Use of jujube polysaccharide and derivatives thereof in the preparation of immunomodulators

Abstract

The application relates to application of jujube polysaccharide and derivatives thereof in preparation of immunoregulators, wherein the jujube polysaccharide and the derivatives thereof include one or both of jujube polysaccharide and acetylated jujube polysaccharide; the acetylated jujube polysaccharide is obtained by acetylation modification on the jujube polysaccharide; and the jujube polysaccharide is a neutral polysaccharide prepared by a water extraction and alcohol precipitation method. The jujube polysaccharide and the derivatives thereof have a regulating effect on the immune system and can be used for preparing immunoregulators.

Description

Technical Field

[0001] This invention relates to the field of jujube polysaccharides and their derivatives, specifically to the application of jujube polysaccharides and their derivatives in the preparation of immunomodulators. Background Technology

[0002] The jujube (Ziziphus jujuba Mill.) is a plant belonging to the genus Ziziphus in the family Rhamnaceae. Its fruit has calming, sleep-promoting, and blood-tonifying effects. [ Studies have found that jujube fruit contains functional components including flavonoids, triterpenoids, polysaccharides, and phenolic acids, among which polysaccharides are one of the most abundant active ingredients. Modern pharmacology has confirmed that jujube polysaccharides possess antioxidant, antitumor, hypoglycemic, antiviral, anti-inflammatory, and antibacterial activities, among other biological activities. However, research on their immunomodulatory activities is limited, especially regarding the immunomodulatory activities of jujube polysaccharide derivatives, which have not yet been publicly reported. Summary of the Invention

[0003] The purpose of this invention is to overcome the deficiencies in the prior art and provide an application of jujube polysaccharide and its derivatives in the preparation of immunomodulators.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] The application of a jujube polysaccharide and its derivatives in the preparation of immunomodulators, wherein the jujube polysaccharide and its derivatives include one or two of jujube polysaccharide and acetylated jujube polysaccharide.

[0006] As a further technical solution, the acetylated jujube polysaccharide is prepared by acetylation modification of jujube polysaccharide;

[0007] The jujube polysaccharide is a neutral polysaccharide prepared by water extraction and alcohol precipitation.

[0008] As a further technical solution, the preparation method of the jujube polysaccharide includes the following steps:

[0009] Step a, Pretreatment: Soak the jujube powder in 2.5-3.5 times (preferably 3 times) volume of 95% ethanol solution, and change the ethanol solution every 22h-26h (preferably 24h), repeating 2-4 times to pretreat the jujube powder and remove fat-soluble impurities;

[0010] Step b, water extraction: On a dry weight basis, distilled water is added to the pretreated jujube powder at a ratio of 1g:(18-22)mL (preferably 1g:20mL), and the mixture is extracted in a boiling water bath for 1.5h-2.5h (preferably 2.0h). The mixture is filtered, and the residue is extracted 2-4 times (preferably 3 times). The filtrates are combined and concentrated by rotary evaporation to obtain a concentrated solution.

[0011] Step c, alcohol precipitation: Add 95% ethanol solution to the concentrate at a volume ratio of 1:3-5 (preferably 1:4), precipitate overnight at 4°C, filter with filter cloth to collect the precipitate, wash the precipitate with anhydrous ethanol, acetone and diethyl ether in sequence to remove small molecule impurities, dialyze the precipitate with running water for 3 days, and freeze dry under vacuum to obtain crude jujube polysaccharide.

[0012] Step d, protein removal: After adding water to the crude polysaccharide of jujube to make a crude polysaccharide solution, the protein is removed by the Sevage method. The protein removal is repeated 5-7 times (preferably 6 times). After the protein is removed, the polysaccharide solution is concentrated by evaporation, dialyzed with distilled water for 70-75 hours (preferably 72 hours), and then freeze-dried under vacuum to obtain jujube polysaccharide.

[0013] As a further technical solution, the jujube powder is made from dried and pulverized jujube fruits.

[0014] As a further technical solution, both the jujube polysaccharide and the acetylated jujube polysaccharide include rhamnose, arabinose, xylose, mannose, glucose and galactose;

[0015] The average molecular weight of the jujube polysaccharide is 2.75 × 10⁻⁶. 5 ,

[0016] The average molecular weight of acetylated jujube polysaccharide is 3.38 × 10⁻⁶. 5 .

