SlugCas9 mutant protein and its related applications

Abstract

The present application relates to the technical field of gene editing, in particular to a Slug mutant protein, a CRISPR / Cas9 gene editing system comprising the same, and application thereof. More particularly, the SlugCas9 mutant protein of the present application forms a complex with a single-stranded guide RNA, which has a simpler PAM than the wild-type SlugCas9 complex, a larger targeting range, can accurately locate a target DNA sequence and produce a cut, cause double-strand breakage damage to the target sequence, has high specificity, can reduce off-target rate of gene editing in cells or in vitro, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, specifically to a SlugCas9 mutant protein, a CRISPR / Cas9 gene editing system containing the SlugCas9, and related applications for gene editing. Background Technology

[0002] The CRISPR / Cas9 system is an acquired immune system evolved by bacteria and archaea to defend against invasion by exogenous viruses or plasmids. The CRISPR / Cas9 system contains tracrRNA (trans-activating RNA) and crRNA (CRISPR-derived RNA), which together with Cas9 form a complex to function. tracrRNA and crRNA can fuse into single-stranded guide RNA (sgRNA) through a linker sequence. When DNA breaks occur, two main DNA damage repair mechanisms in the cell are responsible for repair: non-homologous end-joining (NHEJ) and homologous recombination (HR). NHEJ repair results in base deletions or insertions, which can lead to gene knockout; when a homologous template is provided, HR repair can be used for site-specific gene insertion and precise base substitution.

[0003] The CRISPR / Cas9 system can target target sites with native neighbor (PAM) sequences at the 3' end. The simpler the PAM requirement of the CRISPR / Cas9 system, the larger its target range.

[0004] Beyond basic scientific research, the CRISPR / Cas9 gene editing system also holds broad clinical application prospects. Another key issue when using the CRISPR / Cas9 gene editing system for gene therapy is off-target effects. Off-target effects can damage normal genes, leading to cancer. Most CRISPR / Cas9 systems exhibit off-target effects.

[0005] Therefore, there is a need to develop a CRISPR / Cas9 system with simpler PAM requirements and higher specificity to expand the scope of gene editing, reduce off-target effects, and increase the safety of gene editing. Summary of the Invention

[0006] Through repeated research, the inventors identified mutation sites related to PAM recognition, targeting specificity, and cleavage activity of wild-type SlugCas9 protein, thereby obtaining a series of SlugCas9 mutant proteins, all of which can form a CRISPR / Cas9 gene editing system with enhanced cleavage specificity for effective gene editing with single-stranded guide RNA, thus completing this invention.

[0007] In summary, in a first aspect of the present invention, a SlugCas9 mutant protein is provided, the SlugCas9 mutant protein comprising a mutation at one or more amino acid residues corresponding to Q782, S888, L906, N984, E1012 and K1016 of the wild-type SlugCas9 protein.

[0008] In a second aspect, the present invention provides a conjugate comprising:

[0009] a) The SlugCas9 mutant protein described in the first aspect;

[0010] b) Modified parts; and

[0011] c) An optional adapter for connecting the SlugCas9 mutant protein to the modified portion.

[0012] In a third aspect, the present invention provides a fusion protein comprising:

[0013] a) The SlugCas9 mutant protein described in the first aspect;

[0014] b) Other proteins and peptides; and

[0015] c) Optional adapters for connecting the SlugCas9 mutant protein to the other proteins and peptides.

[0016] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following:

[0017] a) The SlugCas9 mutant protein described in the first aspect;

[0018] b) The conjugate described in the second aspect; or

[0019] c) The fusion protein described in the third aspect.

[0020] In a fifth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the following:

[0021] a) The SlugCas9 mutant protein described in the first aspect;

[0022] b) The conjugate described in the second aspect; or

[0023] c) The fusion protein described in the third aspect.

[0024] In a sixth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0025] 1) Protein components, which include:

[0026] a) The SlugCas9 mutant protein described in the first aspect;

[0027] b) The conjugate described in the second aspect; or

[0028] c) The fusion protein described in the third aspect;

[0029] as well as

[0030] 2) A single-stranded guide RNA, wherein the single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end;

[0031] Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex.

[0032] In a seventh aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule described in the fourth aspect, or the carrier described in the fifth aspect.

[0033] In an eighth aspect, the present invention provides a method for gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the intracellular or in vitro environment:

[0034] (1) The SlugCas9 mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0035] (2) The isolated nucleic acid molecules described in the fourth aspect;

[0036] (3) The carrier described in the fifth aspect; and

[0037] (4) The CRISPR / Cas9 gene editing system described in the sixth aspect;

[0038] The single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

[0039] The SlugCas9 mutant protein, the conjugate, or the fusion protein recognizes a protospacer adjacent sequence (PAM) located at the 3' end of the target sequence and having the sequence 5'-NNGG or 5'-NNG.

[0040] In a ninth aspect, the present invention provides a kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising:

[0041] a) Choose any one of (1) to (4) below:

[0042] (1) The SlugCas9 mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0043] (2) The isolated nucleic acid molecules described in the fourth aspect;

[0044] (3) The carrier described in the fifth aspect; and

[0045] (4) The CRISPR / Cas9 gene editing system described in the sixth aspect;

[0046] The single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end; and

[0047] b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment.

[0048] The inventors of this invention have developed a variety of SlugCas9 mutant proteins based on the wild-type SlugCas9 protein (having the amino acid sequence shown in SEQ ID NO:1). The SlugCas9 mutant proteins contain mutations at one or more amino acid residues corresponding to Q782, S888, L906, N984, E1012 and K1016 of the wild-type SlugCas9 protein, thereby having simpler PAM requirements and exhibiting lower off-target rates and higher specificity.

[0049] The SlugCas9 mutant protein of this invention can form a complex with sgRNA for gene editing. Compared to wild-type SlugCas9, the gene editing tool using the SlugCas9 mutant protein of this invention, which has multiple mutation sites, especially at least two mutation sites, can recognize PAMs that change from NNGG in the wild-type protein to NNG, thus providing more target sites and higher specificity. Furthermore, due to the relatively small number of amino acids and small molecular weight of the protein, it can be easily packaged into vectors such as adeno-associated viruses, making it very suitable for later development as a gene therapy tool. Therefore, this invention further expands the scope of gene editing and has broad application prospects in the field of gene editing. Attached Figure Description

[0050] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below.

[0051] Figure 1 The PAM requirements for CRISPR / Cas9 gene editing systems, including wild-type SlugCas9 and the mutant proteins SlugCas9-N984S and SlugCas9-K1016I of the present invention, are shown.

[0052] Figure 2 The PAM requirements for CRISPR / Cas9 gene editing systems including the mutant proteins of the present invention, SlugCas9-2mut (including mutation sites N984S and K1016I), SlugCas9-5mut (including mutation sites Q782R, S888R, L906R, E1012K and K1016I), and SlugCas9-6mut (including mutation sites Q782R, S888R, L906R, N984S, E1012K and K1016I), are shown.

[0053] Figure 3 A schematic diagram showing a comparison of the specificity detection results of gene editing systems including wild-type SlugCas9 and the mutant protein SlugCas9-5mut of the present invention in the HEK293T cell line of the GFP reporter system is presented.

[0054] Figure 4 A schematic diagram showing a comparison of the specificity detection results of gene editing systems including wild-type SlugCas9 and the mutant protein SlugCas9-6mut of the present invention in the HEK293T cell line of the GFP reporter system is presented.

[0055] Figure 5The results show the editing efficiency of gene editing systems including wild-type SlugCas9 and the mutant proteins SlugCas9-5mut or SlugCas9-6mut of the present invention for multiple target sites. Detailed Implementation

[0056] The present invention will be described in detail below with reference to the accompanying drawings. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0057] definition

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0059] In cases where numerical ranges are provided, such as concentration ranges, percentage ranges, or ratio ranges, it should be understood that, unless the context explicitly specifies otherwise, all intermediate values ​​between the upper and lower limits of the range, up to one-tenth of the lower limit unit, and any other values ​​or intermediate values ​​within the range are included in the subject matter. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, limited by any specific excluded limit values ​​within the range. Where the range includes one or two limit values, the range excluding any one or both of those included limit values ​​is also included in the subject matter.

