain a PCR amplification product. The PCR amplification system is preferably 20μL, and preferably includes the following components: 10×buffer 2.0μL, dNTPmix 0.3μL, Taq DNA polymerase 0.2μL, genomic DNA 1μL (75-100ng), upstream primer 0.5μL, downstream primer 0.5μL and sterile water 15.5μL. The annealing temperature during the PCR amplification is preferably 59-60℃, and more preferably 60℃. The PCR amplification program is specifically preferably 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 59-60℃ annealing for 30s, 70-72℃ extension for 30s, 35 cycles; 72℃ final extension for 30s.

[0037] After obtaining the PCR amplification product, the PCR amplification product is subjected to electrophoresis detection, when the PCR amplification product can specifically amplify a band, and contains a 300 bp band type, the cotton germplasm to be tested is a high-temperature-resistant cotton germplasm; when the PCR amplification product cannot specifically amplify a band or the amplified band type does not contain a 300 bp band type, the cotton germplasm to be tested is a high-temperature-sensitive cotton germplasm. The 300 bp band type corresponds to the sequence shown in SEQ ID NO. 5, specifically 5'-AGAAAGTTAGAAATCAACAATCAGGATTTTGTTTTGCAATTTTCACCATTCCATTATTTTGGGGGGAAAATTGTTATGTAGATTTGAAAGTTTCATGGCGGTTTTATATAGCACCCAGAAAACAGGATTTCTGTTGAAAATGCAATAAATATTCAAGCATGATGGCTACCATGCAGTCAACAATTATGTAACATATTATGGTCAAAGCAGCCAATTTTCAATGTTATCTCTTCGTTTATATCTTTTGTCTGGTCCATATAAATAGGCTTATATCTAACGTCGCTATTGTCAGATCTAGAA-3'.

[0038] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0039] The cotton germplasm used in the following examples is selected from a natural population of upland cotton germplasm resources. Related research on this natural population of upland cotton germplasm resources has been published (DOI: 10.1038 / ng.3807.), and the germplasm population is composed of directly purchased or introduced from the germplasm resource library, and the original source is introduced from abroad.

[0040] Example 1

[0041] Candidate gene association analysis based on natural variation of GhHRK1 gene

[0042] Firstly, the published 376 upland cotton re-sequencing data is used to construct the upland cotton natural variation map (DOI: 10.1038 / s41588-021-00844-9); combined with the published 218 cotton natural population pollen high temperature resistance phenotype (DOI: 10.1111 / nph.17325), the variation information (including 1500 bp before the start codon and 1500 bp after the stop codon) on the GhHRK1 locus is retrieved for candidate gene association analysis, and the analysis steps are as follows:

[0043] 1. Obtain the variation information between 9,093,555bp to 9,105,018bp in natural variation map (summarized in Table 1). According to the information in Table 1, there are 25 SNP variations in GhHRK1 locus, of which 24 are in intron and 1 is in upstream regulatory region.

[0044] 2. After grouping the cotton variety materials according to different genotypes, calculate the average value of pollen viability phenotype after high temperature stress, and perform group t test, and the p value is the correlation between variation and phenotype after t test, and less than 0.01 is the significant threshold.

[0045] 3. According to the analysis of step 2, of the 25 SNP variations, 10 SNP variations are significantly related to the phenotype, of which 9 are in intron and 1 is in upstream regulatory region, such as Figure 1 a, wherein a is the correlation between variation at different physical positions and pollen viability phenotype, the X axis is the physical position of SNP in Table 1 on the genome, and the Y axis is -log(p), wherein p is the t test result in Table 1.

[0046] 4. Since the regulatory region has a relatively more important role in the expression change of the gene, and the variation G->A in the regulatory region (such as Figure 1 b) also has a significant negative correlation with the phenotype (p=1.20E-09), Figure 1 b, wherein the distribution of SNP variation on the GhHRK1 gene model is marked with different colors according to the significant correlation threshold of p value less than 0.01, wherein the blue mark is the mark with p value greater than 0.01, the green mark is the significantly associated variation in the upstream regulatory sequence of GhHRK1 (physical position 9094715bp), and the red mark is the significantly associated variation in the intron of GhHRK1.

[0047] Therefore, in this embodiment, SNP in the regulatory region (at physical position 9094715bp, obtained based on 'TM-1_HAU-AD1_v1.1' genome) is used for marker development.

[0048] Table 1 Summary of natural population variation information

[0049]

[0050] Note: The categories in the table header represent Type: type of variation; Pos: genomic physical position; Ref: reference genotype; Alt: variant genotype; Dist to ATG: physical distance to the start codon (negative value indicates upstream regulatory region of the start codon); PV_ref_mean: average pollen viability of cotton materials with reference genotype; PV_alt_mean: average pollen viability of cotton materials with variant genotype; T.test_p: T-test p value of pollen viability of the two genotypes.