[0017] As a further technical solution, the molar ratio of rhamnose (Rha), arabinose (Ara), xylose (Xyl), mannose (Man), glucose (Glc), and galactose (Gal) in the jujube polysaccharide is 1.05:1.00:1.61:0.05:0.10:0.07;

[0018] The molar ratio of rhamnose (Rha), arabinose (Ara), xylose (Xyl), mannose (Man), glucose (Glc), and galactose (Gal) in the acetylated jujube polysaccharide is 0.39:1.00:1.21:0.02:0.05:0.10.

[0019] As a further technical solution

[0020] The acetylated jujube polysaccharide was prepared by acetylation modification of jujube polysaccharide using the acetic anhydride method.

[0021] As a further technical solution, the preparation method of acetylated jujube polysaccharide includes the following steps:

[0022] The reaction mixture was prepared according to the following mass-volume ratio: jujube polysaccharide, distilled water, and acetic anhydride 1g:30mL:8-10mL. First, the jujube polysaccharide was dissolved in distilled water and stirred until dissolved. Then, acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.0. The reaction was then carried out at a constant temperature of 40℃-60℃ for 2-4 hours. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid. The mixture was dialyzed with distilled water for 3 days and then freeze-dried under vacuum to obtain acetylated jujube polysaccharide.

[0023] As a further technical solution, administration of jujube polysaccharide at 400 mg / kg, acetylated jujube polysaccharide at 200 mg / kg, and 400 mg / kg has a restorative effect on the immune organs of immunosuppressed mice;

[0024] As a further technical solution, administration of jujube polysaccharide at doses of 100 mg / kg, 200 mg / kg, and 400 mg / kg can increase the platelet count in immunosuppressed mice.

[0025] As a further technical solution, administration of jujube polysaccharide at 200 mg / kg and 400 mg / kg, and administration of acetylated jujube polysaccharide at 100 mg / kg, 200 mg / kg, and 400 mg / kg, can increase the number of red blood cells in immunosuppressed mice.

[0026] As a further technical solution, administration of jujube polysaccharide at 400 mg / kg and acetylated jujube polysaccharide at 400 mg / kg can increase the number of white blood cells in immunosuppressed mice.

[0027] As a further technical solution, administration of jujube polysaccharide at 400 mg / kg and acetylated jujube polysaccharide at 400 mg / kg is beneficial for restoring bone marrow hematopoietic function in immunosuppressed mice.

[0028] As a further technical solution, administration of jujube polysaccharide at 100 mg / kg, 200 mg / kg, and 400 mg / kg, and administration of acetylated jujube polysaccharide at 100 mg / kg, 200 mg / kg, and 400 mg / kg, showed a restorative effect on IL-4 and IFN-γ levels in immunosuppressed mice.

[0029] As a further technical solution, both jujube polysaccharide and acetylated jujube polysaccharide can significantly promote the secretion of the cytokine IFN-γ.

[0030] As a further technical solution, both jujube polysaccharide and acetylated jujube polysaccharide can promote the recovery of humoral immunity in immunosuppressed mice.

[0031] As a further technical solution, acetylated jujube polysaccharide has a stronger effect on restoring humoral immunity in immunosuppressed mice than jujube polysaccharide.

[0032] As a further technical solution, both jujube polysaccharide and acetylated jujube polysaccharide have a regulatory effect on the composition of intestinal flora in immunosuppressed mice.

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0034] This invention employs water extraction, alcohol precipitation, and the Sevage method to remove proteins and extract jujube polysaccharides. It also strictly limits the process parameters for acetylation modification of jujube polysaccharides to achieve the optimal degree of substitution, thereby improving the water solubility and immunomodulatory activity of jujube polysaccharides.

[0035] This invention provides dose-dependent protective effects of jujube polysaccharides and acetylated jujube polysaccharides on the spleen and thymus of immunosuppressed mice. Both jujube polysaccharides and acetylated jujube polysaccharides effectively alleviate cyclophosphamide-induced bone marrow damage in mice, increase the number of white blood cells, red blood cells, and platelets, and promote the recovery of bone marrow hematopoietic function in immunosuppressed mice. High-dose administration enhances bone marrow hematopoietic function. Both jujube polysaccharides and acetylated jujube polysaccharides significantly promote the secretion of the cytokine IFN-γ. Low, medium, and high doses of jujube polysaccharides and acetylated jujube polysaccharides significantly increased serum IgG, IgA, and IgM levels in immunosuppressed mice, indicating that both jujube polysaccharides and acetylated jujube polysaccharides can promote the recovery of humoral immunity in immunosuppressed mice. At IgG and IgM levels, acetylated jujube polysaccharides are more effective than jujube polysaccharides in restoring humoral immunity in immunosuppressed mice, while at IgA levels, jujube polysaccharides are more effective than acetylated jujube polysaccharides in restoring humoral immunity in immunosuppressed mice.