[0060] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of." The expressions "comprising," "including," or "basically / mainly composed of" are generally understood as open-ended expressions, indicating that they include not only the elements, components, parts, or method steps specifically listed after the expression, but also other elements, components, parts, or method steps. However, in this document, the expressions "comprising," "including," or "basically / mainly composed of" can also be understood as closed-ended expressions in certain cases, indicating that they only include the elements, components, parts, or method steps specifically listed after the expression, and do not include any other elements, components, parts, or method steps. In this case, the expression is equivalent to the expression "composed of."

[0061] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0062] The terms “SlugCas9 protein,” “Cas9,” and “Cas” as used herein are interchangeable and refer to RNA-guided nucleases, including the SlugCas9 protein or its functionally active fragments. The SlugCas9 protein is a protein component of the CRISPR / Cas9 genome editing system that, guided by single-stranded guide RNA (sgRNA), targets and cleaves DNA target sequences, forming DNA double-strand breaks (DSBs). DNA double-strand breaks can activate the cell’s inherent repair mechanisms of non-homologous end-joining (NHEJ) and homologous recombination (HR), thereby repairing DNA damage in the cell. During the repair process, the specific DNA sequence is edited at specific sites.

[0063] The terms “guide RNA,” “gRNA,” “sgRNA,” or “mature crRNA” as used herein are interchangeable and have the meanings commonly understood by those skilled in the art. Generally, a single-stranded guide RNA may comprise a scaffold sequence and a guide sequence, also referred to herein as guide RNA (or gRNA). In the context of an endogenous CRISPR system, the guide sequence is also referred to as a spacer sequence. In some cases, the guide sequence is any polynucleotide sequence that is sufficiently similar to a target sequence to hybridize with said target sequence and guide the specific binding of the CRISPR / Cas9 complex to said target sequence. In some embodiments, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimal alignment is achieved. Determining optimal alignment is within the capabilities of those skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan. As used herein, the term "CRISPR / Cas9 complex" refers to a complex formed by the binding of a single-stranded guide RNA or mature crRNA to the SlugCas9 protein, which contains a guide sequence that hybridizes to a target sequence, thereby enabling the SlugCas9 protein to bind to said target sequence. This complex is capable of recognizing and cleaving polynucleotides that hybridize with the single-stranded guide RNA.

[0064] Therefore, in the formation of the CRISPR / Cas9 complex, the "target sequence" refers to a polynucleotide targeted by a guide sequence designed to be targeted, such as a sequence complementary to the guide sequence, where hybridization between the target sequence and the guide sequence will promote the formation of the CRISPR / Cas9 complex. Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of the CRISPR / Cas9 complex. The target sequence can include any polynucleotide, such as DNA. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In other cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast.

[0065] As used herein, the term "target sequence" or "target polynucleotide" can refer to any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM). The precise sequence and length requirements for the PAM vary depending on the Cas protein used, but the PAM is typically a 2-5 base sequence adjacent to the protospacer sequence (target sequence). Those skilled in the art can identify the PAM sequence used with a given Cas protein.

[0066] The terms “polynucleotide,” “nucleic acid sequence,” “nucleotide sequence,” or “nucleic acid fragment” used herein are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0067] In the sequences used in this invention, degenerate bases are sometimes used to represent bases at one or more positions. Degenerate bases can be represented by the letters R, Y, M, K, S, W, H, B, V, D, and N, where R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents C / G, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0068] The terms “polypeptide,” “peptide,” and “protein” as used herein are used interchangeably to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and also to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.

[0069] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. A vector is called an expression vector when it enables the expression of a protein encoded by the inserted polynucleotide, or when it enables transcription of the inserted polynucleotide (e.g., to generate mRNA or functional RNA). Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to, plasmid vectors and viral vectors. Vectors may also contain various regulatory sequences that regulate expression. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein, referring to a nucleotide sequence located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that affects transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. These regulatory sequences may originate from different sources or from the same source but arranged in a manner different from what is typically found naturally. Additionally, vectors may contain a replication initiation site.

[0070] As used herein, the term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the invention, a promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it originates from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.

[0071] As used in this article, the term "constitutive promoter" refers to a promoter that generally causes gene expression in most cell types and under most conditions. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to promoters that are primarily, but not necessarily, expressed specifically in a single tissue or organ, and may also be expressed in a specific cell type. "Developmental regulatory promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoter" selectively expresses a manipulated DNA sequence in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0072] "Introducing" nucleic acid molecules (such as plasmids, linear nucleic acid fragments, RNA, etc.) or proteins into an organism refers to transforming the cells of an organism with the nucleic acid or protein, enabling the nucleic acid or protein to function within the cell. The term "transformation" as used in this invention includes both stable transformation and transient transformation.

[0073] The terms “identity,” “consistency,” or “homology” used in this article have the generally accepted meanings in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using publicly available techniques. Sequence identity can be measured along the full length of a polynucleotide or polypeptide or along a region of the molecule (see, for example, Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While many methods exist for measuring the identity between two polynucleotides or peptides, the term "identity" is known to those skilled in the art to refer to conserved amino acid substitutions in peptides or proteins that can generally be performed without altering the biological activity of the resulting molecule. Typically, those skilled in the art recognize that a single amino acid substitution in a non-essential region of a peptide does not substantially alter its biological activity (see, for example, Watson et al., Molecular Biology of the Gene, 4). th Edition, 1987, The Benjamin / Cummings Pub. co., p. 224).

[0074] As used in this article, the term "stable transformation" refers to the introduction of a foreign nucleotide sequence into the genome, resulting in the stable inheritance of the foreign gene. Once stable transformation occurs, the foreign nucleic acid sequence is stably integrated into the genome of the organism and its subsequent generations.

[0075] The term "transient transformation" as used in this article refers to the introduction of nucleic acid molecules or proteins into cells to perform their functions without the stable inheritance of the foreign gene. In transient transformation, the foreign nucleic acid sequence does not integrate into the genome.

[0076] As used herein, the term "complementarity" refers to the ability of one nucleic acid sequence to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. The complementarity percentage indicates the percentage of residues in one nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with another nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementarity out of 10). "Complete complementarity" means that all consecutive residues in one nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in another nucleic acid sequence. As used herein, “substantially complementary” refers to a complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% in a region having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.

[0077] As used in this paper, the hybridization-related term "strict condition" refers to conditions under which a nucleic acid complementary to a target sequence hybridizes primarily with that target sequence and substantially does not hybridize to non-target sequences. Strict conditions are typically sequence-dependent and depend on many factors. Generally, the longer the sequence, the higher the temperature at which it specifically hybridizes to its target sequence. A non-limiting example of a strict condition is described in Tijssen, 1993, *Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization With Nucleic Acid Probes*, Section I, Chapter II, "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, New York.

[0078] As used herein, the term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of these nucleotide residues. Hydrogen bonds can occur via Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can consist of two strands forming a duplex, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization can be a step in a broader process, such as the initiation of PCR or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is called the "complement" of that given sequence.

[0079] SlugCas9 protein

[0080] In a first aspect of the invention, a SlugCas9 mutant protein is provided, the SlugCas9 mutant protein comprising a mutation at one or more amino acid residues corresponding to Q782, S888, L906, N984, E1012 and K1016 of the wild-type SlugCas9 protein.

[0081] The wild-type SlugCas9 protein used in this paper has the amino acid sequence shown in SEQ ID NO:1.

[0082] In one specific implementation, the mutation is one or more mutations selected from Q782R, S888R, L906R, N984S, E1012K, and K1016I.

[0083] In yet another specific implementation, the mutation is Q782R, S888R, L906R, N984S, E1012K, or K1016I.

[0084] In yet another specific implementation, the SlugCas9 mutant protein relative to the wild-type SlugCas9 protein may include multiple mutations from Q782R, S888R, L906R, N984S, E1012K, and K1016I, such as two, three, four, five, or six mutations.

