Tomato plants with improved insect resistance
By introducing the SlAT2 and AP2e gene combination into tomato plants to regulate acyl sugar production, the problem of tomato plants' resistance to whiteflies was solved, achieving effective protection against whiteflies and mites.
Patent Information
- Application Number
- CN202180093334.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-03-24
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2041-03-24
AI Technical Summary
Existing tomato plants lack effective resistance to whitefly pests. Conventional methods such as pesticides and biological control methods are difficult to completely solve the whitefly infestation problem, and the loss of genetic diversity in cultivated tomatoes makes them more susceptible to pest attacks.
Insect resistance was enhanced by introducing a combination of the acetyl-CoA-dependent acyltransferase gene (SlAT2) and the APETALA2e ethylene response transcription factor gene (AP2e) into tomato plants to regulate the production of acyl sugars, especially the accumulation of C29H48O15 and C36H62O15 acyl sucroses.
It significantly improved the resistance of tomato plants to whiteflies and mites, reduced the damage caused by pests to the plants, and enhanced the plants' protective capabilities.
Smart Images

Figure BDA0004384305240000121 
Figure HDA0004384305250000011 
Figure HDA0004384305250000021
Abstract
Description
[0001] describe
[0002] This invention relates to tomato plants with improved insect resistance, more particularly whitefly or mite resistance, said plants comprising the SlAT2 gene encoding an acetyl-CoA-dependent acyltransferase and the AP2e gene encoding the APETALA2 ethylene response transcription factor. The invention also relates to methods for providing tomato plants with improved insect resistance, and the use of the SlAT2 gene combined with the AP2e gene for providing insect-resistant tomato plants.
[0003] Whiteflies, belonging to the family Aleyrodidae, typically feed on the abaxial surface of plant leaves. With over 1500 species described, whiteflies pose a significant problem for crop protection in warm or tropical climates and in greenhouses, resulting in substantial economic losses worldwide each year, particularly in warm climates and tropical climates and greenhouses. Many whitefly species are small, complicating their control in greenhouses, where populations can rapidly increase if left unchecked. Whitefly-related damage reduces crop quality and quantity, such as decreased plant viability and yield, premature wilting, yellowing leaves, and leaf drop. The silver leaf whitefly (Bemisia tabaci) is one such species and is currently one of the most important agricultural pests.
[0004] While several species of whiteflies can cause some crop damage simply by sucking sap when their numbers are high, their primary harm is indirect. Their main importance as crop pests lies in their role as vectors for plant diseases, including more than 200 plant viruses. Furthermore, whiteflies feed by invading the plant's phloem, introducing toxic saliva, and reducing the plant's overall turgor pressure. Whiteflies secrete large amounts of honeydew, which supports harmful fungal invasions such as sooty mold. Due to the large populations of whiteflies, susceptible plants can quickly become overwhelmed.
[0005] Insecticides such as neonicotinoids, organochlorine compounds, and organophosphates are widely used and are effective in controlling whiteflies. However, continuous application of insecticides leads to the development of resistance in whiteflies. In addition, more environmentally friendly biological methods have been proposed to control whitefly infestations, such as using natural predators and parasites (e.g., lacewing larvae) to control whitefly infestations, or washing plants to reduce the number of pests on the plants. However, these methods do not provide optimal solutions for the pests, and whiteflies remain difficult to control.
[0006] Whitefly infestation has proven to be a problem, particularly in tomatoes (Solanum lycopersicum) and peppers (Capsicums pp.). Tomatoes are classified under the clade *Solanumsect.* Lycopersicon, comprising 13 species, of which *Solanum lycopersicum* is the cultivated tomato, while the other 12 are wild relatives. The genus *Capsicums* has 25 species, five of which are cultivated, including annual pepper (*C. annuum*), Chinese pepper (*C. chinense*), drooping pepper (*C. baccatum*), hairy pepper (*C. pubescens*), and shrub-like pepper (*C. frutescens*). Domestication of tomatoes and peppers has led to a loss of genetic diversity, making them vulnerable to both abiotic and biotic stresses (e.g., pest attacks). To date, cultivated tomatoes and peppers do not exhibit resistance to whiteflies. Several previous studies have been conducted to identify whitefly resistance in wild relatives of tomatoes and peppers. Several wild relatives of tomatoes (S. pennellii, S. habrochaites, S. peruvianum, and S. pimpinellifolium) are known to be more resistant than cultivated species.
[0007] Antibiotic activity is one of the resistance mechanisms that adversely affect plant growth and survival against insects. One of the most prominent tomato traits contributing to whitefly resistance is the trichome, a small protrusion or appendage on the plant, such as glandular hairs. Its function is to secrete metabolites that have various functions in the plant related to growth and development as well as stress response, including terpenes, phenylpropanoids, flavonoids, methyl ketones, and acyl sugars. For example, monoterpenes and sesquiterpenes, methyl ketones, and acyl sugars are known secondary metabolites in tomatoes associated with whitefly resistance. While glandular trichomes have shown to play an important role in whitefly resistance, the compounds within these trichomes are actually the decisive factor. A strong correlation has been found between the presence of specific trichomes (type IV trichomes) and whitefly resistance, and previous research has shown that whitefly resistance is based on several mechanisms involving many genes and is a complex process. Efforts to introduce whitefly resistance into cultivated tomatoes have been unsuccessful, and new approaches and sources of resistance should be considered.
[0008] In summary, there is a need in the art for tomato plants with improved insect resistance, and more particularly, for tomato plants with improved insect resistance. Additionally, there is a need in the art for methods of providing plants with improved insect resistance, and more particularly for methods of providing tomato plants with improved resistance to whiteflies.
[0009] Among other objectives, one objective of the present invention is to address the aforementioned needs in the art. In other objectives, the present invention is satisfied by the invention as set forth in the appended claims.
[0010] In particular, according to a first aspect of the invention, among other objectives, the aforementioned objectives are achieved by the invention through tomato plants having improved whitefly resistance, wherein said plants comprise a combination of an acetyl-CoA-dependent acyltransferase gene (SlAT2) and an APETALA2e ethylene response transcription factor gene (AP2e), said acetyl-CoA-dependent acyltransferase gene (SlAT2) encoding a cDNA sequence having at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No. 2, said APETALA2e ethylene response transcription factor gene (AP2e) encoding a cDNA sequence having at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No. 5, wherein, compared to tomato plants not containing said gene combination, the combination of said SlAT2 gene and AP2e gene results in C 29 H 48 O 15 Acyl sugar content and C 36 H 62 O 15 The acyl sugar content is increased. Even more preferably, the SlAT2 gene encodes the cDNA of SEQ ID No. 2, and the AP2e gene encodes the cDNA of SEQ ID No. 5.
[0011] The tomato plants of the present invention (preferably *S. lycopersicum* plants) exhibit improved insect resistance, wherein the plants comprise a combination of the SlAT2 gene and the AP2e gene, as well as the AP2e gene. The APETALA2 (AP2) gene family (sometimes also referred to as the AP2 / ethylene-responsive element-binding factor (ERF) gene family or the ERF / AP2 gene family) defines a large family of genes (>100+ genes) of DNA-binding proteins called AP2 / ERF in tomato plants. AP2 genes perform a range of functions, including hormone regulation, establishing floral meristem organ characteristics, regulating and growing floral organs, and various responses to environmental stimuli and stresses. Furthermore, it is known that multiple different AP2 genes provide for changes in the hexose to sucrose ratio during seed development of the plant, and that AP2 proteins regulate the amount of sugars in the system and participate in transport, shaping, and signal transduction in the plants using these multiple sugars. Unexpectedly, the combination of the SlAT2 gene and the AP2e gene was found to promote and regulate a specific type of acyl sugar C.29 H 48 O 15 (S4: C17 acyl sucrose) and / or C 36 H 62 O 15 The production of (S4:C24 acyl sucrose) is enhanced, and this specific increased production of acyl sugars is associated with high levels of insect resistance in plants. The SlAT2 gene encodes an acetyl-CoA-dependent acyltransferase, and the AP2e gene encodes the APETALA2e ethylene-responsive transcription factor, which is involved in regulating acyl sugar production. Thus, AP2e appears to be associated with the ability to produce general amounts of different types of acyl sugars, while SlAT2 promotes the production of specific acyl sugars in the plant that influence insect resistance. AP2e affects the total amount of acyl sucrose produced by activating genes involved in biosynthetic pathways and trichome formation, while SlAT2 has a strong influence on the final type of acyl sucrose produced. The active SlAT2 enzyme is responsible for adding an additional acetyl group to acyl sucroses that already have three acyl groups. This results in an increased amount of tetraacyl sucrose at the expense of triacyl sucrose, leading to the improved insect resistance observed in tomato plants. It is a series of cumulative steps of reactions catalyzed by an enzyme of the SlAT type (a different acyl-CoA transferase) that is different from SlAT2, adding at most three acyl chains to the initial sucrose molecule, and thus contributing only indirectly to insect resistance.