[0036] In this invention, both jujube polysaccharide and acetylated jujube polysaccharide have certain regulatory effects on the gut microbiota composition of immunosuppressed mice. Principal component analysis revealed that acetylated jujube polysaccharide is more effective than jujube polysaccharide in improving the gut microbiota structure of immunosuppressed mice, and acetylated jujube polysaccharide can restore the gut microbiota altered by cyclophosphamide to a certain extent. This finding is important for studying the relationship between jujube polysaccharide and its derivatives on immune regulation and gut microbiota regulation. Attached Figure Description

[0037] Figure 1 Effect of acetic anhydride addition on the degree of substitution (DS) of jujube polysaccharide acetylation modification;

[0038] Figure 2 Effect of reaction temperature on the degree of substitution (DS) of acetylation modification of jujube polysaccharides;

[0039] Figure 3 Effect of reaction time on the degree of substitution (DS) of jujube polysaccharide acetylation modification;

[0040] Figure 4 UV scan images of crude polysaccharide, jujube polysaccharide and their derivative solutions;

[0041] Figure 5 Infrared spectra of jujube polysaccharides and their derivatives;

[0042] Figure 6 SEM images of jujube polysaccharides and their derivatives magnified 5000 times;

[0043] Figure 7 Energy dispersive X-ray spectroscopy (EDS) of jujube polysaccharides and their derivatives;

[0044] Figure 8 Phylogenetic distribution of gut microbiota in different groups of JP and AcJP mice;

[0045] Figure 9 Genus-level distribution of gut microbiota in JP and AcJP mice in different groups;

[0046] Figure 10 Effects of JP on principal components of mouse gut microbiota;

[0047] Figure 11 The effect of AcJP on the principal components of mouse gut microbiota; Detailed Implementation

[0048] The present invention will be further described in detail below with reference to the embodiments.

[0049] In this invention,

[0050] 1. Determination of the degree of substitution of acetylated polysaccharides:

[0051] The degree of substitution of acetylated polysaccharides was determined by acid-base titration. 10 mg of the sample was dissolved in 10 mL of 0.01 mol / L NaOH solution and reacted at 50 °C for 2 h, stirring with a magnetic stirrer to ensure complete saponification. Back titration was performed using phenolphthalein as an indicator with 0.01 mol / L HCl solution. During the process, partial degradation of the polysaccharide may occur, consuming a certain amount of alkali. Therefore, unsaponified jujube polysaccharide (JP) was used as a blank for titration. The degree of substitution (DS) was calculated according to the formula:

[0052]

[0053]

[0054] In the formula: A is the content of acetyl groups; C0 (mol / L) is the concentration of NaOH solution; V0 (mL) is the volume of NaOH solution consumed; C1 (mol / L) is the concentration of HCl solution; V1 (mL) is the volume of HCl solution consumed; m (g) is the mass of the sample.

[0055] Example 1

[0056] A method for preparing jujube polysaccharide includes the following steps:

[0057] Step 1, Pretreatment: Soak the jujube powder in 3 times its volume of 95% ethanol solution, changing the ethanol solution every 24 hours, repeating 3 times to pretreat the jujube powder and remove fat-soluble impurities; the jujube powder is made by removing the pits from the golden silk jujube fruit, drying it at 60℃, and then pulverizing it with a powder grinder.

[0058] Step 2, Water extraction: On a dry weight basis, distilled water was added to the pretreated jujube powder at a ratio of 1g:20mL, and the mixture was extracted in a boiling water bath for 2 hours. The mixture was filtered, and the residue was extracted three times. The filtrates were combined and concentrated by rotary evaporation to obtain a concentrated solution.

[0059] Step 3, Alcohol Precipitation: Add 95% ethanol solution to the concentrate at a volume ratio of 1:4, and precipitate overnight at 4°C. Collect the precipitate by filtration through a filter cloth. Wash the precipitate sequentially with anhydrous ethanol, acetone, and diethyl ether to remove small molecule impurities. Dialyze the precipitate to running water for 3 days, and then freeze-dry under vacuum to obtain crude jujube polysaccharide.