[0085] The inventors discovered that when the SlugCas9 mutant protein of the present invention includes point mutations of Q782R, S888R, L906R, N984S, E1012K, or K1016I relative to the wild-type SlugCas9 protein, the recognizable PAM is NNGG. However, unexpectedly, when the SlugCas9 mutant protein of the present invention includes two (e.g., including mutation sites N984S and K1016I) or more (e.g., five or six) mutations relative to the wild-type SlugCas9 protein, the recognizable PAM changes from NNGG of the wild-type protein to NNG, thereby having more target sites and higher specificity.

[0086] Therefore, in a preferred embodiment, the SlugCas9 mutant protein relative to the wild-type SlugCas9 protein may include at least two mutations among Q782R, S888R, L906R, N984S, E1012K, and K1016I.

[0087] In a more preferred embodiment, the SlugCas9 mutant protein relative to the wild-type SlugCas9 protein may include a combination of mutations of N984S and K1016I.

[0088] In a further preferred embodiment, the SlugCas9 mutant protein relative to the wild-type SlugCas9 protein may include a combination of mutations of Q782R, S888R, L906R, E1012K, and K1016I, or a combination of mutations of Q782R, S888R, L906R, N984S, E1012K, and K1016I.

[0089] In a further preferred embodiment, the SlugCas9 mutant protein has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even higher (e.g., 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 99.999%) sequence identity with the wild-type SlugCas9 protein.

[0090] Derivatized proteins

[0091] Proteins can be derivatized, for example, by linking them to other molecules (e.g., other proteins or peptides). Typically, protein derivatization (e.g., labeling) does not adversely affect the protein's desired activity (e.g., activity binding to single-stranded guide RNA, endonuclease activity, activity of binding to and cleaving a target sequence at a specific site guided by guide RNA). Therefore, the SlugCas9 mutant protein of the present invention is also intended to include such derivatized forms. For example, the SlugCas9 mutant protein of the present invention can be functionally linked (by chemical coupling, gene fusion, non-covalent linkage, or other means) to one or more other molecular moieties, such as other proteins or peptides, detectable labels, pharmaceutical reagents, etc.

[0092] Specifically, the SlugCas9 mutant protein can be linked to other functional units. For example, it can be linked to a nuclear localization signal (NLS) sequence to enhance the protein's ability to enter the cell nucleus. For example, it can be linked to a targeting moiety to make the SlugCas9 mutant protein of the present invention targeted. For example, it can be linked to a detectable tag to facilitate the detection of the SlugCas9 mutant protein of the present invention. For example, it can be linked to an epitope tag to facilitate the expression, detection, tracing, and / or purification of the SlugCas9 mutant protein of the present invention.

[0093] Therefore, in a second aspect, the present invention provides a conjugate comprising:

[0094] a) The SlugCas9 mutant protein described in the first aspect;

[0095] b) Modified parts; and

[0096] c) An optional adapter for connecting the SlugCas9 mutant protein to the modified portion.

[0097] It is understandable that, in addition to the SlugCas9 mutant protein itself, the SlugCas9 mutant protein can also be combined with other substances such as other proteins or tagged objects to give it other functions.

[0098] Therefore, in one specific implementation, the modified portion may be another protein or polypeptide, a detectable label, or a combination thereof.

[0099] In a further embodiment, the additional protein or polypeptide is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal (NLS) sequences, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressor KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

[0100] Epitope tags are well known to those skilled in the art, and examples include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select an appropriate epitope tag according to the desired purpose (e.g., purification, detection, or tracing).

[0101] Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, and BFP.

[0102] Detectable markers are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0103] The SlugCas9 mutant protein of the present invention can be coupled, conjugated, or fused to the modified moiety via a linker, or it can be directly linked to the modified moiety without a linker. Linkers are well known in the art, and examples of them may include, but are not limited to, linkers containing 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0104] In a third aspect, the present invention provides a fusion protein comprising:

[0105] a) The SlugCas9 mutant protein described in the first aspect;

[0106] b) Other proteins and peptides; and

[0107] c) Optional adapters for connecting the SlugCas9 mutant protein to the other proteins and peptides.

[0108] Similar to the second aspect of the invention, the additional protein or polypeptide may be selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal (NLS) sequences, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressor KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

[0109] Epitope tags are well known to those skilled in the art, and examples include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select an appropriate epitope tag according to the desired purpose (e.g., purification, detection, or tracing). Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0110] Reporter proteins are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, and BFP.

[0111] The SlugCas9 mutant protein of the present invention can be coupled, conjugated, or fused to the other proteins or peptides via a linker, or can be directly linked to the other proteins or peptides without a linker. Linkers are well known in the art, and examples include, but are not limited to, linkers containing 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0112] The SlugCas9 mutant protein of this invention has a relatively small number of amino acids, enabling it to form a complex with sgRNA for precise gene editing, and it can perform gene editing in a eukaryotic environment. The inventors unexpectedly discovered that, compared to the wild-type SlugCas9 protein, gene editing tools containing the SlugCas9 mutant protein of this invention with multiple mutation sites can recognize simpler PAMs, namely 5'-NNGs, such as 5'-AGGA, 5'-GTGA, 5'-GCGT, 5'-CTGT, 5'-GTGC, 5'-GAGC, 5'-GTGG, or 5'-TGGG, and exhibit higher editing efficiency and specificity. Furthermore, due to its small molecular weight, it can be easily packaged into vectors such as adeno-associated viruses, making it highly suitable for later development as a gene therapy tool. This invention expands the scope of gene editing and has broad application prospects in the field of gene editing.

[0113] Nucleic acid encoding and vectors

[0114] In a fourth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following:

[0115] a) The SlugCas9 mutant protein described in the first aspect;

[0116] b) The conjugate described in the second aspect; or

[0117] c) The fusion protein described in the third aspect.

[0118] In one specific implementation, the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a single-stranded guide RNA, the single-stranded guide RNA including a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

[0119] In a further specific embodiment, the scaffold sequence may be any of the nucleic acid sequences shown in SEQ ID NO:2-4, but is not limited thereto, as long as it can be used in conjunction with the SlugCas9 mutant protein of the present invention to perform gene editing or other functions.

[0120] In a further specific embodiment, the CRISPR spacer sequence is a sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that is complementary to the target sequence.

[0121] In a preferred embodiment, the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

[0122] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 3' end of the scaffold sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0123] The single-stranded guide RNA can bind to the aforementioned SlugCas9 mutant protein, conjugate, or fusion protein to form a complex. This complex can recognize the PAM sequence (5'-NNGG or 5'-NNG) and thereby bind to the target sequence, thus achieving the cleavage of the target sequence or gene editing.

[0124] After the isolated nucleic acid molecules of the present invention are transfected into the corresponding cells using certain tools known in the art, such as expression vectors, the isolated nucleic acid molecules of the present invention can express the SlugCas9 mutant protein, its conjugates or fusion proteins, and / or the single-stranded guide RNA described above, and perform the corresponding functions, such as gene editing.

[0125] In addition, the isolated nucleic acid molecules of the present invention can express SlugCas9 protein, its conjugates or fusion proteins, and single-stranded guide RNA individually or separately, or they can express the expression products together, depending on the specific circumstances.

[0126] Furthermore, the expressed product has the corresponding effects and / or functions described above, which will not be repeated here for the sake of brevity.

[0127] In a fifth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the following:

[0128] a) The SlugCas9 mutant protein described in the first aspect;

[0129] b) The conjugate described in the second aspect; or

[0130] c) The fusion protein described in the third aspect.

[0131] In one specific implementation, the vector can be an expression vector, such as a plasmid vector like pUC19 vector, an applicator vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

[0132] In yet another specific implementation, the vector further comprises a nucleic acid sequence encoding a single-stranded guide RNA, the single-stranded guide RNA including a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

[0133] In a further specific embodiment, the scaffold sequence may be any of the nucleic acid sequences shown in SEQ ID NO:2-4, but is not limited thereto.

[0134] In a further specific embodiment, the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides, that is complementary to the target sequence.

[0135] In a preferred embodiment, the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

[0136] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 3' end of the scaffold sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0137] The single-stranded guide RNA can bind to the aforementioned SlugCas9 mutant protein, conjugate, or fusion protein to form a complex. This complex can recognize the PAM sequence (5'-NNGG or 5'-NNG) and thereby bind to the target sequence, thus achieving the cleavage of the target sequence or gene editing.

