A method for rapid identification of salt-resistance function of grape miRNA based on chemically synthesized miRNA
By chemically synthesizing miRNA and dripping it onto the surface of grape callus tissue, the problem of long genetic transformation cycle in grape miRNA function research was solved, the salt resistance function of grape miRNA was quickly verified, a theoretical basis for regulating plant salt resistance was provided, and the application of other stress resistance identification was expanded.
Patent Information
- Application Number
- CN202310275573.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-26
- Filing Date
- 2023-03-21
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2043-03-21
AI Technical Summary
The research on grape miRNA function is limited by the long genetic transformation cycle, complex operation and low efficiency, resulting in slow progress in the verification of its salt-resistance function.
Chemically synthesized miRNA was added to the surface of grape callus for functional verification, which simplified the operation and shortened the verification cycle.
It provides a method for rapidly verifying the salt-resistance function of grape miRNA, provides a theoretical basis for regulating plant salt resistance, and can be used for functional identification of other stress-resistance phenotypes, with broad application value.
Smart Images

Figure CN116879494B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a method for rapidly identifying the salt-resistance function of grape miRNA based on chemically synthesized miRNA. Background Art
[0002] MicroRNA (miRNA)-mediated gene silencing regulates physiological and biochemical processes within plants, thereby controlling their growth, development, and adaptability to the external environment. In recent years, with the rapid development and maturity of high-throughput sequencing technologies, an increasing number of miRNAs have been identified in plants. The latest PmiREN (Plant miRNA ENcyclopedia) lists 148 and 135 miRNA families in Arabidopsis and grapevine, respectively. As regulatory factors, miRNAs are widely involved in various stages of plant growth and development. Numerous studies have demonstrated that miRNAs play a crucial role in plant responses to salt stress. Exploring the salt-tolerance function of miRNAs makes them promising targets for genetically engineering salt tolerance in crops. Currently, overexpression or silencing methods are commonly used to obtain stably inherited transgenic plants and verify the salt-tolerance function of miRNAs.
[0003] Grape (Vitis vinifera L.) belongs to the Vitaceae family, genus Vitis. Its genome was published in 2007, making it the first fruit tree to be sequenced. However, research on the functional miRNAs in grape lags far behind that of model plants such as Arabidopsis thaliana and tomato, primarily due to the long genetic transformation cycle, complex procedures, and low transformation efficiency.
[0004] To date, there are no reports on the verification of miRNA function in native grape species. Summary of the Invention
[0005] In response to the above-mentioned existing technologies, the present invention aims to provide a method for rapidly identifying the salt-resistance function of grape miRNA based on chemically synthesized miRNA. This method abandons the traditional approach of verifying miRNA function through genetic transformation. Instead, it chemically synthesizes miRNA and drips it onto the surface of callus tissue for functional verification. This method requires a short cycle and is simple to operate, thus possessing great application value.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] The first aspect of the present invention provides a method for rapidly identifying plant miRNA function, comprising the following steps:
[0008] According to the sequence information of the plant miRNA to be identified, the miRNA is chemically synthesized; the chemically synthesized miRNA is dripped onto the surface of the plant callus tissue, and then the phenotypic function of the plant callus tissue is identified.
[0009] Preferably, the concentration of chemically synthesized miRNA added is 35-40 nM.
[0010] Preferably, the plant miRNA is grape miR3631f.
[0011] Preferably, the phenotypic functional identification includes: salt resistance, drought resistance and metal ion stress resistance.
[0012] Preferably, the plant miRNA is from a plant species that is difficult to genetically transform, including but not limited to grape, cherry, apple, and pear.
[0013] The second aspect of the present invention provides the use of grape miR3631f in regulating grape salt resistance; the nucleotide sequence of the grape miR3631f is shown in SEQ ID NO.1.
[0014] A third aspect of the present invention provides a method for improving the salt resistance of grapes, comprising the step of silencing grape miR3631f.
[0015] Beneficial effects of the present invention:
[0016] In response to the current situation that the grape genetic transformation system has a long cycle and the research foundation of miRNA function is weak, the present invention chemically synthesized grape miR3631f. By dripping miR3631f onto the surface of grape callus, the salt resistance function of miR3631f was verified, providing a theoretical basis for regulating plant salt resistance. It also provides a reference for functional verification of miRNA in other plant species that are difficult to genetically transform, such as apple, cherry, and pear. In addition to being used for salt resistance identification, this method can also be used for phenotypic functional identification of other stress resistances such as drought and metal ion stress, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The expression of grape miR3631f after salt stress.