[0012] According to another preferred embodiment, the present invention relates to a tomato plant containing a tetraacyl (S4) sugar and a triacyl (S3) sugar, wherein the ratio of the tetraacyl (S4) sugar to the triacyl (S3) sugar (S4:S3) in the plant is at least 1, preferably at least 1.2, more preferably at least 1.5, and most preferably at least 1.7. Experiments have shown that the type of acyl sugar is crucial for providing whitefly resistance in tomato plants. It has been observed that plants containing the AP2e gene and producing acyl sugars are not always resistant to whiteflies. However, compared to susceptible plants that primarily accumulate triacyl (S3) sucrose, plants also containing the SlAT2 gene exhibit improved insect resistance, which is suggested to be related to high levels of tetraacyl (S4) sucrose, such as high C. 29 H 48 O 15 (S4:C17) and C 36 H 62 O 15 (S4:C24).
[0013] The tomato plants of this invention have increased C compared to plants that do not contain the combination of the SlAT2 and AP2e genes. 29 H 48 O 15 Acyl sugar content and / or C36 H 62 O 15 Acyl sugar content. Acyl sugars are secreted by the trichomes; more specifically, C... 29 H 48 O 15 (S4:C17 acyl sucrose) and C 36 H 62 O 15 (S4:C24 Acylsucrose) Acyl sugars are type IV trichome secretions that contribute to insect resistance in tomato plants. AP2e is involved in both trichome development and acyl sugar production. Tomato plants containing the AP2e gene have increased type IV trichomes on the leaf surface and in the stem. Many trichome secretions in tomatoes (approximately 90%) contain acyl sugars, of which more than 70 compounds are known. Acyl sugars produced in tomatoes consist of different combinations of acyl groups derived from different aliphatic acids with different chain lengths that esterify into glucose or sucrose. The acyl chains are primarily short- to medium-length aliphatic acids with branched or narrow chains. In tomatoes, it has been shown that the major short acyl chains of acyl sugars are derived from acetate (C2) or branched amino acids, namely 2-methylpropionic acid (C4) and 3-methylbutyric acid (C5). Longer acyl groups may be derived from β-oxidation products of fatty acids. However, the presence and abundance of specific acyl sugars differed significantly between resistant and susceptible plants, particularly in insect-resistant plants. 29 H 48 O 15 and C 36 H 62 O 15 It has a high content of acyl sugars. These acyl sugars are sticky substances that act as glue traps and are also toxic to insects (especially whiteflies), thus providing the plant with improved insect resistance. In addition, the presence of these specific acyl sugars prevents not only whiteflies but also other piercing-sucking insects from settling on the leaves.
[0014] According to a preferred embodiment, the present invention relates to tomato plants in which the whitefly is selected from one or more species of the following: Aleurocanthus woglumi (citrus black fly), Aleyrodes proletella (cabbage whitefly), tobacco whitefly (silver leaf whitefly), and Trialeurodes vaporariorum (greenhouse whitefly), preferably greenhouse whitefly and / or tobacco whitefly.
[0015] According to a preferred embodiment of the present invention, the plants of the present invention described above are not plants specifically obtained through basic biological methods.
[0016] While the genomic regions or fragments of the present invention can be introduced into tomato plants via introgression, since the nucleotide sequences of the genomic fragments of the present invention are known, these genomic fragments can be artificially constructed, for example, in yeast, and subsequently allowed to recombine with the genome of a susceptible tomato. Alternatively, these genomic regions or fragments can be amplified by long-range PCR, and the resulting amplified fragments can be transformed into spinach cells in a single step or a series of transformations, ultimately producing the tomato plants of the present invention. The genomic fragments of the present invention (which are subsequently completely or partially reassembled), for example after restriction digestion, can also be isolated from gels or columns and subsequently transformed into tomato cells. Furthermore, mutations, deletions, or insertions in the genome can be obtained by EMS mutagenesis and / or CRISPR technology. Alternatively, the target genomic fragment can be introduced into a vector under a (strong) promoter. Subsequently, the vector can be used to transform susceptible plants and express the target sequence, thereby generating resistance. These techniques are readily available to those skilled in the art. The construction of artificial chromosomes containing genomic fragments of the present invention is also contemplated within the context of this invention.
[0017] According to another preferred embodiment, the present invention relates to a tomato plant in which the genomic region encoding the SlAT2 gene has at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No. 1, and wherein the genomic region encoding the AP2e gene has at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No. 4. SEQ ID No. 1 and SEQ ID No. 4 are genomic regions containing the SlAT2 gene and the AP2e gene, respectively, each containing its respective promoter element. They possess at least 95%, preferably at least 98%, more preferably at least 99% sequence identity.
[0018] According to another preferred embodiment, the present invention relates to a tomato plant in which the SlAT2 gene encodes the protein sequence shown in SEQ ID No. 3, and wherein the AP2e gene encodes the protein sequence shown in SEQ ID No. 6.
[0019] According to another preferred embodiment, the present invention relates to a tomato plant in which the SlAT2 gene encodes the coding sequence of SEQ ID No. 2 and the AP2e gene encodes the coding sequence of SEQ ID No. 5.
[0020] According to another preferred embodiment, the present invention relates to a tomato plant in which C 29 H 48 O 15The acyl sugar content is at least 150 μg / g fresh weight (FW) of plant leaves, preferably at least 200 μg / g FW of plant leaves, more preferably at least 250 μg / g FW of plant leaves, and / or C 36 H 62 O 15 The acyl sugar content is at least 125 μg / g plant leaf FW, preferably at least 175 μg / g plant leaf FW, and more preferably at least 250 μg / g plant leaf FW. Fresh weight (FW) is the weight of the plant or a part of the plant (in this case, the plant leaves at harvest). Bioassays have shown that at the required acyl sugar concentration, an average mortality rate of 40% or higher was observed in whiteflies, indicating a level of resistance to whiteflies.
[0021] According to yet another preferred embodiment, the present invention relates to a tomato plant, wherein the plant is obtained from the deposit NCIMB 43748, dated March 18, 2021, at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland.
[0022] According to another preferred embodiment, the present invention relates to tomato plants having an increased acyl sugar content selected from one or more of the following, compared to plants not containing the SlAT2 and AP2e genes: C 28 H 46 O 15 Acyl sugar content, C 34 H 58 O 15 Acyl sugar content and C 35 H 60 O 15 Acyl sugar content. Specifically, acyl sucrose compound C. 29 H 48 O 15 C 36 H 62 O 15 C 28 H 46 O 15 C 34 H 58 O 15 C 35 H 60 O 15 Subsequently, two other sugars, C, were found in the resistant tomato plants. 33 H 56 O 15 and C 37 H 64 O 15It was present at a higher concentration than in its susceptible counterparts (although not significantly).