[0138] As described above, after the vector of the present invention is transfected into cells, the coding sequence cloned in the vector can be expressed as a SlugCas9 mutant protein, its conjugates or fusion proteins, and / or the single-stranded guide RNA described above, and perform the corresponding functions therein. For example, gene editing.

[0139] Alternatively, multiple vectors, such as two vectors, can be transfected into cells. One vector expresses the SlugCas9 mutant protein, its conjugates, or fusion proteins, while the other vector expresses single-stranded guide RNA. Subsequently, the expressed SlugCas9 mutant protein, its conjugates, or fusion proteins combine with the expressed single-stranded guide RNA to form a complex, which then performs its corresponding function, such as gene editing.

[0140] Alternatively, the nucleic acid sequence encoding the SlugCas9 mutant protein, its conjugate or fusion protein, and the nucleic acid sequence encoding the single-stranded guide RNA can be cloned into a vector, so that after the vector is transfected into cells, it expresses both the SlugCas9 mutant protein, its conjugate or fusion protein, and the single-stranded guide RNA, and performs the corresponding functions, such as gene editing.

[0141] CRISPR / Cas9 gene editing system

[0142] In a sixth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0143] 1) Protein components, which include:

[0144] a) The SlugCas9 mutant protein described in the first aspect;

[0145] b) The conjugate described in the second aspect; or

[0146] c) The fusion protein described in the third aspect;

[0147] as well as

[0148] 2) A single-stranded guide RNA, wherein the single-stranded guide RNA comprises a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end;

[0149] Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex.

[0150] In a further specific embodiment, the scaffold sequence may be any of the nucleic acid sequences shown in SEQ ID NO:2-4, but is not limited thereto.

[0151] In a further specific embodiment, the CRISPR spacer sequence is a sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length that is complementary to the target sequence.

[0152] In a preferred embodiment, the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

[0153] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 3' end of the scaffold sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0154] The CRISPR / Cas9 gene editing system of this invention can be directly constructed from the SlugCas9 mutant protein, its conjugates or fusion proteins, and single-stranded guide RNA as described herein, or it can be constructed from the expression products obtained by expressing isolated nucleic acid molecules or vectors as described herein. The CRISPR / Cas9 gene editing system of this invention achieves the recognition, localization, cleavage, and gene editing of target sequences through the combined action of the SlugCas9 mutant protein and single-stranded guide RNA contained therein.

[0155] The CRISPR / Cas9 gene editing system of this invention can precisely locate the target sequence. "Precisely located" has two meanings: first, the CRISPR / Cas9 gene editing system itself can recognize and bind to the target sequence; second, the CRISPR / Cas9 gene editing system can bring other proteins fused with the SlugCas9 mutant protein or proteins that specifically recognize the sgRNA to the location of the target sequence.

[0156] The CRISPR / Cas9 gene editing system of the present invention has low tolerance for non-target sequences. In this document, "low tolerance" means that the CRISPR / Cas9 gene editing system of the present invention is substantially or completely unable to recognize and bind to non-target sequences, or substantially or completely unable to bring other proteins fused with the SlugCas9 mutant protein or proteins that specifically recognize the sgRNA to the location of the non-target sequence.

[0157] The CRISPR / Cas9 gene editing system of this invention has a wider gene editing targeting range. Because the SlugCas9 mutant protein of this invention, which includes multiple mutation sites, recognizes a simpler PAM sequence (5'-NNG) than the wild-type SlugCas9 protein, it can target more DNA sequences in the genome, thus achieving a broader targeting range.

[0158] cell

[0159] In a seventh aspect, the present invention provides a cell comprising: the isolated nucleic acid molecule described in the fourth aspect, or the carrier described in the fifth aspect.

[0160] As an example, the cell can be a prokaryotic cell or an animal cell. For the animal cell, as an example, it can be a mammalian cell, such as a human cell.

[0161] method

[0162] In an eighth aspect, the present invention provides a method for gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: contacting any one of the following (1) to (4) with the target sequence in the intracellular or in vitro environment:

[0163] (1) The SlugCas9 mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0164] (2) The isolated nucleic acid molecules described in the fourth aspect;

[0165] (3) The carrier described in the fifth aspect; and

[0166] (4) The CRISPR / Cas9 gene editing system described in the sixth aspect;

[0167] The single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

[0168] The SlugCas9 mutant protein, the conjugate, or the fusion protein recognizes a protospacer adjacent sequence (PAM) located at the 3' end of the target sequence and having a 5'-NNG sequence.

[0169] In one embodiment, the scaffold sequence may be any of the nucleic acid sequences shown in SEQ ID NO:2-4, but is not limited thereto.

[0170] In a further specific embodiment, the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides, that is complementary to the target sequence.

[0171] In a preferred embodiment, the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

[0172] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 3' end of the scaffold sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0173] In one specific implementation, the PAM sequence can be 5'-AGGA, 5'-GTGA, 5'-GCGT, 5'-CTGT, 5'-GTGC, 5'-GAGC, 5'-GTGG, or 5'-TGGG.

[0174] In one specific implementation, the cell is a prokaryotic cell or an animal cell, and the animal cell is, for example, a mammalian cell such as a human cell.

[0175] In yet another specific implementation, the gene editing includes one or more of the following: gene knockout of a target sequence, site-specific base alteration, site-specific insertion, regulation of gene transcription, regulation of DNA methylation, DNA acetylation modification, histone acetylation modification, single-base conversion, and chromatin imaging tracking. For example, the single-base conversion includes adenine to guanine, cytosine to thymine, or cytosine to uracil.

[0176] Regarding items (2) and (3) above, as can be understood from the above description, the isolated nucleic acid molecule described in the fourth aspect of the present invention and the vector described in the fifth aspect may, in some cases, contain only a nucleic acid sequence encoding a SlugCas9 mutant protein or its conjugate or fusion protein, and in other cases, may contain a nucleic acid sequence encoding a SlugCas9 mutant protein or its conjugate or fusion protein and a nucleic acid sequence encoding a single-stranded guide RNA. Therefore, depending on the circumstances, the isolated nucleic acid molecule or the vector may further contain a nucleic acid sequence encoding a single-stranded guide RNA.

[0177] Furthermore, it is understood that the single-stranded guide RNA mentioned herein as "an isolated nucleic acid molecule containing a nucleic acid sequence encoding a single-stranded guide RNA" or "a vector containing a nucleic acid sequence encoding a single-stranded guide RNA" can be either a single-stranded guide RNA containing the scaffold sequence shown in any of SEQ ID NO:2-4 or a single-stranded guide RNA containing other scaffold sequences, as long as it can be used in conjunction with the SlugCas9 mutant protein of the present invention to perform gene editing or other functions.

[0178] In yet another specific implementation, in the method, the CRISPR spacer sequence of the single-stranded guide RNA forms a fully complementary base pairing structure with the target sequence, and an incomplete complementary base pairing structure with the non-target sequence.

[0179] In this document, the incomplete base pairing structure refers to a structure that includes a portion of base pairing and a portion of non-base pairing, wherein the non-base pairing includes, for example, base mismatch and / or base bulge.

[0180] In a further specific embodiment, the incomplete base complementary pairing structure includes one or more, for example, two or more base mismatches.

[0181] Therefore, the SlugCas9 mutant protein of the present invention can cleave the target site on the target sequence, and double-strand breaks occur in the target sequence under the cleavage action of the SlugCas9 mutant protein. Furthermore, when the method is performed intracellularly, the cleaved target sequence can be repaired through intracellular non-homologous end joining repair or homologous recombination repair pathways, thereby achieving gene editing of the target sequence.

[0182] In the CRISPR / Cas9 gene editing system and gene editing method of the present invention, the SlugCas9 mutant protein of the present invention has been experimentally found to form a complex with sgRNA for gene editing, and its mismatch-containing guide RNA has a near 0% error tolerance. Therefore, these gene editing systems can edit target genes with high specificity, and have the characteristics of high editing efficiency and low off-target rate, and can be widely used in gene editing in cells or in vitro environments.