[0060] Step 4, protein removal: After adding water to the crude jujube polysaccharide to make a crude polysaccharide solution, the protein was removed by the Sevage method. The protein removal was repeated 6 times. After the protein was removed, the polysaccharide solution was concentrated by evaporation, dialyzed with distilled water for 72 hours, and then freeze-dried under vacuum to obtain jujube polysaccharide.

[0061] Examples 2-8: Effect of acetic anhydride dosage on the degree of acetylation modification

[0062] I. Acetylation Modification Methods:

[0063] A method for preparing acetylated jujube polysaccharide includes the following steps:

[0064] The reaction mixture was prepared by dissolving 0.5 g of jujube polysaccharide in 15 mL of distilled water and stirring until dissolved. Then, 2-5 mL of acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.0, and the mixture was then reacted at 60 °C for 3 h. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid. The mixture was dialyzed with distilled water for 3 days and then freeze-dried under vacuum to obtain acetylated jujube polysaccharide.

[0065] II. The parameters for each embodiment are shown in Table 1;

[0066] Table 1

[0067]

[0068] III. Effect of acetic anhydride addition on the degree of substitution of jujube polysaccharide sulfation modification. Results are shown in […]. Figure 1 ;

[0069] from Figure 1It can be seen that the degree of substitution increases with the increase of acetic anhydride addition, but the degree of substitution decreases rapidly after the amount of acetic anhydride added to 0.5g of jujube polysaccharide is greater than 4.5mL. Therefore, 4.5mL is determined to be the optimal amount of acetic anhydride to be added.

[0070] Examples 9-13: Effect of reaction temperature on the degree of substitution of acetylation modification

[0071] I. Acetylation Modification Methods:

[0072] A method for preparing acetylated jujube polysaccharide includes the following steps:

[0073] The reaction mixture was prepared by dissolving 0.5 g of jujube polysaccharide in 15 mL of distilled water and stirring until dissolved. Then, 4.5 mL of acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.0. The reaction was then carried out at a constant temperature of 40-80℃ for 3 hours. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid. The mixture was dialyzed with distilled water for 3 days and then freeze-dried under vacuum to obtain acetylated jujube polysaccharide.

[0074] II. The parameters for each embodiment are shown in Table 2;

[0075] Table 2

[0076] Example 9 Example 10 Example 11 Example 12 Example 13 Reaction temperature ℃ 40 50 60 70 80

[0077] III. Effect of reaction temperature on the degree of substitution of jujube polysaccharide sulfation modification. Results are shown in […]. Figure 2 ;

[0078] from Figure 2 It can be seen that the degree of substitution of jujube polysaccharide acetylation reaches its maximum when the reaction temperature is 50℃. Therefore, the optimal reaction temperature is determined to be 50℃.

[0079] Examples 14-18: Effect of reaction temperature on the degree of substitution of acetylation modification

[0080] I. Acetylation Modification Methods:

[0081] A method for preparing acetylated jujube polysaccharide includes the following steps:

[0082] The reaction mixture was prepared by dissolving 0.5 g of jujube polysaccharide in 15 mL of distilled water and stirring until dissolved. Then, 4.5 mL of acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.0. The mixture was then kept at 60 °C for 1-5 h. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid. The mixture was dialyzed against distilled water for 3 days and then freeze-dried under vacuum to obtain acetylated jujube polysaccharide.

[0083] II. The parameters for each embodiment are shown in Table 3;

[0084] Table 3

[0085] Example 14 Example 15 Example 16 Example 17 Example 18 reaction time h 1 2 3 4 5

[0086] III. Effect of reaction time on the degree of substitution of jujube polysaccharide acetylation modification. Results are shown in […]. Figure 3 ;

[0087] from Figure 3 It can be seen that when the reaction time is less than 3 hours, the degree of substitution of the acetyl group first decreases and then increases. When the reaction time is greater than 3 hours, the degree of substitution decreases. Therefore, 3 hours is determined to be the optimal reaction time.

[0088] Example 19

[0089] A method for preparing acetylated jujube polysaccharide includes the following steps:

[0090] The reaction mixture was prepared according to a mass-to-volume ratio of jujube polysaccharide, distilled water, and acetic anhydride of 1 g: 30 mL: 8.6 mL. First, 0.5 g of jujube polysaccharide was dissolved in 15 mL of distilled water. After stirring and dissolving, 4.3 mL of acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.0, and the reaction was carried out at 60℃ for 3.5 h. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid, and the mixture was dialyzed against distilled water for 3 days. The acetylated jujube polysaccharide was then freeze-dried under vacuum to obtain acetylated jujube polysaccharide. The degree of substitution of the acetylated jujube polysaccharide was 0.716.