[0023] According to yet another preferred embodiment, the present invention relates to a tomato plant in which C 28 H 46 O 15 The acyl sugar content is at least 10 μg / g plant leaf fresh weight (FW), preferably at least 15 μg / g plant leaf fresh weight (FW), more preferably at least 20 μg / g plant leaf fresh weight (FW), and / or wherein C 34 H 58 O 15 The acyl sugar content is at least 15 μg / g plant leaf fresh weight (FW), preferably at least 20 μg / g plant leaf fresh weight (FW), more preferably at least 25 μg / g plant leaf fresh weight (FW), and / or wherein C 35 H 60 O 15 The acyl sugar content is at least 12.5 μg / g plant leaf fresh weight (FW), preferably at least 15 μg / g plant leaf fresh weight (FW), and more preferably at least 20 μg / g plant leaf fresh weight (FW).
[0024] According to another preferred embodiment, the present invention relates to tomato plants that are also resistant to mites, preferably spider mites (Tetranychus urticae).
[0025] According to a second aspect, the present invention relates to the seeds, fruits, or plant parts of the tomato plant of the present invention.
[0026] According to another aspect, the present invention relates to a method for providing tomato plants with improved whitefly resistance, the method comprising the steps of providing whitefly-susceptible tomato plants and causing genomic mutations therein, the steps including:
[0027] - Provides a combination of an acetyl-CoA-dependent acyltransferase gene (SlAT2) and an APETALA2e ethylene response transcription factor gene (AP2e), wherein the acetyl-CoA-dependent acyltransferase gene (SlAT2) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 2, and the APETALA2e ethylene response transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 5, wherein the combination of the SlAT2 gene and the AP2e gene, compared to tomato plants without the combination of said genes, results in C 29 H 48 O 15 Acyl sugar content and C 36 H 62 O15 The acyl sugar content is increased.
[0028] According to another aspect, the present invention relates to a method for providing tomato plants with improved whitefly resistance, wherein the method includes the following steps;
[0029] a) Crossing tomato plants susceptible to whiteflies with whitefly-resistant tomato plants of the present invention as defined herein.
[0030] b) Select tomato plants with improved insect resistance, wherein the plants contain the SlAT2 and AP2e genes. Tomato plants with improved insect resistance can be based on C 29 H 48 O 15 Acyl sugar content and / or C 36 H 62 O 15 The selection is based on the determination of the acyl sugar content, wherein C 29 H 48 O 15 The acyl sugar content is at least 150 μg / g plant leaf fresh weight (FW), preferably at least 200 μg / g plant leaf fresh weight (FW), more preferably at least 250 μg / g plant leaf fresh weight (FW), and / or the C content is stated herein. 36 H 62 O 15 The acyl sugar content is at least 125 μg / g plant leaf fresh weight (FW), preferably at least 175 μg / g plant leaf fresh weight (FW), and more preferably at least 250 μg / g plant leaf fresh weight (FW). Furthermore, selection of whitefly-resistant tomato plants can be achieved by identifying or determining specific sequences (cDNA sequences, gDNA sequences, or protein sequences) of SlAT2 and AP2e, as identified herein as SEQ NO ID.1 to SEQ NO ID.6.
[0031] According to another preferred embodiment, the present invention relates to a method in which tomato plants with improved insect resistance are obtained by determining C 29 H 48 O 15 Acyl sugar content and / or C 36 H 62 O 15 The selection is based on the acyl sugar content, wherein the C 29 H 48 O 15 The acyl sugar content is at least 150 μg / g plant leaf fresh weight (FW) and / or the C content is stated in the figure. 36 H 62 O 15 The acyl sugar content is at least 125 μg / g fresh weight of plant leaves (FW).
[0032] According to another aspect, the present invention relates to a combination of two genomic regions for providing insect resistance in tomato plants, comprising a genomic region of SEQ ID No. 1 encoding an acetyl-CoA-dependent acyltransferase gene (SlAT2) and a second genomic region of SEQ ID No. 4 encoding an APETALA2e ethylene response transcription factor gene (AP2e).
[0033] According to another aspect, the present invention relates to a combination of two genes for providing insect resistance in tomato plants, one gene encoding an acetyl-CoA-dependent acyltransferase (SlAT2) protein comprising SEQ ID No. 3 and a second gene encoding an APETALA2e ethylene response transcription factor (AP2e) comprising SEQ ID No. 6.
[0034] According to another aspect, the present invention relates to the use of a combination of two genomic regions or a combination of two genes as defined above in a tomato plant for providing a whitefly-resistant tomato plant.
[0035] The present invention will be further described in detail in the following embodiments and accompanying drawings, wherein:
[0036] Figure 1 Figure E shows leaves (A and B) of a tomato plant (S. lycopersicum, tomato) according to the invention and leaves (C and D) of an insect-susceptible tomato plant (tomato). Both types of tomato plants have been exposed to whitefly infestation in commercial greenhouses that promote whitefly infestation. The leaves of the plant according to the invention are not infested by whiteflies, while the leaves of the insect-susceptible tomato plant are clearly infested by whiteflies. Figure E shows the leaves (S) of the insect-susceptible tomato plant and the leaves (R) of the tomato plant according to the invention; clearly, whiteflies are alive and present on the leaf surface of the S plant, while on the R plant, whiteflies are dead and not present on the leaf surface.
[0037] Figure 2 shows the rate at which dead whiteflies (WF) increase the concentration of acyl sugars in tomato plants. Figure 2A The linear relationship between the number of dead whiteflies and the concentration of acyl sugar C36H62O15 was shown. Figure 2B The dose response of the C29H48O15 acyl sugar is shown. Both of these specific acyl sugars showed negative effects on whitefly survival. On the other hand, other acyl sugars present in the plant, such as C32H54O15 (…),… Figure 2C No, this does not affect whiteflies in this way. Fresh weight (FW) is the weight of the plant, and in this case, it is the leaf weight at harvest. Bioassays show that the acyl sugar content level in the plant leaves directly affects the resistance level, which is observed as whitefly mortality.
[0038] Figure 3 The image shows a stacked LC-MS chromatogram, illustrating the presence and relative concentrations of various acyl sugars in insect-resistant plants (red peak), moderately resistant plants (orange peak), and susceptible plants (green peak). Acyl sugar compounds, labeled in red, are present at high concentrations in insect-resistant plants and are considered to play a key role in the insect resistance of these plants. Acyl sugars, labeled in green, are predominantly found in susceptible plants. This analysis leads to the conclusion that plants with improved insect resistance are associated with high levels of C... 29 H 48 O 15 (S4:C17) and C 36 H 62 O 15 (S4:C24) acyl sugar is involved. Furthermore, no C-related association with plant insect resistance was observed. 27 H 46 O 14 (S3:C15), C 32 H 56 O 14 (S3:C20), C 33 H 58 O 14 (S3:C21), C 34 H 60 O 14 (S3:C22) and C 39 H 68 O 15 Significant changes in (S4:C27) acyl sugar content.
[0039] Figure 4 The image shows the genomic region (gDNA), coding sequence (cDNA), and protein sequence (SEQ ID No. 1 to 3, respectively) of SlAT2, and the gDNA, cDNA, and protein sequence (SEQ ID No. 4 to 6, respectively) of AP2e, wherein the combination of SlAT2 and AP2e provides whitefly resistance in tomato plants. Example
[0040] Biological assay of isolated leaves
[0041] Young leaves, approximately 4 cm long, from at least 12-week-old tomato plants grown in a plastic greenhouse were separated from the tops. The petioles of the leaves were placed in test tubes containing nutrient agarose gel. With the adaxial portion of the leaf facing upwards, the test tubes (using a blu tack) were placed horizontally against the wall of a medium-height glass culture dish, ensuring space between the leaf and the dish on both the adaxial and abaxial sides. Each dish was then inoculated with 25 whiteflies anesthetized with CO2 for 3 seconds.