[0183] Reagent test kit

[0184] In a ninth aspect, the present invention provides a kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising:

[0185] a) Choose any one of (1) to (4) below:

[0186] (1) The SlugCas9 mutant protein described in the first aspect, the conjugate described in the second aspect, or the fusion protein described in the third aspect, and single-stranded guide RNA;

[0187] (2) The isolated nucleic acid molecules described in the fourth aspect;

[0188] (3) The carrier described in the fifth aspect; and

[0189] (4) The CRISPR / Cas9 gene editing system described in the sixth aspect;

[0190] The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence from the 5' end to the 3' end.

[0191] as well as

[0192] b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment.

[0193] In one specific implementation, the stent sequence may be any of the stent sequences shown in SEQ ID NO: 2-4, but is not limited thereto.

[0194] In a further specific embodiment, the CRISPR spacer sequence can be a sequence of 15-28 nucleotides in length, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides, that is complementary to the target sequence.

[0195] In a preferred embodiment, the CRISPR spacer sequence may be a 21-nucleotide sequence that is complementary to the target sequence.

[0196] In a further specific embodiment, the single-stranded guide RNA further includes a terminator at the 3' end of the scaffold sequence. As an example, the terminator may be a plurality of terminators, such as at least six (e.g., seven or eight) U.

[0197] Regarding items (2) and (3) above, as can be understood from the above description, the isolated nucleic acid molecule described in the fourth aspect of the present invention and the vector described in the fifth aspect may, in some cases, contain only a nucleic acid sequence encoding a SlugCas9 mutant protein or its conjugate or fusion protein, and in other cases, may contain a nucleic acid sequence encoding a SlugCas9 mutant protein or its conjugate or fusion protein and a nucleic acid sequence encoding a single-stranded guide RNA. Therefore, depending on the circumstances, the isolated nucleic acid molecule or the vector may further contain a nucleic acid sequence encoding a single-stranded guide RNA.

[0198] Furthermore, it can be understood that the single-stranded guide RNA mentioned in the descriptions "isolated nucleic acid molecules containing nucleic acid sequences encoding single-stranded guide RNA" or "vectors containing nucleic acid sequences encoding single-stranded guide RNA" can be either single-stranded guide RNA containing the scaffold sequences shown in any of SEQ ID NO:2-4 or single-stranded guide RNA containing other scaffold sequences.

[0199] Of course, those skilled in the art will understand that the kit of the present invention may also contain other reagents that facilitate gene editing.

[0200] A brief description of the sequence involved in this invention.

[0201] SEQ ID NO:1: Wild-type SlugCas9 protein sequence;

[0202] SEQ ID NO:2: SaCas9_sgRNA scaffold sequence;

[0203] SEQ ID NO:3: SlugCas9_sgRNA scaffold sequence;

[0204] SEQ ID NO:4: Modified_SlugCas9_sgRNA scaffold sequence;

[0205] SEQ ID NO:5: DNA fragment 1 for constructing the SlugCas9 expression plasmid;

[0206] SEQ ID NO:6: Sequence of Sa_sgRNA fragment.

[0207] Example

[0208] The invention will now be described with reference to the following embodiments, which are intended to be illustrative and not limiting. Those skilled in the art will understand that the embodiments provided herein are for the purpose of describing the invention in detail only and are not intended to limit the scope of protection claimed by the invention.

[0209] Unless otherwise specified, the experiments and methods described in the examples were generally performed according to conventional methods well known in the art and described in the various references. Furthermore, for conditions not specifically specified in the examples, conventional conditions or conditions recommended by the manufacturer were followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0210] Example 1:

[0211] Construction of SlugCas9 expression plasmid

[0212] Using pCMV_ABEmax_P2A_GFP plasmid (Addgene platform, catalog #112101) and SlugCas9 plasmid (Addgene platform, catalog #163793) as templates (Addgene platform, catalog #52963), the 785-3943 bp sequence on the SlugCas9 plasmid (SlugCas9 sequence, PCR fragment 1) and the 866-4357 bp sequence on the pCMV_ABEmax_P2A_GFP plasmid (excluding ABEmax, P2A, and eGFP, PCR fragment 2) were amplified by PCR. DNA fragment 1 with the nucleotide sequence shown in SEQ ID NO:5 (this fragment contains one BPSV40 NLS, P2A, and Puro) was synthesized by Shanghai Huajin Biotechnology Co., Ltd. The PCR primers are shown in Table 1 below.

[0213] Table 1: PCR primers for constructing the SlugCas9 expression plasmid

[0214]

[0215] The PCR amplification reaction system is as follows:

[0216]

[0217] The PCR procedure is as follows:

[0218]

[0219] The PCR products were electrophoresed on a 1% agarose gel at 120V for 30 min. The target DNA fragments were purified using a gel extraction kit according to the manufacturer's instructions. The DNA concentration was measured using a NanoDrop™ Lite spectrophotometer (Thermo Scientific). The above three fragments were recombined and ligated using the NEBuilder® HiFi DNA Assembly (NEB) homologous recombination kit under the following reaction system and conditions.

[0220] The reaction system is as follows:

[0221]

[0222] The reaction conditions are as follows:

[0223]

[0224] Add 3 μL of the ligation product to 100 μL of *E. coli* DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubate on ice for 30 min, heat shock at 42℃ for 1 min, incubate on ice for 2 min, add 900 μL of LB medium, and incubate at 37℃ for 1 hour. Centrifuge at 5000 rpm for 1 minute, retain approximately 100 μL of bacterial culture, spread it on LB agar plates containing ampicillin, and incubate upside down at 37℃ for 16 hours. Select single clones for Sanger sequencing verification.

[0225] After sequencing to verify the correct ligation of the clone, culture the culture medium, extract the plasmid to obtain the SlugCas9 expression plasmid, and store it for later use or at -20℃ for long-term preservation.

[0226] Construction of SlugCas9 mutant expression plasmid

[0227] Using the SlugCas9 expression plasmid as a template, combined PCR reactions were performed at multiple sites to obtain SlugCas9 mutant expression plasmids containing different point mutations. The PCR primer sequences are shown in Table 2.

[0228] Table 2: PCR primers for constructing the SlugCas9 mutant expression plasmid

[0229]

[0230] Note: Underlined and bolded positions indicate mutant bases.

[0231] The PCR amplification reaction system is as follows:

[0232]

[0233] The PCR procedure is as follows:

[0234]

[0235] The PCR products were sequentially subjected to gel running, purification, concentration determination, homologous recombination ligation (a maximum of 3 recombination fragments per recombination), DH5α transformation, single-clone sequencing identification, and plasmid extraction and preservation. The specific steps were the same as those for the construction of the SlugCas9 expression plasmid in (1), thereby obtaining the SlugCas9 mutant expression plasmids, namely SlugCas9-N984S expression plasmid, SlugCas9-K1016I expression plasmid, SlugCas9-2mut expression plasmid (including mutation sites N984S and K1016I), SlugCas9-5mut expression plasmid (including mutation sites Q782R, S888R, L906R, E1012K and K1016I) and SlugCas9-6mut expression plasmid (including mutation sites Q782R, S888R, L906R, N984S, E1012K and K1016I).

[0236] (3) Construction of mU6-Sa_trac plasmid and preparation of linearized vector

[0237] The sequence of pBluescript II SK(-) vector (NovoPro, product number: V012543) from 682 to 649 bp was amplified by PCR and ligated to the synthesized DNA fragment Sa_sgRNAfragment with the nucleotide sequence shown in SEQ ID NO:6 via homologous recombination. Primer sequences are shown in Table 3 below:

[0238] Table 3: PCR primers for constructing the mU6-Sa_trac plasmid

[0239]

[0240] The PCR amplification reaction system is as follows:

[0241]

[0242] The PCR procedure is as follows:

[0243]

[0244] The PCR products were sequentially subjected to gel electrophoresis, purification, concentration determination, homologous recombination ligation with the Sa_sgRNA fragment, DH5α transformation, single-clone sequencing identification, and plasmid extraction. The specific steps were the same as those for the construction of the SlugCas9 expression plasmid in (1). Finally, the mU6-Sa_trac plasmid was obtained and prepared for use or stored at -20℃.