[0018] Figure 2 The RACE method was used to verify the cleavage relationship between grape miR3631f and its target gene VHAc1.
[0019] Figure 3 The luciferase method was used to verify the cleavage relationship between grape miR3631f and its target gene VHAc1.
[0020] Figure 4 The effect of adding chemically synthesized miR3631f on the expression level of its target gene VHAc1.
[0021] Figure 5The effect of chemically synthesized miR3631f on the salt-resistant phenotype of grape callus tissue. DETAILED DESCRIPTION
[0022] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.
[0023] As mentioned above, research on the functions of plant miRNAs has attracted considerable attention. However, due to the difficulty of genetic transformation in non-model plants such as grapes, progress in miRNA functional research has been slow, and direct evidence on miRNA function is lacking. Salt stress is a major factor affecting the development of the grape industry, and identifying miRNAs involved in the salt tolerance pathway in grapes is of great significance for regulating salt tolerance.
[0024] Based on this, the present invention abandons the approach of verifying miRNA function through genetic transformation and takes a different approach. It is assumed that callus cells can absorb miRNA, which can regulate the expression of target genes after entering the cells to exert its function. Therefore, by chemically synthesizing miRNA and dripping it onto the callus surface, it is expected that the function of miRNA can be verified, which will greatly shorten the verification cycle of grape miRNA function and simplify the experimental operation.
[0025] MiR3631 is a collective term for a family of proteins, including miR3631a, miR3631b, miR3631c, miR3631d, miR3631e, and miR3631f. The precursor sequences of all members are distinct. The mature sequences of miR3631a, miR3631b, miR3631c, and miR3631d are identical, while the mature sequences of miR3631e and miR3631f are identical. During our research, we failed to clone the precursor sequence of miR3631e (implying that mature miR3631e expression is extremely low), so we used miR3631f as an example to verify its function.
[0026] The nucleotide sequence of miR3631f is shown in SEQ ID NO. 1, and is as follows:
[0027] miR3631f: AUAUUGGAUGAUGUCAACAAG; (SEQ ID NO.1)
[0028] Based on the sequence information of miR3631f, the present invention first synthesized miR3631f through chemical synthesis. The synthesized miR3631f was then added dropwise to the surface of grape callus tissue. The grape callus tissue was then placed in a simulated salt environment. Grape callus tissue is sensitive to salt concentration and tends to turn black at high salt concentrations. However, low salt concentrations prevent functional identification. After testing multiple concentrations, it was found that a sodium chloride concentration of 25 mM was most effective.
[0029] Through the above method, the present invention discovered for the first time that miR3631f can regulate the salt resistance of grapes. After adding miR3631f, the salt resistance of callus tissue decreased, providing direct evidence that miR3631f is involved in the salt resistance function in grapes.
[0030] Based on the miR3631f discovered above, the scope of protection of the present invention also includes fragments homologous to miR3631f. These fragments homologous to the miR3631f gene include alleles, homologous genes, mutant genes, and derivative genes corresponding to the nucleotide sequence of the present invention (SEQ ID NO. 1), all of which are protected by the present invention.
[0031] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.
[0032] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.
[0033] Example 1: Expression of grape miR3631f at different salt treatment time points
[0034] 1. Plant materials:
[0035] 'SA15' grapevine tissue culture seedlings, subcultured for one month and showing consistent growth, were randomly divided into treatment and control groups, with nine plants in each group. Three replicates were set up, with three plants in each replicate. The treatment group seedlings were immersed in a 150mM NaCl solution, while the control group had the salt solution replaced with sterile water. Root samples were then taken at different time points. All samples were snap-frozen in liquid nitrogen, and RNA was extracted to examine the expression of miR3631f at different time points after salt treatment.
[0036] 2. RT-qPCR detection of miR3631f expression level
[0037] Total RNA from grapes was extracted using a plant RNA extraction kit (R015-50, Beijing Jinbaite Biotechnology Co., Ltd.) according to the standard instructions. 1000 ng of total RNA was reverse transcribed using the following collar-loop primers (6210A, Takara Biotechnology Co., Ltd.):
[0038] miR3631f-FZ:
[0039] 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTGTTGA-3′
[0040] (SEQ ID NO. 2);
[0041] Specific primers for quantitative analysis of grape miR3631f in RT-qPCR were designed as follows:
[0042] miR3631f-F: 5′-CGGCGGATATTGGATGA-3′ (SEQ ID NO.3);
[0043] miR3631f-R: 5′-GTGCAGGGTCCGAGGT-3′ (SEQ ID NO. 4).