[0042] Twenty to 48 hours later, the number of whiteflies on the adaxial or abaxial surface and the number of dead whiteflies were counted. Each plant was tested twice, and the percentage of dead whiteflies was calculated by comparing the number of surviving whiteflies (feeding from both adaxial and abaxial parts of the leaves plus those still flying around in the petri dish) to the number of dead whiteflies. Correlation analysis of specific acyl sucroses with whitefly mortality revealed that different specific acyl sucrose molecules play different roles in whitefly resistance / susceptibility. As shown in Figure 2, it illustrates the whitefly (WF) mortality rate relative to the content of specific acyl sucroses present in the plant, primarily C... 29 H 48 O 15 (S4:C17) and C 36 H 62 O 15 (S4:C24) acyl sugars show a high influence on resistance. Other acyl sugar compounds associated with resistance are C... 28 H 46 O 15 (S4:C16), C 34 H 58 O 15 (S4:C22), C 35 H 60 O 15 (S4:C23), C 33 H 56 O 15 (S4:C21) and C 37 H 64 O 15 (S4:C25) acyl sugar.
[0043] Analysis of acyl sugar content in tomatoes by liquid chromatography-mass spectrometry (LC-MS)
[0044] Chemical analysis of the leaf surface of a group of tomato plants, including insect-resistant, moderately resistant, and susceptible plants (all tomatoes) according to the present invention, was performed by LC-MS. Plants were allowed to grow until they had 10 lateral branches, and two opposite leaflets (3×3×3 cm) from the 3rd or 4th terminal leaflet were placed in a 10 ml glass vial. 2 ml of methanol containing an internal standard (sucrose octaacetate, 10 mg / L) was added, and the vial was shaken for 15 seconds. The leaflets were removed, and 300 μl of the methanol extract was transferred to an LC vial and analyzed using an Agilent 1290 Infinity II UHPLC coupled to an Agilent 6230 TOF mass spectrometer.
[0045] 1 μL of the extract was injected and separated on an Agilent ZORBAXRRHD Eclipse Plus C18 column at a mobile phase flow rate of 0.3 mL / min at 50 °C. The mobile phase consisted of water + 0.1% formic acid (A) and acetonitrile + 0.1% formic acid (B) in the following A:B gradient: from 60:40 to 45:55 (within 6 min) to 10:90 (within 8 min) to 60:40 (within 3 min). Molecules were ionized at 325 eV (positive mode) and detected at 1 m / s in the range of 50 to 1500 μM. The extract mainly contained acyl sugars, which were detected as sodium adducts by mass spectrometry.
[0046] Individual acyl sugars were identified using the MassHunter qualitative analysis software (Agilent) by calculating the molecular formula based on the precursor ion constituting the chromatographic peak. Here, the molecular formula was calculated by allowing carbon, hydrogen, and oxygen atoms to form a precursor ion, which, along with H... + Na + and K + The presence of formate / ester adduct combinations, along with double bond equivalents (DBEs) ranging from 1 to 10, restricts the molecular formula. The precise mass of the parent ion combined with the DBE allows for the deduction of the basic structure of the acyl sugar molecule; the main chain portion, the number of acyl chains, and the total number of carbon atoms forming the acyl chains. The amount of acyl sugar is calculated by integrating chromatographic peaks using MassHunter quantitative analysis software (Agilent) and comparing the total peak area of the individual acyl sugar with the total peak area of the internal standard (sucrose octaacetate).
[0047] The obtained LC-MS results were consistent with those obtained from the above-mentioned assays of isolated leaf biomolecules. Further evidence regarding the involvement of specific acyl sugars in insect resistance may be derived from... Figure 3 LC-MS chromatograms. Individual chromatograms of methanolic leaf dips from insect-resistant plants (red), moderately resistant plants (orange), and susceptible plants (green) are superimposed. Acyl sugar compounds, marked in red, are present in high concentrations in plants showing high resistance to whiteflies. Conversely, in plants showing susceptibility to whiteflies, these specific acyl sugars were not detected or only detected at low concentrations by LC-MS. Furthermore, for plants susceptible to whiteflies, the predominantly present acyl sugars are marked in green and are significantly absent or present at low concentrations in resistant plants. From this analysis, it can be concluded that plants with improved insect resistance are associated with high C 29 H 48 O 15 (S4:C17) and C 36 H 62 O 15(S4:C24) acyl sugar is involved. No C was observed in insect-susceptible or resistant plants. 27 H 46 O 14 (S3:C15), C 32 H 56 O 14 (S3:C20), C 33 H 58 O 14 (S3:C21), C 34 H 60 O 14 (S3:C22) and C 39 H 68 O 15 Significant changes in (S4:C27) acyl sugar content.
[0048] Genotyping and mapping of SlAT2 and AP2e.
[0049] Acyl sugar production in tomato plants is associated with high levels of insect resistance. It is important to determine which type of acyl sugar is required for insect resistance. Genotypic data of a resistant tomato plant population (tomato) were investigated using biomarker analysis. Biomarkers M8 and M5 (Table 1) were used to determine the genotype of resistant tomato plants (C). 36 H 62 O 15 (S4:C24) and (C 29 H 48 O 15 (S4:C17) acyl sucrose produces QTLs that are clearly related.
[0050] In summary, based on the reference genome SL2.40, genomic regions related to the amount of acyl sugars produced by type IV trichomes have been mapped onto chromosome 6. Regions involved in acyl sugar production and associated with insect resistance were identified between positions 43250794 bp and 43259933 bp. The marker M5 was 100% correlated with the amount of acyl sugars produced (Table 1). Based on the reference genome SL2.40 and computer predictive analysis (ITAG 2.3), a gene, Solyc06g075510.2, was located in a finely mapped region encoding the APETALA2 ethylene response transcription factor (AP2e).
[0051] Furthermore, the type of acyl sugar is crucial for providing whitefly resistance in tomato plants. It was observed that plants containing the AP2e gene and producing acyl sugars are not always resistant to whiteflies. By comparing the acyl sugar profiles of susceptible and resistant plants, it was concluded that plants with improved insect resistance, compared to susceptible plants that primarily accumulate triacylsucrose (S3), exhibited higher levels of tetraacyl (S4) sucrose C. 29 H48 O 15 (S4:C17) and C 36 H 62 O 15 (S4:C24) is associated with the marker M8. The marker M8 is 100% correlated with the type of acyl sugar (Table 1), and a specific sequence is mapped onto chromosome 1 that encodes a member of the BAHD family of acyltransferases, more specifically the acetyl-CoA-dependent acyltransferase SlAT2, which is capable of acetylation of sucrose and is responsible for producing C. 29 H 48 O 15 (S4:C17) and C 36 H 62 O 15 (S4:C24).
[0052] Sequencing of the functional SlAT2 gene yielded a genomic sequence (SEQ ID No. 1) containing the promoter region. Compared to plants without SEQ ID No. 1 (which cannot produce S4 sugars, making them susceptible to whiteflies), plants containing the combination of SEQ ID No. 1 (i.e., functional SlAT2) and AP2e exhibited an improved S4 / S3 ratio and high resistance to whiteflies. SEQ ID No. 1 shows the genomic sequence containing the SlAT2 gene, which contains the promoter region of the whitefly-resistant plant of the present invention. SEQ ID No. 2 shows the coding sequence of SlAT2 in the plant of the present invention, which encodes the SlAT2 protein of SEQ ID No. 3. SEQ ID No. 4 shows the genomic sequence of the AP2e gene, which contains the promoter region of the whitefly-resistant plant of the present invention. SEQ ID No. 5 shows the coding sequence of AP2e in the plant of the present invention, which encodes the AP2e protein of SEQ ID No. 6.