[0245] The mU6-Sa_trac plasmid was cut using BbsI-HF (purchased from NEB) under the following reaction system and conditions.

[0246] The reaction system is as follows:

[0247]

[0248] The reaction conditions are as follows:

[0249]

[0250] The enzyme digestion products were electrophoresed on a 1% agarose gel at 120V for 30 min. A 3355 bp DNA fragment was excised from the agarose gel and recovered using a gel extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions. Finally, the fragment was eluted with ultrapure water to obtain the linearized fragment mU6-Sa_trac_BbsI.

[0251] The recovered linearized fragment mU6-Sa_trac_BbsI was used to determine the DNA concentration using a NanoDrop™ Lite spectrophotometer (ThermoScientific) and stored for later use or at -20°C. This linearized fragment was used in the construction of all sgRNA expression plasmids described thereafter.

[0252] (4) Construction of sgRNA expression plasmid (sgRNA-PAM plasmid)

[0253] The gRNA sequences designed for the target sites are shown in Table 4 below, along with their corresponding oligonucleotide single-stranded DNA sequences.

[0254] Table 4: Oligonucleotide Single-Stranded DNA Sequences of gRNA

[0255]

[0256] Oligo-F and oligo-R were annealed. The annealing reaction mixture consisted of 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After vortexing and mixing the annealing mixture, it was placed in a PCR instrument and the annealing program was run. The annealing program is as follows:

[0257] Store at 95℃ for 5 min, 85℃ for 1 min, 75℃ for 1 min, 65℃ for 1 min, 55℃ for 1 min, 45℃ for 1 min, 35℃ for 1 min, 25℃ for 1 min, at 4℃, with a cooling rate of 0.3℃ / s.

[0258] After annealing, the resulting product was ligated to the linearized fragment mU6-Sa_trac_BbsI using a sticky-terminal transient ligase (purchased from NEB) under the following reaction system and conditions.

[0259] The reaction system is as follows:

[0260]

[0261] The reaction conditions are as follows:

[0262]

[0263] Transform 3 μL of the ligation product into 100 μL of DH5α competent cells, then perform single clone selection, sequencing identification, and plasmid extraction to obtain the sgRNA-PAM plasmid, which can be used for later use or stored at -20℃.

[0264] (5) Transfection and gene editing of SlugCas9 expression plasmids and SlugCas9 mutant expression plasmids

[0265] The SlugCas9 expression plasmids and SlugCas9 mutant expression plasmids (i.e., SlugCas9-N984S expression plasmid, SlugCas9-K1016I expression plasmid, SlugCas9-2mut expression plasmid, SlugCas9-5mut expression plasmid or SlugCas9-6mut expression plasmid) obtained in (1) and (2) were co-transfected with sgRNA-PAM plasmid into a GFP reporter cell line library containing the target sequence (GGCTCGGAGATCATCATTGCG) via polyethyleneimine (PEI, purchased from Polysciences).

[0266] The GFP reporter cell line library containing the target sequence was obtained as follows: First, a DNA fragment containing the CMV promoter and the GFP gene was inserted into the genome of the HEK293T cell line via lentiviral infection. In this DNA fragment, there is a non-triple-length DNA sequence between the start codon (ATG) and the GFP coding sequence, causing a frameshift mutation in GFP to prevent normal fluorescence production. Gene editing causes insertion or deletion of this non-triple-length DNA sequence, repairing the frameshift mutation in some cells and allowing normal GFP expression. In this cell library, the insertion sequence between the start codon and the GFP coding sequence is 5'-GAACGGCTCGGAGATCATCATTGCGNNNNNNN-3'. By analyzing the sequence composition of seven consecutive "N"s in positive cells, the PAM recognition sequence of SlugCas9 and its mutant proteins can be obtained.

[0267] The above transfection process includes the following steps:

[0268] On day 0, as required for transfection, the HEK293T cell line containing the target sequence of the GFP reporter system was plated in 10 cm petri dishes to achieve 70% confluence at transfection. The GFP reporter cell line library contained the nucleotide sequence CMV-ATG-targetsite-NNNNNNN-GFP, where the target site sequence was GGCTCGGAGATCATCATTGCG.

[0269] On day 1, transfection was performed as follows: 10 μg of SlugCas9 expression plasmid or SlugCas9 mutant expression plasmid and 5 μg of sgRNA-PAM plasmid were added to 500 μL of Opti-MEM medium (purchased from Gibco) and mixed by pipetting.

[0270] Gently mix the PEI, add 15 μL of PEI to 500 μL of Opti-MEM medium, mix gently, and let stand at room temperature for 5 min.

[0271] The diluted plasmid and diluted transfection reagent were mixed and shaken to mix. The resulting mixture was allowed to stand at room temperature for 15 min, and then added to the culture medium of the GFP reporter cell line library. The mixture was then placed in a 37°C, 5% CO2 incubator for further culture.

[0272] Five days after transfection, GFP-positive cells were sorted using a MoFlo XDP sorter. The sorted cells were then cultured at 37°C in a 5% CO2 incubator for another 5 days.

[0273] Cells were then collected, and genomic DNA was extracted using a DNA kit (Tiangen Biotech (Beijing) Co., Ltd., DP304) in accordance with the instructions provided with the DNA kit.

[0274] (6) Preparation of next-generation sequencing libraries

[0275] The extracted genomic DNA was used for library construction through two rounds of PCR, and the primer sequences are shown in Table 5 below.

[0276] Table 5: Primer sequences for two rounds of PCR library construction

[0277]

[0278] The PCR reaction system for one round is as follows:

[0279]

[0280] The procedure for one round of PCR is as follows:

[0281]

[0282] The second-round PCR reaction system is as follows:

[0283]

[0284] The procedure for the second round of PCR is as follows:

[0285]

[0286] The second-round PCR products were purified using a gel extraction kit according to the manufacturer's instructions to obtain a 300-400bp DNA fragment. Thus, the next-generation sequencing library was prepared.

[0287] (7) Analysis of second-generation sequencing results

[0288] The prepared next-generation sequencing library was subjected to paired-end sequencing on the high-throughput sequencer HiseqXTen (Illumina).

[0289] By analyzing next-generation sequencing data, PAM recognition sequences for the SlugCas9 protein and its mutant proteins were obtained. The results are as follows: Figure 1 and Figure 2 As shown, the PAM recognition sequences of the five mutant proteins are all altered. Among them, the PAM recognition sequences of SlugCas9-2mut, SlugCas9-5mut, and SlugCas9-6mut are NNG instead of NNGG of SlugCas9. This indicates that the SlugCas9 mutant protein of the present invention with at least two mutation sites can target more target sequences.

[0290] Example 2

[0291] (1) Construction of sgRNA-on / off-target plasmid

[0292] The sequences for designing on / off target gRNAs are shown in Table 6 below, along with their corresponding oligonucleotide single-stranded DNA sequences.

[0293] Oligo-F and oligo-R were annealed. The annealing reaction mixture consisted of 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After vortexing and mixing the annealing mixture, it was placed in a PCR instrument and the annealing program was run. The annealing program is as follows:

[0294] Store at 95℃ for 5 min, 85℃ for 1 min, 75℃ for 1 min, 65℃ for 1 min, 55℃ for 1 min, 45℃ for 1 min, 35℃ for 1 min, 25℃ for 1 min, at 4℃, with a cooling rate of 0.3℃ / s.

[0295] After annealing, the resulting product was ligated to the linearized fragment mU6-Sa_trac_BbsI using a sticky-end transient ligase (purchased from NEB).

[0296] The reaction system is as follows:

[0297]

[0298] The reaction conditions are as follows:

[0299]

[0300] Transform 3 μL of the ligation product into 100 μL of LDH5α competent cells, then pick single clones, sequence them for identification, and extract plasmids to obtain sgRNA-on / off-target plasmids, which can be used for later use or stored at -20℃.