[0051] Example 2

[0052] Molecular marker development

[0053] 2.1 Verification of authenticity of molecular marker (taking 9094715bp physical position G->A as an example)

[0054] According to the material information and corresponding genotype information in the variation map of Example 1, one material each with genotype G and A at the position of 9094715bp was selected. In this example, two materials Emian19 (G) and Jimian15 (A) in the natural population were used for molecular marker amplification, and the main steps were as follows:

[0055] 1. According to the GhHRK1 upstream regulatory sequence in SEQ ID NO. 1 and the marker position, PCR primers were designed, and the upstream primer and the downstream primer were shown in SEQ ID NO. 2 (5'-GGTTGTATTGCACACCAAACTAGA-3') and SEQ ID NO. 4, respectively.

[0056] 2. Genomic DNA was extracted from Emian 19 and Jimian 15 materials using the CTAB method. Specifically, fresh leaves were placed in 2 mL centrifuge tubes, clean steel balls were added, and 200 μL of extraction buffer (0.35 M glucose, 0.1 M Tris-HCl, 0.005 M Na2EDTA, 2% PVP K-30, and 0.1% DIECA, pH 7.5) was added. The tubes were then ground in a grinder (Shanghai Jingxin #Tissuelyser-192) for 60 s at 60 Hz. After grinding, 800 μL of lysis buffer (0.1 M Tris-HCl, 1.4 M NaCl, 0.02 M Na2EDTA, 2% CTAB, 2% PVP K-30, and 0.1% DIECA, pH 7.5) was added. 8.0); After bathing in a 65℃ water bath for 30 min, add 800 μL of chloroform (chloroform:isoamyl alcohol volume ratio of 24:1), gently invert, and extract for 20 min; after centrifugation at 12000 rpm for 8-10 min, transfer the supernatant and mix with an equal volume of isopropanol pre-cooled at -20℃. After mixing, flocculent DNA precipitate will appear; wash the DNA twice with 75% ethanol (volume percentage), dry in a laminar flow hood, and dissolve the DNA in ddH2O. Prepare the PCR amplification system according to the formula in Table 2, and perform PCR amplification according to the procedure in Table 3.

[0057] Table 2 PCR amplification system

[0058]

[0059] Table 3 PCR amplification program

[0060]

[0061] 3. After PCR amplification, the PCR product was cloned into the entry vector pTOPO-T (Aidlab#CV2101), heat-shocked into competent DH5α cells of *E. coli*, and 4-5 single clones were selected for sequencing using M13F universal primers to confirm the authenticity of the marker SNP in the sequence. Results are as follows: Figure 2 As shown.

[0062] Depend on Figure 2 It can be seen that the genotype of Emian 19 at the 9094715bp physical location is G; the genotype of Jimian 15 at the 9094715bp physical location is A, thus confirming the existence of marker SNP variants; among which... Figure 2a and b represent the genotype information of Emian 19 and Jimian 15 at 9094715bp, respectively. The genotype of Emian 19 at 9094715bp is G (high temperature resistant genotype), and the genotype of Jimian 15 at 9094715bp is A (high temperature sensitive genotype). The genotype information is obtained by using the upstream primer and the downstream primer shown in SEQ ID NO. 2 and SEQ ID NO. 4 for PCR amplification, cloning and Sanger sequencing, wherein the nucleotide sequences of the upstream primer and the downstream primer are 5'-GGTTGTATTGCACACCAAACTAGA-3' and 5'-TTCTAGATCTGACAATAGCGACGT-3', respectively.

[0063] 2.2 Optimal primer sequence and annealing temperature design

[0064] After confirming the authenticity of the marker, the number of materials was increased to explore the optimal primer sequence and annealing temperature. In this embodiment, according to the design principle of the annealing sensitive KASP marker (KASP, Kompetitive Allele Specific PCR), the primer sequence and the annealing temperature were designed and the marker was developed, and the steps were as follows: Figure 3 a. Taking the detection of G genotype as an example, after setting G base at the 3' end of the primer (SEQ ID NO. 3), the G base at the 3' end of the primer cannot anneal with A base at a certain specific annealing temperature, and PCR amplification cannot be successfully performed), the primer was designed and the marker was developed, and the steps were as follows:

[0065] 1. On the sequence of the sequencing result, keep the reverse primer SEQ ID NO. 4 unchanged, design the forward primer from the physical position of 9094715bp, keep the 3' end as G base, and design the annealing temperature of the forward primer and the reverse primer at about 55°C.

[0066] 2. Expand the material range, according to the genetic variation map in embodiment 1, select Emian 19, Zhemian 3, Xinluzhong 7, Xinluazao 11 and Deltapine SR-1 these five materials with G genotype and Jimian 15, Shaanmian 1, Hongyejijiaomian, Xinluzao 6 and Shaan 2786 these five materials with A genotype, according to the PCR amplification system in table 2 and the PCR amplification program in table 3 in embodiment 2, respectively, gradient annealing experiment from 55°C to 60°C every 1°C, Figure 3The middle b, wherein 10 parts of molecular markers of different genotypes of materials are amplified, wherein the five materials of Emian 19, Zhemian 3, Xinluzhong 7, Xinluazao 11 and Deltapine SR-1 are G genotype, and the five materials of Jimian 15, Shaanmian 1, Hongyejijiaomian, Xinluazao 6 and Shaan 2786 are A genotype. The primer with G base at the 3' end cannot be annealed with the sequence of the A genotype at the annealing temperature of 59 DEG C and 60 DEG C.