[0053] Table 1. Marker sequences used for QTL mapping
[0054] markers sequence M5_F (SEQ ID No. 7) GCGAGGCATTTGTTGAAGTTGCTAATGC M5_R (SEQ ID No. 8) GGTTGATACAAACAGCCCATTG M8_F (SEQ ID No. 9) AAGCAATGCGAAATATCGTAAC M8_R(SEQ TD No.10) GAGAGACCCTCACATTTTGTC
[0055] The combination of the SlAT2 and AP2e genes was found to specifically promote and regulate the production of specific types of acyl sugars, such as C. 29 H 48 O 15 (S4: C17 acyl sucrose) and / or C 36 H 62 O 15(S4:C24 acyl sucrose), and more generally, increased the ratio of tetraacylated (S4) sugar to triacylated (S3) sugar. The combination of AP2e (marker M5) + SlAT2 (marker M8) increased the levels of S4:C17 and S4:C24 acyl sucrose required for whitefly resistance. Several tomato plants were selected using the M5 and M8 markers based on the presence / absence of the AP2e gene and the presence / absence, homozygosity / heterozygosity of the SlAT2 gene. The total acyl sugar content (μg / gram plant fresh weight, gFW) and the specific acyl sugar C of each plant were determined. 29 H 48 O 15 (S4: C17 acyl sucrose) and C 36 H 62 O 15 The presence of (S4:C24 acyl sucrose), the ratio of tetraacylated (S4) sucrose to triacylated (S3) sucrose, and resistance to whiteflies were correlated. The genotype of SlAT2 was co-segregated with the production of S4:C17 and S4:C24 acyl sucrose and the increased S4 / S3 ratio, and was associated with whitefly resistance levels (see Table 2).
[0056] Table 2. Presence of AP2e and SlAT2 in plants and their effects on resistance to acyl sugars and whiteflies.
[0057] sequence list <110> Enza Zaden Beheer BV <120> Tomato plants with improved insect resistance <130> P182378PC00 <160> 10 <170> BiSSAP 1.3.6 <210> 1 <211> 2322 <212> DNA <213> Tomato (Solanum lycopersicum) <220> <223> gDNA SlAt2 <400> 1 tcacttgtag gggtggaaaa atagactaaa cctatatata tattatatta tatggttata 60 agtttgatta atccatttta aaatggtttt gtcgttcgaa taaaaatgaa taaaatataa 120 attaattctg gttacattcg tcaataata atatatatat ttttattatta agatattatt 180 tttaataac acttaaaaat tctcaaat attggattg attackattacc aatttattat 240 tagcgaaga tattgtataa tagaaaga cttactttca gagtacttt cttttactc 300 caaaggaaaa ggcttggttg aaggcaaat ttgatgtaat tttggaattc cggcatgcaa 360 agttacaaga gttcacaca ataatgctaa ttattgtagg aatggcttta tcccagaca 420 aaatgagtcc aaatgagttt tcacttccc aatcaggac attctagttc gatagctac 480 tttcacattc tcaatttatt ttataatatt tgatagatga gtgaaactta attttcgatt 540 tttagttagt gagtaaattt tctctcagaa tagttttggt tatgaggaga aaaattta 600 taaactctat tgaaaatatt gtttggaattt ttaggtttct agtttataaa gtatttccca 660 tgtttggtgc aaatcaag aacaacttt tgccagaaa atgcaacagg tatatag 720 cgacatttga ctgatatgat ttaaaatatt taccctgaaa attttgtaat tgtaaaact 780 tttagcgtaa ttaaccgccc aaataaattc tgtagtatat acactagtgt ttgttctgaa caatgcactt tatgaatgtt aaatgcaata tattaagat tgacgccatg ccaaactata fathers' children tgatagattt attcagaaac aacactttat tcatccaaaa aaaaagatga attgttatat tgaaattcaa tcaaggaaaa tggtgaaacc ctcagctcct accccggata atcttcggag attgaagctt tccttgttcg atcagatgga tattggtgca tatgtaccaa ttgtcttcaa ctacttgccg aacagcactt catcatatga tcatgatgat aagcttgaaa aatcattgtc ggagacgcta accaagtttt acccttttgc tggaagattt agaaaaggca ttgatccatt ttccatcgac tgcaatgatg aaggtattga atatgttcga accaaagtca atgcagacga tcttgcccaa tatctccgtg gtcaagccca taatgatatt gagtcgtctt tgattgatct tcttcctgta atgcatcgtc taccatcaag tccattattt 1380 ggtgttcaag tgaatgtatt caataacgga ggtgtaacca tagggataca aattttacat atggtatctg atgctttcac tttagtaaaa tttgtaaatg aatgggcgca caccaccctt acagggacga tgccactaga taatcccggt tttggtcaat tgccatggct atttccagca 1560 agagcgctac cgtttccatt acctgatttc aacactacta ctgcccctaa ttataagaat 1620 gttacaaaga ggtttctctt tgatgctttg gcaatagaaa acctcagaaa tacaatcaaa 1680 gccaatgaca tgatgatgaa gcaaccttct agagtggtgg tcgtgatgtc cctaatatgg 1740 aaggttctta cacacatttc ttccgccaaa aataatggaa attcaaggga ctcatcttta 1800 gtgtttgttg ttaatttgag gggaaaactg tcatgtactg caccgtcttt agaacacgtt 1860 gtagggaatt gtgtaatacc agcaactgct aaaggagg gcgatgaggc aagaagaaag 1920 gatgatgagt tgaatgattt cgttaagttg gtaagaaata caatacggga cacatgtgaa 1980 gccattggta aggcggaaag cgttgatgat atttcctctt tagcatttaa caatctgacg 2040 aaatgtatag aaaaaattct gcatggagac gagatggact tctattcgtg ctctagttgg 2100 tgcggattcc cttggtatga agctgacttt ggttggggaa agccattctg ggtgagctca 2160 gttagttttg gtcatcatgg agtaactaat ctcatggaca caaaagatgg tgatggaata 2220 caagtaacaa tttgtttgaa ggagaatgac atgattgagt ttgagagaga ccctcacatt 2280 ttgtcctcca cttcaaaact agcattccat tccttaggat aa 2322 <210> 2 <211> 1356 <212> DNA <213> Tomato <220> <223> cDNA SlAt2 <400> 2 atgaattgtt atattgaaat tcaatcaagg aaaatggtga aaccctcagc tcctaccccg 60 gataatcttc ggagattgaa gctttccttg ttcgatcaga tggatattgg tgcatatgta 120 ccaattgtct tcaactactt gccgaacagc acttcatcat atgatcatga tgataagctt ,180 gaaaaatcat tgtcggagac gctaaccaag ttttaccctt ttgctggaag atttagaaaa 240 ggcattgatc cattttccat cgactgcaat gatgaaggta ttgaatatgt tcgaaccaaa 300 gtcaatgcag acgatcttgc ccaatatctc cgtggtcaag cccataatga tattgagtcg 360 tctttgattg atcttcttcc tgtaatgcat cgtctaccat caagtccatt atttggtgtt 420 caagtgaatg tattcaataa cggaggtgta accataggga tacaaatttt acatatggta 480 It should be noted that there may be some inaccuracies in the translation due to the complexity and potential ambiguity of the biological sequence content. It is recommended to double-check with relevant biological experts for more accurate understanding and interpretation.tctgatgctt tcactttagt aaaatttgta aatgaatggg cgcacaccac ccttacaggg 540 acgatgccac tagataatcc cggttttggt caattgccat ggctatttcc agcaagagcg 600 ctaccgtttc cattacctga tttcaacact actactgccc ctaattataa gaatgttaca 660 aagaggttc tctttgatgc tttggcaata gaaaacctca gaaatacaat caaagccaat 720 gacatgatga tgaagcaacc ttctagagtg gtggtcgtga tgtccctaat atggaaggtt 780 cttacacaca tttcttccgc caaaaataat ggaaattcaa gggactcatc tttagtgttt 840 gttgttaatt tgaggggaaa actgtcatgt actgcaccgt cttagaaca cgttgtaggg 900 aattgtgtaa taccagcaac tgctaacaag gagggcgatg aggcaagaag aaaggatgat 