[0301]

[0302] (2) Transfection and gene editing of SlugCas9 expression plasmids and SlugCas9 mutant expression plasmids

[0303] The SlugCas9 expression plasmid and the SlugCas9 mutant expression plasmid (SlugCas9-5mut expression plasmid and SlugCas9-6mut expression plasmid) prepared in Example 1 were co-transfected with the sgRNA-on / off-target plasmid into a GFP reporter cell line containing the target sequence (GGATATGTTGAAGAACACCATGAC) via PEI.

[0304] The GFP reporter cell line containing the target sequence was obtained by inserting a PAM sequence and a specific target sequence between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation. This mutation was then integrated into HEK293T cells via lentiviral infection, resulting in a GFP reporter cell line containing the target sequence. After the gene editing system cuts the target sequence, the cells' self-repair system allows some cells to recover the GFP reading frame, producing green fluorescence. Flow cytometry analysis of the GFP-positive cell ratio can assess the editing capability and specificity of the gene editing system.

[0305] The above transfection process includes the following steps:

[0306] On day 0, HEK293T cell lines containing the target sequence were seeded in 24-well plates to achieve 70% confluence at transfection, according to the transfection requirements. This GFP reporter cell line contains the nucleotide sequence CMV-ATG-target site-PAM-GFP, where the target site sequence is GGCTCGGAGATCATCATTGCG and the PAM sequence is CTGG.

[0307] On day 1, transfection was performed as follows: 0.6 μg of SlugCas9 expression plasmid or SlugCas9 mutant expression plasmid (SlugCas9-5mut expression plasmid, SlugCas9-6mut expression plasmid) was taken and added together with 0.3 μg of sgRNA-on / off-target plasmid to 25 μL of Opti-MEM medium (purchased from Gibco), and gently pipetted to mix.

[0308] Mix polyethyleneimine (PEI, purchased from Polysciences) gently, add 0.9 μL of PEI to 25 μL of Opti-MEM medium, mix gently, and let stand at room temperature for 5 min.

[0309] The diluted plasmid and diluted transfection reagent were shaken and mixed. The resulting mixture was allowed to stand at room temperature for 15 min, and then added to the culture medium of the HEK293T cell line containing the target sequence of the GFP reporter system. The cell line was then placed in a 37°C, 5% CO2 incubator for further culture.

[0310] (3) Flow cytometry analysis was used to evaluate the specificity of SlugCas9 and its mutants.

[0311] Five days after transfection, the proportion of GFP-positive cells was analyzed using flow cytometry (BD Biosciences FACSCalibur), and the specificity of SlugCas9 protein and its mutant protein was evaluated using FlowJo software for analysis and plotting.

[0312] The editing efficiency of SlugCas9 protein and its mutant proteins SlugCas9-5mut and SlugCas9-6mut in GFP reporter cell lines containing the target sequence is shown in the figures below. Figure 3-4 . Figure 3-4 The Y-axis represents the percentage of GFP-positive cells (%), and the X-axis represents on / off target gRNA. From... Figure 3-4As can be seen, the SlugCas9 protein and its mutant proteins SlugCas9-5mut and SlugCas9-6mut can effectively edit target sites in GFP reporter cell lines. Although the SlugCas9 mutant proteins SlugCas9-5mut and SlugCas9-6mut have slightly lower target editing efficiency than the wild-type SlugCas9 protein, their off-target rates are significantly reduced at each target site, exhibiting higher specificity. Among them, SlugCas9-6mut has the lowest off-target rate at each target site.

[0313] Example 3:

[0314] (1) Construction of sgRNA-target plasmid

[0315] The sequence of the target gRNA was designed, and its corresponding oligonucleotide single-stranded DNA is shown in Table 7 below.

[0316] Table 7: gRNA and its DNA sequence

[0317]

[0318] Note: The part before the "-" in "site" indicates the gene where the target site is located, and the part after the "-" indicates the PAM sequence of the target site.

[0319] Oligo-F and oligo-R were annealed. The annealing reaction mixture consisted of 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After vortexing and mixing the annealing mixture, it was placed in a PCR instrument and the annealing program was run. The annealing program is as follows:

[0320] Store at 95℃ for 5 min, 85℃ for 1 min, 75℃ for 1 min, 65℃ for 1 min, 55℃ for 1 min, 45℃ for 1 min, 35℃ for 1 min, 25℃ for 1 min, at 4℃, with a cooling rate of 0.3℃ / s.

[0321] After annealing, the resulting product was ligated to the linearized fragment mU6-Sa_trac_BbsI using a sticky-end transient ligase (purchased from NEB).

[0322] The reaction system is as follows:

[0323]

[0324] The reaction conditions are as follows:

[0325]

[0326] Transform 3 μL of the ligation product into 100 μL of DH5α competent cells, then select single clones, sequence them for identification, and extract plasmids to obtain the sgRNA-target plasmid, which can be used for later use or stored at -20℃.

[0327] (2) SlugCas9 expression plasmid and SlugCas9 mutant expression plasmid (SlugCas9-5mut expression plasmid and Transfection and gene editing of SlugCas9-6mut expression plasmid

[0328] On day 0, HEK293T cells containing the target sequence were seeded in 24-well plates as needed for transfection, so that they reached 70% confluence at the time of transfection.

[0329] Day 1, transfection was performed. The transfection process is as follows:

[0330] Take 0.6 μg of SlugCas9 expression plasmid and SlugCas9 mutant expression plasmid (SlugCas9-mut5 expression plasmid and SlugCas9-mut6 expression plasmid), and add them together with 0.3 μg of sgRNA-on / off-target plasmid into 25 μL of Opti-MEM medium (purchased from Gibco), and gently pipette to mix.

[0331] Add 0.9 μL of PEI to 25 μL of Opti-MEM medium, mix gently, and let stand at room temperature for 5 min.

[0332] The diluted plasmid and diluted transfection reagent were mixed and shaken to mix. The resulting mixture was allowed to stand at room temperature for 15 minutes, and then added to the culture medium of HEK293T cell line containing the target sequence of GFP reporter system. The cell line was then placed in a 37°C, 5% CO2 incubator for further culture.

[0333] 24 hours after transfection, puromycin was added to a final concentration of 1 ng / µL for selection. 72 hours after transfection, the medium was replaced with puromycin-free standard medium and incubated at 37°C in a 5% CO2 incubator for another 2 days.

[0334] Cells edited for 5 days were collected, and genomic DNA was extracted using a DNA kit (Tiangen Biotech (Beijing) Co., Ltd., DP304) according to the instructions provided with the DNA kit.

[0335] (3) Preparation of next-generation sequencing libraries

[0336] The extracted genome was used for library construction via two rounds of PCR. The primers for the first round of PCR are shown in Table 8 below:

[0337] Table 8: Primers for one round of PCR

[0338]

[0339] The PCR reaction system for one round is as follows:

[0340]

[0341] The procedure for one round of PCR is as follows:

[0342]

[0343] The primers for the second round of PCR are shown in Table 9 below:

[0344] Table 9: Primers for Second Round PCR

[0345]

[0346] The second-round PCR reaction system is as follows:

[0347]

[0348] The procedure for the second round of PCR is as follows:

[0349]

[0350] The second-round PCR products were purified using a gel extraction kit according to the manufacturer's instructions, resulting in a 300-400 bp DNA fragment. This completed the preparation of the next-generation sequencing library.

[0351] (4) Analysis of second-generation sequencing results

[0352] The prepared next-generation sequencing library was subjected to paired-end sequencing on the high-throughput sequencer HiseqXTen (Illumina).

[0353] Next-generation sequencing analysis yielded the editing efficiency results of SlugCas9 protein and its mutant proteins on multiple target sites obtained in step (3) above, such as... Figure 5 As shown in the figure, the X-axis represents the target site, and the Y-axis represents the editing efficiency (Indels%). The results show that the SlugCas9 protein only exhibits high efficiency at the test site with the PAM sequence NNGG. The SlugCas9 mutant proteins SlugCas9-5mut and SlugCas9-6mut not only show similar editing activity to the wild-type SlugCas9 protein at the test site with the PAM sequence NNGG, but also demonstrate high editing activity at the test sites with the PAM sequences NGA, NNGT, and NNGC. This proves that these two mutant proteins of the present invention can effectively edit endogenous sites with the PAM sequence NNG.