[0067] 3. According to the PCR amplification result, the material with genotype G can be normally amplified at the annealing temperature of 59 DEG C and 60 DEG C, and the material with genotype A basically has no PCR product, so as to ensure the authenticity of the amplification result, and finally 60 DEG C is selected as the optimum annealing temperature.

[0068] Example 3

[0069] Natural population level of molecular marker verification

[0070] Example 2 confirms the authenticity of the marker, and the optimum annealing temperature and primer sequence are explored. In this example, the annealing temperature and primer sequence confirmed in Example 2 are used, 47 parts of high-temperature-resistant materials and 47 parts of high-temperature-sensitive materials are selected according to the pollen vitality phenotype data of the natural population, and the DNA is extracted. With the reference genotype variety TM-1 of upland cotton as the control, the G base is set at the 3' end of the primer, and the PCR amplification is carried out at the annealing temperature of 60 DEG C. According to the PCR amplification system in Table 2 and the PCR amplification program in Table 3, the marker amplification of the 9094715bp physical position is carried out on the above-mentioned variety materials at the annealing temperature of 60 DEG C.

[0071] The PCR result shows that among the high-temperature-resistant materials, 40 parts of materials can be amplified to specific bands, 7 parts of materials have shallow band amplification or non-specific amplification ( Figure 4 The middle a, the red asterisk indicates that the material is not obviously amplified or not specific); among the high-temperature-sensitive materials, 9 parts of materials can be amplified to specific bands, 38 parts of materials have shallow band amplification or non-specific amplification ( Figure 4 The middle b, the blue asterisk indicates that the material is obviously amplified or specific); according to the chi-square test, the amplification efficiency between the high-temperature-resistant materials and the high-temperature-sensitive materials is significantly different, and the p value is 4.51E-28.

[0072] From the above example results, it can be concluded that the SNP variation provided by the application and the primer developed based on the SNP variation can realize the detection of high-temperature resistance of upland cotton, and effectively distinguish the high-temperature-resistant cotton germplasm and the high-temperature-sensitive cotton germplasm.

[0073] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Application of SNP variation in upstream regulatory region of Gossypium hirsutum L. GhHRK1 gene in identifying high temperature resistance of Gossypium hirsutum L., the nucleotide sequence containing the SNP variation is shown as SEQ ID NO. 1; the SNP variation is located at 9094715 bp of chromosome A01 of Gossypium hirsutum L. Gossypium hirsutum genome, and an allelic genotype variation of G to A exists compared with the reference genome; the version of the reference genome is TM-1_HAU-AD1_v1.

1.

2. Application of a reagent for detecting SNP variation in identifying high temperature resistance of Gossypium hirsutum, wherein the nucleotide sequence containing the SNP variation is shown as SEQ ID NO. 1; the SNP variation is located at 9094715 bp of chromosome A01 of Gossypium hirsutum (Gossypium hirsutum L.), Gossypium hirsutum and an allelic variation of G to A occurs compared with a reference genome; the version of the reference genome is TM-1_HAU-AD1_v1.

1.

3. Use according to claim 2, characterized in that, The reagent for detecting the SNP variation comprises KASP markers, and the nucleotide sequences of the upstream primer and the downstream primer of the KASP marker are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively.

4. Use according to claim 2, characterized in that, The reagent kit for detecting the SNP variation comprises KASP marker primers and PCR amplification reagents; the nucleotide sequences of the upstream primer and the downstream primer of the KASP marker primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively.

5. Use according to claim 4, characterized in that, The PCR amplification reagents comprise Taq DNA polymerase, dNTPs and buffer reagents.

6. A method of detecting heat tolerance in cotton, comprising, The method comprises the following steps: PCR amplification is performed on the genomic DNA of the cotton germplasm to be tested by using a primer pair, and a PCR amplification product is obtained; the nucleotide sequences of the upstream primer and the downstream primer of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively; The PCR amplification product is subjected to electrophoresis detection, and when the PCR amplification product can specifically amplify a band and contains a 300bp band type, the cotton germplasm to be tested is a high-temperature-resistant cotton germplasm; When the PCR amplification product cannot specifically amplify a band or the amplified band type does not contain a 300bp band type, the cotton germplasm to be tested is a high-temperature-sensitive cotton germplasm.

7. The method of claim 6, wherein, The annealing temperature during the PCR amplification is 59-60℃.

8. The method according to claim 6 or 7, characterized in that, The PCR amplification program is 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 59-60℃ annealing for 30s, 70-72℃ extension for 30s, 35 cycles; and 72℃ final extension for 30s.

Images