960 gagttgaatg atttcgttaa gttggtaaga aatacaatac gggacacatg tgaagccatt 1020 ggtaaggcgg aaagcgttga tgatatttcc tctttagcat ttaacaatct gacgaaatgt 1080 atagaaaaaa ttctgcatgg agacgagatg gacttctatt cgtgctctag ttggtgcgga 1140 ttcccttggt atgaagctga ctttggttgg ggaaagccat tctgggtgag ctcagttagt 1200 tttggtcatc atggagtaac taatctcatg gacacaaaag atggtgatgg aatacaagta 1260 acaatttgtt tgaaggagaa tgacatgatt gagtttgaga gagaccctca cattttgtcc 1320 tccacttcaa aactagcatt ccattcctta ggataa 1356 <210> 3 <211> 451 <212> PRT <213> Tomato <220> <223> Protein SlAT2 <400> 3 Met Asn Cys Tyr Ile Glu Ile Gln Ser Arg Lys Met Val Lys Pro Ser 1 5 10 15 Ala Pro Thr Pro Asp Asn Leu Arg Arg Leu Lys Leu Ser Leu Phe Asp 20 25 30 Gln Met Asp Ile Gly Ala Tyr Val Pro Ile Val Phe Asn Tyr Leu Pro 35 40 45 Asn Ser Thr Ser Ser Tyr Asp His Asp Asp Lys Leu Glu Lys Ser Leu 50 55 60 Ser Glu Thr Leu Thr Lys Phe Tyr Pro Phe Ala Gly Arg Phe Arg Lys 65 70 75 80 Gly Ile Asp Pro Phe Ser Ile Asp Cys Asn Asp Glu Gly Ile Glu Tyr 85 90 95 Val Arg Thr Lys Val Asn Ala Asp Asp Leu Ala Gln Tyr Leu Arg Gly 100 105 110 Gln Ala His Asn Asp Ile Glu Ser Ser Leu Ile Asp Leu Leu Pro Val 115 120 125 Met His Arg Leu Pro Ser Ser Pro Leu Phe Gly Val Gln Val Asn Val 130 135 140 Phe Asn Asn Gly Gly Val Thr Ile Gly Ile Gln Ile Leu His Met Val 145 150 155 160 Ser Asp Ala Phe Thr Leu Val Lys Phe Val Asn Glu Trp Ala His Thr 165 170 175 Thr Leu Thr Gly Thr Met Pro Leu Asp Asn Pro Gly Phe Gly Gln Leu 180 185 190 Pro Trp Leu Phe Pro Ala Arg Ala Leu Pro Phe Pro Leu Pro Asp Phe 195 200 205 Asn Thr Thr Thr Ala Pro Asn Tyr Lys Asn Val Thr Lys Arg Phe Leu 210 215 220 Phe Asp Ala Leu Ala Ile Glu Asn Leu Arg Asn Thr Ile Lys Ala Asn 225 230 235 240 Asp Met Met Met Lys Gln Pro Ser Arg Val Val Val Val Met Ser Leu 245 250 255 Ile Trp Lys Val Leu Thr His Ile Ser Ser Ala Lys Asn Asn Gly Asn 260 265 270 Ser Arg Asp Ser Ser Leu Val Phe Val Val Asn Leu Arg Gly Lys Leu 275 280 285 Ser Cys Thr Ala Pro Ser Leu Glu His Val Val Gly Asn Cys Val Ile 290 295 300 Pro Ala Thr Ala Asn Lys Glu Gly Asp Glu Ala Arg Arg Lys Asp Asp 305 310 315 320 Glu Leu Asn Asp Phe Val Lys Leu Val Arg Asn Thr Ile Arg Asp Thr 325 330 335 Cys Glu Ala Ile Gly Lys Ala Glu Ser Val Asp Asp Ile Ser Ser Leu 340 345 350 Ala Phe Asn Asn Leu Thr Lys Cys Ile Glu Lys Ile Leu His Gly Asp 355 360 365 Glu Met Asp Phe Tyr Ser Cys Ser Ser Trp Cys Gly Phe Pro Trp Tyr 370 375 380 Glu Ala Asp Phe Gly Trp Gly Lys Pro Phe Trp Val Ser Ser Val Ser 385 390 395 400 Phe Gly His His Gly Val Thr Asn Leu Met Asp Thr Lys Asp Gly Asp 405 410 415 Gly Ile Gln Val Thr Ile Cys Leu Lys Glu Asn Asp Met Ile Glu Phe 420 425 430 Glu Arg Asp Pro His Ile Leu Ser Ser Thr Ser Lys Leu Ala Phe His 435 440 445 Ser Leu Gly 450 <210> 4 <211> 4556 <212> DNA <213> Tomato <220> <223> gDNA AP2e <400> 4 aatgaaaaaa caaaagggaa atgtcataga ttttctatac gaataattgc tattacttgt 60 aattagaagt gacattgcgg gagtaagcta aataaaatat gtatataact atataaattt 120 tgtacaaaat aggaccgaat tttagtccaa aactgtaaat gaagagtgtt tttataaatt 180 ataaatgttt ggataattta aaattttaaa aaatccccga atactttttc ccccctaata 240 tttgaaaact taggatggtt accaaatatg tttataaaga aataacaact tatatttgaa 300<00,00499>aatacttgtg gccaaatgaa aatgagaaac tcgttttttt aaaatttcta tatgtaaaat 360 ttaaaaatgt aattttttac caaaatattt tcatcgtcca taatgcaccc gcagtctttt 420 gtaaaataag gtccacttga aacgaaaagc tcacggccca tgcaacctc ctgcatcata 480 cattagttaa ttagtatact taatttcaa cttatttactc ttagttact tgagtttta 540 aattttgatt tttatataca aaattatgat gttaattta aaatatatca atactttcc 600 tattctgttt tataatgtct acatgagat ctttaataaa aaagaaatt tattttttt 660 ggtccatatc aaattatgat tttttgaa ccattatgct aagttaaact acaatttaac 720 tgataactaa tcaatcctca agggaactat tcattcggac ccatctagga atccattatt 780 cgttagccat ttacaagaat agagacccca ttaagataa tacataaaat taatagttat 840 aatggagcac ccaatacttc ttaatttgca taaaaggtgc ttgctgat ttcaatttcc 900 taaaagagat atatataatg taggtgaga aaataatctt tcctattgc cagcgtggat 960 tcaatgagt aaaaaaat taaaata aacataata tagattac aaaaaatga 1020 aaaggggggc cccacgttct gttttggta aaagaata gagtatttt ttgtaaattt 1080 ttccatataa aaccatagtg ttcccaaa taagaggaac caaagtagc ttcacaaatc 1140 acacaaccca cataagttgc ctcacacgtc ccatctttct tcttccccaa cccctacccc 1200 ctatctactg ctcctatgga gtactataac taaatgaaat tcatctcaat ttattcttct 1260 tccattgacg cttacaatca ttttggttaa ctcccacaga tattttatag ttagtcaaaa 1320 acagaacaat gttggatctc aatgtaagcg taatctacag taatgacctt ccacaagttt 1380 ctctacttga tgaatcagcc acctccaatt catccttacg aaatgcggaa gctacaacca 1440 gtgccggtga cgaagattcg tgcgccggtg agttgttcgc tttcaatttt ggaatcctca 1500 aagttgaagg agctgagact agtaggagca gcaacaacga tgatgaggaa gcatacggta 1560 agaatcagag agttactcat tctcaattcg tgactaggca gctgtttccc gttgatgatg 1620 gtgagttgaa ccggaaacaa accgatcggg tcattctctc ctccgctcga tccggtactt 1680 ctatcggttt tggagatgtg cggataatac aacagcaaca aacggagcaa ccgaaacaac 1740 aagtgaagaa gagtaggaga ggcccaaggt caagaagttc acagtacaga ggtgtcactt 1800 tctaccgtag aactggtaga tgggaatcac atatatggtt agttttctaa ctgatttttt 1860 ttttgttgat aggatgatga ttaattggca aatgataaat tgtcaatttt attaatataa 1920 ctacaattgg atgcagggac tgtgggaaac aagtatatttt gggtatggat attgctattt 1980 taaatataca gtttggttaa tttcgttgtt tttgtggatt ttggtgctaa agctgtgtct 2040 atactttttg ctaatttttg attgtttttt tttgttgctt tatattaggt ggttttgata 2100 ctgctcacac agcagcaagg taaaataaaa gtcatatgag ttctcaaata tacgcgtcat 2160 cagatttttc aaatttatgc tatttcccaa atttgattgt atttgttttc ttctccgttg 2220 tacagagctt atgacagagc tgcaattaaa tttaggggtg ttgatgctga tatcaacttt 2280 agcttaagtg attacgagga ggatatgcaa caggttagaa atgcaaagat ttaatatgtg 2340 caaatatgtt aaagtcactg ttgagcgctt ctctgggttt attattgctt ctgttttaat 2400 tggcatcaat aatatgaatc atatacaagt attctgaact atttggtgga cacctttttt 2460 tgattacgc agatgaaaaa ccttggtaaa gaagaatttg tgcacttgct gcgacgccat 2520 agcactggtt tctcaagagg gagctccaaa ttcagaggag tgacgctaca taaatgtggc 2580 agatgggagg ctcggatggg acagttcctc gggaaaaagt aaggaactca ctcactcatt 2640 gaaattcg aagaagtaga ttacatctta ttatagtaat tggtcaaaaa tgggacatac 