[0091] Example 20: Physicochemical Properties Analysis of Jujube Polysaccharides and Their Derivatives

[0092] The physicochemical properties of the jujube polysaccharide prepared in Example 1 and the acetylated jujube polysaccharide prepared in Example 19 were analyzed from the following aspects, and the results are shown in Table 4.

[0093] 1. Determination of total sugar content: The total sugar content of the sample was determined by the phenol-sulfuric acid method.

[0094] 2. Determination of uronic acid content: The uronic acid content of the sample was determined by the m-hydroxybiphenyl method.

[0095] 3. Water solubility determination: Accurately weigh 100 mg of the sample, add 1 mL of ultrapure water, and shake on a shaker overnight at room temperature to ensure complete dissolution. Then centrifuge at 12000 r / min for 20 min, and dry the precipitate at 60℃ to constant weight. Calculate the water solubility of the sample using the following formula:

[0096]

[0097] In the formula, W0 is the mass of the original sample (mg), W1 is the mass of the precipitate after drying (mg), and V is the volume of ultrapure water used to dissolve the sample (mL).

[0098] 4. Viscosity Measurement

[0099] The apparent viscosity of JP and its derivatives was determined using a digital viscometer (NDJ-5S, UK). 1.00 g of sample was weighed and dissolved in 200 mL of distilled water to prepare a 5 g / L solution. The solution was continuously stirred with a magnetic stirrer until the polysaccharide sample was fully dissolved. The viscometer was adjusted and, after stabilizing (approximately 15 min), the measurement was performed at room temperature (25°C).

[0100] Table 4

[0101]

[0102] Note: Different lowercase letters (a–c) in the column indicate significant differences (p<0.05).

[0103] Example 21: Structural Analysis of Jujube Polysaccharides and Their Derivatives

[0104] The jujube polysaccharide prepared in Example 1 and the acetylated jujube polysaccharide prepared in Example 19 were structurally analyzed from the following aspects;

[0105] 1. Ultraviolet full-wavelength scanning analysis

[0106] Prepare a 1 mg / mL solution of the sample, zero the instrument with distilled water, and scan the sample solution in the 190-900 nm range to obtain the UV spectrum, as shown below. Figure 4 As shown,

[0107] from Figure 4 It can be seen that the crude polysaccharide has an absorption peak at 280 nm, which weakens after protein removal using the Sevage method. Jujube polysaccharide and acetylated jujube polysaccharide show no absorption peak at 260 nm, but a weak absorption peak at 280 nm, indicating that although the Sevage method was used for protein removal, the sample may still contain a small amount of protein. The Sevage method can only remove free protein, not glycoproteins bound to polysaccharides.

[0108] 2. Fourier Transform Infrared Spectroscopy (FT-IR) Measurement

[0109] Infrared spectra of jujube polysaccharides and their derivatives were scanned. The sample and KBr were ground into powder at a ratio of 1:100, compressed into tablets, and the tablets were scanned using an infrared detector in the range of 4000–4000 cm⁻¹. -1 The results are shown Figure 5 .

[0110] Depend on Figure 5 It can be observed that at 3420cm -1 It exhibits a strong characteristic absorption peak of OH stretching vibration at 2930 cm⁻¹. -1The absorption peak at this point is due to the stretching vibration of CH. Jujube polysaccharides and their derivatives all exhibit typical characteristic absorption peaks of polysaccharides. This indicates that the main structure of the polysaccharide is well preserved and has not been damaged.

[0111] The infrared spectrum of acetylated jujube polysaccharide shows that, compared with JP, it exhibits higher activity in the 1731-1743 cm⁻¹ range. -1 The characteristic absorption peaks of the C=O stretching vibration of the ester group within the range are significantly enhanced, indicating that acetyl substitution has occurred. At 3420 cm⁻¹ -1 The absorption peak of OH at the OH position was significantly enhanced, indicating that the acetylation modification of jujube polysaccharide was successful.

[0112] 3. Molecular weight (Mw) determination

[0113] High-performance liquid chromatography (HPLC) with an evaporative light detector was used to determine the molecular weight of jujube polysaccharides and their derivatives. The chromatographic column was a Shodex SUGER KS-805; the mobile phase was ultrapure water; the flow rate was 1 mL / min; the injection volume was 20 μL; and the detector and column temperatures were 35 °C. Solutions of dextran standards (glucose, T10, T40, T70, T100, and T500) and polysaccharide samples of different molecular weights were prepared at 1.0 mg / mL and filtered through a 0.45 μm aqueous filter membrane. The average molecular weight of jujube polysaccharides and their derivatives was calculated based on the elution volume of the samples and the regression equation of the standard curve. The results are shown in Table 5.