[0354] The inventors also verified that combinations of other mutant proteins of the present invention with multiple mutation sites, such as two or five, and the sgRNA shown in SEQ ID NO: 2, all achieved similar technical effects. As mentioned above, mutant proteins of the present invention, including at least two mutation sites, are able to recognize the PAM sequence of NNG.

[0355] Furthermore, the inventors constructed plasmids containing the scaffold sequence shown in SEQ ID NO: 3 or 4 using a method similar to that described in step (3) of Example 1, and constructed other sgRNA-on-target plasmids using the method described in step (1) of this example, and performed detection according to the methods described in steps (2)-(4) of this example. The results showed that, similar to those obtained using the scaffold sequence shown in SEQ ID NO: 2, similar results were also obtained when using the scaffold sequence shown in SEQ ID NO: 3 or 4.

Claims

1. A SlugCas9 mutant protein, said SlugCas9 mutant protein comprising only a combination of mutations at multiple amino acid residues corresponding to Q782, S888, L906, N984, E1012 and K1016 of the wild-type SlugCas9 protein as shown in SEQ ID NO:1: 1) Q782R, S888R, L906R, E1012K, and K1016I; or 2) Q782R, S888R, L906R, N984S, E1012K and K1016I.

2. A conjugate, said conjugate comprising: a) The SlugCas9 mutant protein as described in claim 1; b) Modified parts; c) A connector for linking the SlugCas9 mutant protein to the modified portion; The modified portion is selected from other proteins or peptides, detectable markers, or combinations thereof; The additional protein or polypeptide mentioned therein is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal sequences, cytosine deaminases, adenine deaminases, cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressors KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

3. The conjugate according to claim 2, wherein the linker is a linker with a length of 1-50 amino acids.

4. A fusion protein, said fusion protein comprising: a) The SlugCas9 mutant protein as described in claim 1; b) Other proteins and peptides; c) Connectors for linking the SlugCas9 mutant protein to the other proteins and peptides; The additional protein or polypeptide mentioned therein is selected from one or more of the following: epitope tags, reporter proteins or nuclear localization signal sequences, cytosine deaminases, adenine deaminases, cytosine methyltransferases DNMT3A and MQ1, cytosine demethylase Tet1, transcription activators VP64, p65 and RTA, transcription repressors KRAB, histone acetyltransferase p300, histone deacetyltransferase LSD1, and endonuclease FokI.

5. The fusion protein according to claim 4, wherein the linker is a linker with a length of 1-50 amino acids.

6. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding the following: a) The SlugCas9 mutant protein as described in claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

7. The isolated nucleic acid molecule according to claim 6 further comprises a nucleic acid sequence encoding a single-stranded guide RNA, said single-stranded guide RNA comprising a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

8. The isolated nucleic acid molecule according to claim 7, wherein the scaffold sequence has a nucleic acid sequence shown in any one of SEQ ID NO: 2-4.

9. The isolated nucleic acid molecule according to claim 7, wherein the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length that is complementary to the target sequence.

10. The isolated nucleic acid molecule according to claim 7, wherein the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

11. A vector comprising a nucleic acid sequence encoding the following: a) The SlugCas9 mutant protein as described in claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

12. The vector according to claim 11, wherein the vector is a plasmid vector.

13. The vector according to claim 11, wherein the vector is a pUC19 vector, an applicator vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

14. The vector according to any one of claims 11 to 13 further comprises a nucleic acid sequence encoding a single-stranded guide RNA, said single-stranded guide RNA comprising a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end.

15. The vector according to claim 14, wherein the scaffold sequence has a nucleic acid sequence shown in any one of SEQ ID NO: 2-4.

16. The vector according to claim 14, wherein the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length that is complementary to the target sequence.

17. The vector according to claim 14, wherein the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

18. A CRISPR / Cas9 gene editing system, comprising: 1) Protein components, which include: a) The SlugCas9 mutant protein as described in claim 1; b) The conjugate according to claim 2 or 3; or c) The fusion protein according to claim 4 or 5; as well as 2) A single-stranded guide RNA, wherein the single-stranded guide RNA comprises a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end; Furthermore, the protein component and the single-stranded guide RNA bind to each other to form a complex.

19. The CRISPR / Cas9 gene editing system according to claim 18, wherein the scaffold sequence has a nucleic acid sequence shown in any one of SEQ ID NO: 2-4.

20. The CRISPR / Cas9 gene editing system of claim 18, wherein the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length that is complementary to the target sequence.

21. The CRISPR / Cas9 gene editing system of claim 18, wherein the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

22. A cell comprising the isolated nucleic acid molecule of any one of claims 6 to 10; or the vector of any one of claims 11 to 17.

23. The cell according to claim 22, wherein the cell is a prokaryotic cell or an animal cell, and the animal cell is a mammalian cell.

24. A method for non-therapeutic gene editing of a target sequence in an intracellular or in vitro environment, the method comprising: Contact any of the following (1) through (6) with the target sequence in the intracellular or in vitro environment: (1) The SlugCas9 mutant protein of claim 1, the conjugate of claim 2 or 3, or the fusion protein of claim 4 or 5, and the single-stranded guide RNA. (2) The isolated nucleic acid molecule of claim 6, and the isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA; (3) The isolated nucleic acid molecule as described in claim 7; (4) The vector according to any one of claims 11 to 13, and the vector comprising a nucleic acid sequence encoding a single-stranded guide RNA; (5) The carrier according to claim 14; or (6) The CRISPR / Cas9 gene editing system as described in claim 18; The single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end. The SlugCas9 mutant protein, the conjugate, or the fusion protein recognizes a protospacer adjacent sequence (PAM) located at the 3' end of the target sequence and having the sequence 5'-NNGG or 5'-NNG.

25. The method of claim 24, wherein the scaffold sequence has a nucleic acid sequence shown in any one of SEQ ID NO: 2-4.

26. The method of claim 24, wherein the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length that is complementary to the target sequence.

27. The method of claim 24, wherein the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

28. The method according to claim 24, wherein the cell is a prokaryotic cell or an animal cell, and the animal cell is a mammalian cell.

29. The method according to any one of claims 24 to 28, wherein the gene editing comprises one or more of the following: gene knockout of a target sequence, site-directed base alteration, site-directed insertion, regulation of gene transcription, regulation of DNA methylation, DNA acetylation modification, histone acetylation modification, single base conversion, and chromatin imaging tracking.

30. The method of claim 29, wherein the single base conversion includes adenine to guanine, cytosine to thymine, or cytosine to uracil.

31. The method according to claim 24, wherein, The CRISPR spacer sequence of the single-stranded guide RNA forms a completely complementary base pairing structure with the target sequence, while forming an incomplete complementary base pairing structure with non-target sequences.

32. The method according to claim 31, wherein, The incomplete base complementary pairing structure includes a structure with one or more base mismatches.

33. The method according to claim 31, wherein, The incomplete base pairing structure includes structures with two or more base mismatches.

34. A kit for gene editing of a target sequence in an intracellular or in vitro environment, comprising: a) Choose any one of (1) to (6) below: (1) The SlugCas9 mutant protein of claim 1, the conjugate of claim 2 or 3, or the fusion protein of claim 4 or 5, and the single-stranded guide RNA. (2) The isolated nucleic acid molecule of claim 6, and the isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA; (3) The isolated nucleic acid molecule as described in claim 7; (4) The vector according to any one of claims 11 to 13, and the vector comprising a nucleic acid sequence encoding a single-stranded guide RNA; (5) The carrier according to claim 14; or (6) The CRISPR / Cas9 gene editing system as described in claim 18; The single-stranded guide RNA includes a CRISPR spacer sequence and a scaffold sequence from the 5' end to the 3' end. as well as b) Instructions on how to perform gene editing on target sequences in the intracellular or in vitro environment.

35. The kit according to claim 34, wherein the scaffold sequence has a nucleic acid sequence shown in any one of SEQ ID NO:2-4.

36. The kit according to claim 34, wherein the CRISPR spacer sequence is a sequence of 15-28 nucleotides in length that is complementary to the target sequence.

37. The kit according to claim 34, wherein the CRISPR spacer sequence is a 21-nucleotide sequence that is complementary to the target sequence.

Images