2700 atatgtttaa attgcgtatt tgaagaagaa atcattggga caacagtatt catagtgggg 2760 attgcactgc ttatattgca ggtatatata tcttgggctg ttcgacagcg aagtagaagc 2820 tgcaaggtcc taatgataat gaattaccct ctctctgatg atgaacattt atcctaaatt 2880 ttcaacttta attatgtgtc atctaaccgg tatctcctttt atttttttgc aaatcagggc 2940 ctacgataag gcggcaatta aaactagcgg aagggaagct gttaccaact ttgagccaag 3000 tagctatgaa ggggaaacaa tgtctttacc acagagtgaa ggtttgctca aaagttcttg 3060 gtcatttcca aactaatata gatacatgca acagtagtat ctatatgtgg atctatctca 3120 tttgtgatgc ctatgatgca ggtagccaac atgatcttga tctgaacttg gggatatcga 3180 ccacttcttc aaaggaaaat gacaggttgg gaggttctcg ctatcatcct tacgatatgc 3240 aagacgcaac aaaacctaag gtattagcag agtagcttat atgcttctgt tcttgcaaaa 3300 tcaattggat taaaatgctc tcctttatgt tatagtcttc tattgttact tctttcatag fathergca father tgcagtaatt catgagtatt agttattggt father tctccttttt gttaatttag atagctttttc ccattcatac atagtgtga taaaacatgt tcatgagcat tgttaatctt tcgtttttgt agattgtaat aatctatttg tgctctttaa ctatagatgg ataaacctgg ttcagtaata gttggaagtt cacatctcaa gggactatca atgtcgtccc aacaagctca attgtggact ggaatctatt ctaatttctc ttccagctat gaggtaaat actaactcta ccatcagtca gaatttggg accaaataca gtgatgaaac tccaatttat ctctgtttag tcttcttttc ctcacttatc gtcaaattag cacgtattca gttgccaaaa tagccatatt catgccccct taccccaatt tccctcaagt gctgggacca tttgtgttgt atgaaatgtt ttacctttttt ccttctagtt ctttgcattg tcttcagttg 3900 ccaaataac tatctccatc cccgaagccc aatttctctg aagtactgaa attttgtc ttgtatgaaa cattttacct ttttacttct tgtgtttttt ggggctgata atcagtgata gtatgcccca tgacaaatga taatattgtt gtgggatcgt acaccccatg ataagattta 4080 tctttaactt aacaaaattt ctttgtactt agtcaatcat ttggataatc atgagctatg 4140 ttatacttgg ggtgcatatt ctcatgtgtg gtcacagcca gtttttcact gcaaacagtt 4200 gtctaaaagt caatgtcttt gttatgccct tttgtgcctc ttcttaattg aatgcatcct 4260 tagtgtaacc ttccaaaacc ctctctctgt taatttaact aataatcata tggcagggaa 4320 gagcatatga caagagaaag gacacaggtt catcacaagg acctccaaat tgggcattgc 4380 aaatgcctag tcaggttgat acaaacagcc cattgacaat gttctgcacg gcatcatcat 4440 caggattctt cattccatct actacttctg tcacttcatc aacatctgca ttagcaactt 4500 caacaaatgc ctcgcagtgc ttttaccaga ttaatccccg cctaccactt ccataa 4556 <210> 5 <211> 1425 <212> DNA <213> Tomato <220> <223> cDNA AP2e <400> 5 atgttggatc tcaatgtaag cgtaatctac agtaatgacc ttccacaagt ttctctactt 60 gatgaatcag ccacctccaa ttcatcctta cgaatgcgg aagctacac cagtgccggt 120 gacgaagatt cgtgcgccgg tgagttgttc gctttcaatt ttggaatcct caagttgaa 180 ggagctgaga ctagtaggag cagcaac gatgatgagg aagcatacgg window 240 agagttactc attctcaatt cgtgactagg cagctgttc ccgttgatga tggtgagttg 300 aaccggaaac aaccgatcg gttcattctc tcctccgctc gatccggtac ttctatcggt 360 tttggagatg tgcggataat aacagca aaacggagc aaccgaaca acaagtgaag 420 aagagtagga gaggcccaag gtcaagaagt tcacagtaca gaggtgtcac ttctaccgt 480 agaactggta gatgggaatc acatatgg gactgtggga aacaagtata ttgggtggt 540 tttgatactg ctcacacagc agcagagct tatgacagag ctgcaattaa atttaggtt 600 gttgatgctg atcaactt tagcttaagt gattacgagg aggatatgca acagatgaaa 660 aaccttgta aagagaatt tgtgcacttg ctgcgacgcc atagcactgg tttctcaga 720 gggagctcca aattcagagg agtgacgcta cataaatgtg gcagatggga ggctcggatg 780 ggacagttcc tcgggaaaaa gtatatatat cttgggctgt tcgacagcga agtagaagct 840 gcaagggcct acgataaggc ggcaattaaa actagcggaa gggaagctgt taccaacttt 900 gagccaagta gctatgaagg ggaaacaatg tctttaccac agagtgaagg tagccaacat 960 gatcttgatc tgaacttggg gatatcgacc acttcttcaa aggaaaatga caggttggga 1020 ggttctcgct atcatcctta cgatatgcaa gacgcaacaa aacctaagat ggataaacct 1080 ggttcagtaa tagttggaag ttcacatctc aagggactat caatgtcgtc ccaacaagct 1140 caattgtgga ctggaatcta ttctaatttc tcttccagct atgagggaag agcatatgac 1200 aagagaaagg acacaggttc atcacaagga cctccaaatt gggcattgca aatgcctagt 1260 caggttgata caaacagccc attgacaatg ttctgcacgg catcatcatc aggattcttc 1320 attccatcta ctacttctgt cacttcatca acatctgcat tagcaacttc aacaaatgcc 1380 tcgcagtgct tttaccagat taatccccgc ctaccacttc cataa 1425 <210> 6 <211> 474 <212> PRT <213> Tomato <220> <223> Protein AP2e <400> 6 Met Leu Asp Leu Asn Val Ser Val Ile Tyr Ser Asn Asp Leu Pro Gln 1 5 10 15 Val Ser Leu Leu Asp Glu Ser Ala Thr Ser Asn Ser Ser Leu Arg Asn 20 25 30 Ala Glu Ala Thr Thr Ser Ala Gly Asp Glu Asp Ser Cys Ala Gly Glu 35 40 45 Leu Phe Ala Phe Asn Phe Gly Ile Leu Lys Val Glu Gly Ala Glu Thr 50 55 60 Ser Arg Ser Ser Asn Asn Asp Asp Glu Glu Ala Tyr Gly Lys Asn Gln 65 70 75 80 Arg Val Thr His Ser Gln Phe Val Thr Arg Gln Leu Phe Pro Val Asp 85 90 95 Asp Gly Glu Leu Asn Arg Lys Gln Thr Asp Arg Val Ile Leu Ser Ser 100 105 110 Ala Arg Ser Gly Thr Ser Ile Gly Phe Gly Asp Val Arg Ile Ile Gln 115 120 125 Gln Gln Gln Thr Glu Gln Pro Lys Gln Gln Val Lys Lys Ser Arg Arg 130 135 140 Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe Tyr Arg 145 150 155 160 Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys Gln Val 165 170 175 Tyr Leu Gly Gly Phe Asp Thr Ala His Thr Ala Ala Arg Ala Tyr Asp 180 185 190 Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile Asn Phe Ser 195 200 205 Leu Ser Asp Tyr Glu Glu Asp Met Gln Gln Met Lys Asn Leu Gly Lys 210 215 220 Glu Glu Phe Val His Leu Leu Arg Arg His Ser Thr Gly Phe Ser Arg 225 230 235 240 Gly Ser Ser Lys Phe Arg Gly Val Thr Leu His Lys Cys Gly Arg Trp 245 250 255 Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile Tyr Leu Gly 260 265 270 Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp Lys Ala Ala 275 280 285 Ile Lys Thr Ser Gly Arg Glu Ala Val Thr Asn Phe Glu Pro Ser Ser 290 295 300 Tyr Glu Gly Glu Thr Met Ser Leu Pro Gln Ser Glu Gly Ser Gln His 305 310 315 320 Asp Leu Asp Leu Asn Leu Gly Ile Ser Thr Thr Ser Ser Lys Glu Asn 325 330 335 Asp Arg Leu Gly Gly Ser Arg Tyr His Pro Tyr Asp Met Gln Asp Ala 340 345 350 Thr Lys Pro Lys Met Asp Lys Pro Gly Ser Val Ile Val Gly Ser Ser 355 360 365 His Leu Lys Gly Leu Ser Met Ser Ser Gln Gln Ala Gln Leu Trp Thr 370 375 380 Gly Ile Tyr Ser Asn Phe Ser Ser Ser Tyr Glu Gly Arg Ala Tyr Asp 385 390 395 400 Lys Arg Lys Asp Thr Gly Ser Ser Gln Gly Pro Pro Asn Trp Ala Leu 405 410 415 Gln Met Pro Ser Gln Val Asp Thr Asn Ser Pro Leu Thr Met Phe Cys 420 425 430 Thr Ala Ser Ser Ser Gly Phe Phe Ile Pro Ser Thr Thr Ser Val Thr 435 440 445 Ser Ser Thr Ser Ala Leu Ala Thr Ser Thr Asn Ala Ser Gln Cys Phe 450 455 460 Tyr Gln Ile Asn Pro Arg Leu Pro Leu Pro 465 470 <210> 7 <211> 28 <212> DNA <213> Artificial sequence <220> <223> M5 forward <400> 7 gcgaggcatt tgttgaagtt gctaatgc 28 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> M5 Reverse <400> 8 ggttgataca aacagcccat tg 22 <210> 9 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> M8 forward <400> 9 aagcaatgcg aaatatcgta ac 22 <210> 10 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> M8 Reverse <400> 10 gagagaccct cacattttgt c 21