[0114] Table 5

[0115] sample Example 1 (Jujube Polysaccharide) Example 19 (Acetylated Jujube Polysaccharide) Average molecular weight (Da) <![CDATA[2.75×10 5 ]]> <![CDATA[3.38×10 5 ]]>

[0116] As shown in Table 8, the molecular weight of jujube polysaccharides increases after acetylation modification. The preparation process conditions used in this invention are relatively mild, and the increase in molecular weight of jujube polysaccharides after acetylation modification indicates that the preparation process conditions of the acetylated jujube polysaccharides of this invention do not cause degradation of the jujube polysaccharides.

[0117] 4. Determination of monosaccharide composition

[0118] 1) Determination method: Gas chromatography was used to analyze the monosaccharide composition of jujube polysaccharides and their derivatives.

[0119] Preparation of monosaccharide standard derivatives: Weigh 10 mg of each of the six monosaccharide standards (L-Rha, D-Ara, D-Xyl, D-Man, D-Glc, D-Gal) and add them to six stoppered test tubes. Then add 10 mg of hydroxylamine hydrochloride and 0.5 mL of pyridine. React in a water bath at 90 °C for 30 min. Cool to room temperature, add 0.5 mL of acetic anhydride, and react in a water bath at 90 °C for 30 min to obtain monosaccharide standard derivatives.

[0120] Preparation of mixed monosaccharide standard derivatives: 5 mg of each of the six monosaccharide standards were weighed, and 30 mg of hydroxylamine hydrochloride and 1.5 mL of pyridine were added. The mixture was reacted in a water bath at 90 °C for 30 min. After cooling to room temperature, 1.5 mL of acetic anhydride was added, and the mixture was reacted in a water bath at 90 °C for another 30 min to carry out acetylation derivatization, thus obtaining the mixed monosaccharide standard derivatives.

[0121] Preparation of polysaccharide derivatives: Weigh 20 mg of sample into a stoppered test tube, add 2 mL of 4 mol / L trifluoroacetic acid (TFA) solution, and hydrolyze at 110 °C for 4 h. Evaporate the hydrolysate to dryness using a rotary evaporator, then add methanol and evaporate repeatedly to remove TFA. Add 20 mg of hydroxylamine hydrochloride and 1 mL of pyridine, react in a 90 °C water bath for 30 min, cool to room temperature, add 1 mL of acetic anhydride, and react in a 90 °C water bath for 30 min to obtain the polysaccharide derivative.

[0122] GC-MS conditions: TG-5MS capillary column (30m × 0.25mm, 0.25μm) with flame ionization detector (FID). Splitless injection, injection volume 1μL, carrier gas: high-purity N2, flow rate: 45mL / min. Temperature program: initial temperature 170℃, ramped to 215℃ at 2℃ / min, then ramped to 250℃ at 8℃ / min, held for 1 min. Injector temperature 250℃, detector temperature 250℃. H2 flow rate 30mL / min, air flow rate 300mL / min.

[0123] 2) Measurement results:

[0124] The content of each monosaccharide was calculated by analyzing the peak area of ​​the sample obtained from gas chromatography, and the following results were obtained:

[0125] The jujube polysaccharide prepared in Example 1 and the acetylated jujube polysaccharide prepared in Example 19 both contain six neutral monosaccharides: rhamnose, arabinose, xylose, mannose, glucose, and galactose.

[0126] The molar ratio of Rha, Ara, Xyl, Man, Glc, and Gal in the jujube polysaccharide is 1.05:1.00:1.61:0.05:0.10:0.07; the molar ratio of Rha, Ara, Xyl, Man, Glc, and Gal in the acetylated jujube polysaccharide is 0.39:1.00:1.21:0.02:0.05:0.10.