[0044] The internal reference gene is ACTINF, and its primers are:
[0045] ACTINF: 5′-CTTGCATCCCTCAGCACCTT-3′ (SEQ ID NO.5);
[0046] ACTINR: 5'-TCCTGTGGACAATGGATGGA-3' (SEQ ID NO. 6).
[0047] Real-time PCR reactions were performed on a real-time fluorescence quantitative PCR instrument (CFX connect Real Time PCR Detection System, Bio-Rad). The reaction system used was a 20 μL system (10 μL SYBR Premix Ex Taq, 0.6 μM each of upstream and downstream primers, 1 μL of cDNA template, and the remainder was filled with water). The program was set as follows: 95°C for 30 s; 95°C for 5 s, 60°C for 10 s, for 40 cycles. The relative expression levels of genes were analyzed using the 2-ΔΔct method (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method.Methods 2001,25(4):402-408.).
[0048] The results showed that the expression level of miR3631f was upregulated after salt treatment and reached the highest value at 12h ( Figure 1 ).
[0049] Example 2: Verification of grape miR3631f targeting VHAc1
[0050] The psRNATarget software predicted that the salt-resistant gene VHAc1 (NCBI accession number: XM_002279044.4) can be cleaved by miR3631f. The present invention was verified by 5'-RLM-RACE and luciferase reporter gene experiments.
[0051] 1.5′-RLM-RACE
[0052] Synthesize RNA adapters and ligate the RNA. Perform the first round of PCR using RACE-F1 and VHAc1-R primers. Use the first-round PCR product as a template for the second round of PCR using RACE-F2 and VHAc1-R primers. Ligate the PCR product to the cloning vector, and select positive single clones for sequencing. Test whether a sequence containing a VHAc1 fragment can be obtained, thereby confirming whether VHAc1 can be cleaved by miR3631f.
[0053] RNA ligation adapter:
[0054] 5′-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3′ (SEQ ID NO.7)
[0055] Slot primer sequence:
[0056] RACE-F1: 5′-CGACTGGAGCACGAGGACACTGA-3′ (SEQ ID NO.8)
[0057] RACE-F2: 5′-GGACACTGACATGGACTGAAGGAGTA-3′ (SEQ ID NO.9)
[0058] VHAc1-R: 5′-GCCCAGCGAGAAAACTAATTCC-3′ (SEQ ID NO. 10)
[0059] The results showed that: the sequencing results of 5′-RLM-RACE products confirmed that VHAc1 was cleaved by miR3631f, and the cleavage site was located between the 10th and 11th bases of the predicted target site ( Figure 2 ).
[0060] 2. Luciferase reporter gene assay
[0061] VHAc1 was linked to the luciferase vector pGreen0800II-miRNA (800-VHAc1) and the amplification primers were as follows:
[0062] 800-VHAc1-F:5′-agatcgccgtgtaattctagaATGACTACCTTCAGCGGCGA-3′(SEQ IDNO.11)
[0063] 800-VHAc1-R:5′-agcgaattcactagtggatccCTATTCAGCTCTTGATTGACCAGC-3′(SEQID NO.12)
[0064] The miR3631f precursor primer was connected to the overexpression vector PHB (PHB-miR3631f). The amplification primers are as follows:
[0065] PHB-miR3631f-F:5′-accagtctctctctcaagcttAAAAAAGTCCCGGTGTTTGTTTT-3′(SEQID NO.13)
[0066] PHB-miR3631f-R:5′-gctcctgcagctcgaggatccAGGGGACTTAGGTAGTGTTTGTTTTT-3′(SEQ ID NO.14)
[0067] The obtained positive plasmids were transformed into Agrobacterium tumefaciens GV3101 via the freeze-thaw method. The 800-VHAc1+PHB empty vector and the 800-VHAc1+PHB-miR3631f vector were injected into tobacco leaves via Agrobacterium infection. Three days later, luciferase activity was measured using the IVIS Lumina II high-sensitivity imaging system.