Claims
1. A method for providing tomato plants with improved resistance to whiteflies, wherein the method comprises providing in the tomato plant a combination of an acetyl-CoA-dependent acyltransferase gene SlAT2 and an APETALA2e ethylene response transcription factor gene AP2e, wherein the acetyl-CoA-dependent acyltransferase gene SlAT2 encodes a cDNA sequence having at least 99% sequence identity with SEQ ID No. 2, and the APETALA2e ethylene response transcription factor gene AP2e encodes a cDNA sequence of SEQ ID No. 5, wherein the SlAT2 gene encodes the protein sequence shown in SEQ ID No. 3, wherein the combination of the SlAT2 gene and the AP2e gene results in improved C... 29 H 48 O 15 Acyl sugar content and C 36 H 62 O 15 The acyl sugar content is increased.
2. The method according to claim 1, wherein the plant comprises tetraacyl S4 sugar and triacyl S3 sugar, wherein the ratio of tetraacyl S4 sugar to triacyl S3 sugar in the plant is at least 1 (S4:S3).
3. The method according to claim 2, wherein the ratio of tetraacyl S4 sugar to triacyl S3 sugar in the plant is at least 1.
2.
4. The method according to claim 2, wherein the ratio of tetraacyl S4 sugar to triacyl S3 sugar in the plant is at least 1.
5.
5. The method according to claim 2, wherein the ratio of tetraacyl S4 sugar to triacyl S3 sugar in the plant is at least 1.
7.
6. The method according to any one of claims 1 to 5, wherein the genomic region encoding the SlAT2 gene comprises SEQ ID No. 1, and wherein the genomic region encoding the AP2e gene comprises SEQ ID No.
4.
7. The method according to any one of claims 1 to 5, wherein the AP2e gene encodes the protein sequence shown in SEQ ID No.
6.
8. The method according to any one of claims 1 to 5, wherein C 29 H 48 O 15 The acyl sugar content is at least 150 μg / g plant leaf fresh weight (FW), and / or the C content is stated in the figure. 36 H 62 O 15 The acyl sugar content is at least 125 μg / g of plant leaf FW.
9. The method according to any one of claims 1 to 5, wherein the plant, compared to a tomato plant not containing the combination of said genes, further has an increased content of one or more acyl sugars selected from: C 28 H 46 O 15 Acyl sugar content, C 34 H 58 O 15 Acyl sugar content and C 35 H 60 O 15 Acyl sugar content.
10. The method of claim 9, wherein C 28 H 46 O 15 The acyl sugar content is at least 10 μg / g plant leaf FW, and / or the C mentioned above. 34 H 58 O 15 The acyl sugar content is at least 15 μg / g plant leaf FW, and / or the C mentioned above. 35 H 60 O 15 The acyl sugar content is at least 12.5 μg / g of plant leaf FW.
11. The method according to any one of claims 1 to 5, wherein the plant is obtained from NCIMB 43748, wherein the resistant tomato plant contains the combination of the SIAT2 and AP2e genes.
12. The method according to any one of claims 1 to 5, wherein the plant is also resistant to mites.
13. The method of claim 12, wherein the plant is also resistant to spider mites.
14. The method of claim 12, wherein the plant is also resistant to the two-spotted spider mite (Tetranychus urticae).
15. The method according to any one of claims 1 to 5, the method comprising the step of causing a genomic mutation in the tomato plant to provide a combination of the acetyl-CoA-dependent acyltransferase gene SlAT2 and the APETALA2e ethylene response transcription factor gene AP2e.
16. A method for providing tomato plants with improved whitefly resistance, wherein the method comprises the following steps: Select a tomato (S. lycopersicum) plant containing the SlAT2 gene and AP2e gene as defined in any one of claims 1 to 15.
17. The method of claim 16, wherein the tomato plants with improved insect resistance are determined by C 29 H 48 O 15 Acyl sugar content and / or C 36 H 62 O 15 The selection is based on the acyl sugar content, wherein the C 29 H 48 O 15 The acyl sugar content is at least 150 μg / g plant leaf fresh weight (FW) and / or the C content is stated in the figure. 36 H 62 O 15 The acyl sugar content is at least 125 μg / g fresh weight of plant leaves (FW).
18. A combination of two genomic regions for providing insect resistance in tomato plants, wherein one genomic region consists of SEQ ID NO.1 encoding the acetyl-CoA-dependent acyltransferase gene SlAT2, and the second genomic region consists of SEQ ID NO.4 encoding the APETALA2e ethylene response transcription factor gene AP2e, wherein the SlAT2 gene and the AP2e gene are as defined in any one of claims 1 to 15.
19. A combination of two genes for providing insect resistance in tomato plants, one gene encoding the acetyl-CoA-dependent acyltransferase SlAT2 protein, which is composed of SEQ ID No. 3, and the second gene encoding the APETALA2e ethylene response transcription factor AP2e, which is composed of SEQ ID No.
6.
20. The use of a combination of two genomic regions and / or a combination of two genes as described in claim 18 or 19 in a tomato plant to provide a whitefly-resistant tomato plant.
Citation Information
Patent Citations
Preparation method of early-blossoming high-yield tomato material
CN111662366A
Tomato anti insect related gene, its coding protein and application
CN1824778A