[0127] 5. Scanning electron microscopy (SEM) analysis

[0128] 1) An appropriate amount of jujube polysaccharide and its derivative powder was fixed on the sample stage using conductive tape and then sputtered with gold using a vacuum gold plating machine. The accelerating voltage of the electron gun was 10 kV, and the samples were scanned using a field emission microscope at a resolution of 2 nm. The microstructure of the samples was analyzed, and the results are shown in […]. Figure 6 ;

[0129] from Figure 6 The 5000x SEM images show that the surface of jujube polysaccharide is smooth, while the surface of acetylated jujube polysaccharide is rough, plate-like, and contains many small particles and pores. The different surface morphologies of the polysaccharides indicate that acetylation modification can alter the surface structure of jujube polysaccharides.

[0130] 6. X-ray energy dispersive spectroscopy (EDS) analysis

[0131] The microstructure of jujube polysaccharides and their derivatives was analyzed using scanning electron microscopy and energy-dispersive X-ray spectroscopy. The results are shown in [Figure number missing]. Figure 7 .

[0132] Depend on Figure 7 The energy spectrum shows that the surface of jujube polysaccharides is mainly composed of carbon (C) and oxygen (O). Since gold was sputtered during the energy dispersive spectroscopy (EDS) scan, imparting conductivity to the polysaccharides, gold (Au) is present. After acetylation modification, the surface of the acetylated jujube polysaccharides is mainly composed of C and O, indicating that the acetylation modification was successful. The trace amount of calcium (Ca) may be due to the formation of calcium pectin under dry conditions; calcium pectin is also a polysaccharide.

[0133] Example 22: Immunomodulatory effects of jujube polysaccharides and their derivatives

[0134] The immunomodulatory activity of the jujube polysaccharide prepared in Example 1 and the acetylated jujube polysaccharide prepared in Example 19 was analyzed from the following aspects:

[0135] I. Experimental Methods

[0136] 1. Grouping and administration of experimental animals

[0137] Eighty mice were randomly divided into eight groups: blank group (KB), model group (M), low-dose jujube polysaccharide group (JPD), medium-dose jujube polysaccharide group (JPZ), high-dose jujube polysaccharide group (JPG), low-dose acetylated jujube polysaccharide group (AcJPD), medium-dose acetylated jujube polysaccharide group (AcJPZ), and high-dose acetylated jujube polysaccharide group (AcJPG). The treatment methods for each group are shown in Table 6.

[0138] Table 6

[0139] Group deal with KB From day 1 to day 17, intraperitoneal injection of normal saline was administered. M Days 1-3: Cy (100 mg / kg) administered intraperitoneally; Days 4-17: Normal saline administered by gavage. JPD Days 1-3: Intraperitoneal injection of Cy (100 mg / kg); Days 4-17: Gavage administration of low-dose JP (100 mg / kg). JPZ Days 1-3: Intraperitoneal injection of Cy (100 mg / kg); Days 4-17: Gavage administration of medium dose of JP (200 mg / kg). JPG Days 1-3: Intraperitoneal injection of Cy (100 mg / kg); Days 4-17: Gavage administration of high-dose JP (400 mg / kg). AcJPD Days 1-3: Cy (100 mg / kg) administered intraperitoneally; Days 4-17: AcJP (100 mg / kg) administered orally at a low dose. AcJPZ Days 1-3: Intraperitoneal injection of Cy (100 mg / kg); Days 4-17: Gavage administration of medium dose of AcJP (200 mg / kg). AcJPG Days 1-3: Intraperitoneal injection of Cy (100 mg / kg); Days 4-17: Gavage administration of high-dose AcJP (400 mg / kg).

[0140] Note: Cy: Cyclophosphamide.

[0141] 2. Determination of mouse body weight and immune organ index

[0142] Mice in each group were fasted for 24 hours after the last administration of the drug, but allowed free access to water. They were weighed, and blood was collected by enucleation of the eyeballs. Mice were euthanized by cervical dislocation, and the spleen and thymus were removed. Surrounding tissues were cleaned, and the organs were washed in physiological saline. Bloodstains on the surface of the organs were absorbed with filter paper, and the weights were recorded. Immune organ indices were calculated according to the formula, and the results are shown in Table 7.

[0143]

[0144] 3. Complete blood count (CBC)

[0145] Blood was collected by enucleating the eyeballs and collecting whole blood in anticoagulant tubes. Within 12 hours, the number of white blood cells (WBC), red blood cells (RBC), and platelets (PLT) in the mouse blood was analyzed using an animal whole blood cell analyzer. The results are shown in Table 8.