[0068] The results showed that the fluorescence value of the 800-VHAc1+PHB-miR3631f group was much lower than that of the 800-VHAc1+PHB empty vector combination, indicating that miR3631f can cut VHAc1 ( Figure 3 ).
[0069] Example 3: Chemical synthesis of grape miR3631f
[0070] Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize miR3631f and control oligonucleotides.
[0071] miR3631f: AUAUUGGAUGAUGUCAACAAG; (SEQ ID NO.1)
[0072] Control oligonucleotide: TTC TCC GAA CGT GTC ACG TTT (SEQ ID NO. 15)
[0073] Note: According to WIPO ST.26, "T" represents uracil in RNA sequences and thymine in DNA sequences. Therefore, the "T" in sequence 1 in the sequence listing represents uracil U. The same applies to other RNA sequences in the sequence listing.
[0074] Example 4: Effect test of adding grape miR3631f to grape callus
[0075] Grape calli were subcultured using B5 phytagel medium (3.164 g / L B5, 0.25 g / L casein hydrolyzate, 20 g / L sucrose, 100 mg / L inositol, 0.2 mg / L kinetin, 0.1 mg / L naphthaleneacetic acid, 2.5 g / L phytagel) and used as experimental material after 20-25 days of growth. Grape calli of equal size were transferred to B5 medium containing either 0 mM NaCl or 25 mM NaCl. The miR3631f or control oligonucleotide synthesized in Example 3 was added dropwise to the surface of the grape callus at a concentration of 36 nM in a 10 μL volume.
[0076] After 3 days of culture, the expression level of VHAc1 was detected; after 15 days of culture, the grape callus tissue was photographed.
[0077] (1) Detection of VHAc1 expression level
[0078] Total RNA was extracted from grape callus using a plant RNA extraction kit (R015-50, Beijing Jinbaite Biotechnology Co., Ltd.) according to the standard instructions. The expression level of VHAc1 was detected after reverse transcription using a reverse transcription kit (RR047Q, Takara Biotechnology Co., Ltd.). The primers are as follows:
[0079] VHAc1-F: 5′-TCCAGTCCCGTTTCTCTGCAAAATC-3′ (SEQ ID NO. 16)
[0080] VHAc1-R: 5′-AAGCCGAAGAATGGAGCAGTCT-3′ (SEQ ID NO. 17)
[0081] The results showed that compared with the control, the addition of miR3631 could significantly reduce the expression level of VHAc1 in grape callus, indicating that the addition of chemically synthesized miR3631 could be absorbed by the callus and reduce the expression level of the target gene VHAc1 ( Figure 4 ).
[0082] 2. Salt stress phenotype observation
[0083] Grape callus tissue was photographed after 15 days of culture. The results showed that under salt-free conditions, there was no significant difference in callus growth rate after addition of miR3631f and the control oligonucleotide. However, under salt stress, callus tissue treated with miR3631 grew slower than callus tissue treated with the control oligonucleotide. This suggests that the addition of exogenous miR3631f to NaCl-containing culture medium can increase the sensitivity of grape callus tissue to salt stress. Figure 5 ). By silencing miR3631f in grapes through transgenic technology, stably transformed transgenic plants were obtained, thereby improving the salt tolerance of grapes.
[0084] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.
Claims
1. A method for rapidly identifying plant miRNA function, characterized in that: The following steps are involved: Chemically synthesizing miRNA based on the sequence information of the plant miRNA to be identified; dripping the chemically synthesized miRNA onto the surface of plant callus tissue, and then performing phenotypic functional identification on the plant callus tissue; The plant miRNA is from grape.
2. The method according to claim 1, characterized in that The concentration of chemically synthesized miRNA was 35-40 nM.
3. The method according to claim 1, characterized in that The plant miRNA is grape miR3631f, and the nucleotide sequence of the grape miR3631f is shown in SEQ ID NO.
1.
4. The method according to claim 1, wherein Phenotypic functional identification includes: salt resistance, drought resistance and metal ion stress resistance.
5. Application of grape miR3631f in regulating grape salt resistance; the nucleotide sequence of the grape miR3631f is shown in SEQ ID NO.
1.
6. A method for improving the salt resistance of grapes, characterized in that: include: The step of silencing grape miR3631f, wherein the nucleotide sequence of grape miR3631f is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Method for enhancing and carrying out suppression expression on activity of miRNA in embryogenic callus of longan
CN105969806A
Rapid genetic transformation method for grape calluses
CN114015717A