[0146] 4. Measurement of serum cytokines (IL-4 and IFN-γ)

[0147] Twenty-four hours after the last administration, the eyeballs were removed and blood was collected. The serum was obtained by centrifugation at 3000 r / min for 15 min, aliquoted, and stored at -20℃. The levels of interleukin-4 (IL-4) and interferon-γ (IFN-γ) in the mouse serum were determined by enzyme-linked immunosorbent assay (ELISA). The results are shown in Table 9. The detection process was strictly performed according to the ELISA kit instructions.

[0148] 5. Measurement of serum immunoglobulins (IgA, IgG, and IgM)

[0149] The levels of IgA, IgG and IgM in mouse serum were detected by enzyme-linked immunosorbent assay (ELISA). The results are shown in Table 10. The detection process was strictly performed in accordance with the ELISA kit instructions.

[0150] II. Experimental Results and Analysis

[0151] 1. Effects of jujube polysaccharides and their derivatives on spleen and thymus index in immunosuppressed mice

[0152] Table 7

[0153] Group Thymus index (mg / g) Spleen index (mg / g) Blank group 4.22±0.57 5.77±0.59 Model group <![CDATA[1.80±0.27 ** ]]> <![CDATA[4.34±0.22 ** ]]> JP low-dose group 2.44±0.49 5.28±0.80 JP medium dose group 2.45±0.24 5.49±0.73 JP high-dose group 2.57±0.43 <![CDATA[6.82±2.24 ## ]]> AcJP low-dose group 2.43±0.37 5.69±0.82 AcJP medium dose group 2.61±0.53 <![CDATA[6.00±0.68 ## ]]> AcJP high-dose group 2.67±0.52 <![CDATA[6.46±1.26 ## ]]>

[0154] Note: Compared with the control group, *P<0.05, **P<0.01; compared with the model group, # P<0.05, ## P<0.01; the same applies below.

[0155] As shown in Table 7, compared with the control group, the thymus index and spleen index of the model group mice were significantly reduced (P<0.01), indicating that the immunosuppressed mouse model was successfully established. Compared with the model group, the spleen index of the high-dose JP group mice was significantly increased (P<0.01). After gavage administration of JP, all indices of the immunosuppressed mice increased to varying degrees, indicating that JP has a certain protective effect on the spleen and thymus of immunosuppressed mice in a dose-dependent manner. The spleen indices of the high-dose JP group, the medium-dose AcJP group, and the high-dose AcJP group all reached the level of the control group, and the spleen index of the high-dose JP group mice was significantly increased (P<0.01), indicating that the high-dose JP group has a good protective effect on the immune organs of immunosuppressed mice.

[0156] 2. Effects of jujube polysaccharides and their derivatives on hematopoietic function in immunosuppressed mice

[0157] Table 8

[0158]

[0159]

[0160] Note: Compared with the control group, *P<0.05, **P<0.01; compared with the model group, # P<0.05, ## P<0.01.

[0161] As shown in Table 8, compared with the control group, all three indicators in the model group mice were significantly reduced, with significant differences in erythrocytes and platelets (P<0.01), indicating successful establishment of the mouse immunosuppression model. Compared with the model group, all three indicators in the high-dose JP group were significantly increased (P<0.01), and the erythrocyte counts in the medium- and high-dose JP groups and the low-, medium-, and high-dose AcJP groups were significantly increased (P<0.01). The platelet counts in the low-, medium-, and high-dose JP groups were significantly increased (P<0.01), showing a dose-dependent relationship. All three indicators in the high-dose JP group and the high-dose AcJP group were higher than those in the control group, indicating that high doses of JP and AcJP are beneficial for restoring bone marrow hematopoietic function in immunosuppressed mice.

[0162] 3. Effects of jujube polysaccharides and their derivatives on serum IL-4 and IFN-γ levels in immunosuppressed mice

[0163] Table 9

[0164] Group IL-4 (ng / L) IFN-γ (ng / L) Blank group 72.97±4.89 25.07±2.93 Model group <![CDATA[33.08±2.28 ** ]]> <![CDATA[5.87±1.62 ** ]]> JP low-dose group 41.27±0.63 <![CDATA[31.75±3.50 ## ]]> JP medium dose group <![CDATA[59.29±3.06 ## ]]> <![CDATA[40.19±1.93 ## ]]> JP high-dose group 44.34±1.11 <![CDATA[49.81±4.99 ## ]]> AcJP low-dose group 47.24±2.99 <![CDATA[17.15±4.59 ## ]]> AcJP medium dose group 46.19±2.04 <![CDATA[28.57±8.72 ## ]]> AcJP high-dose group <![CDATA[52.95±0.96 # ]]> <![CDATA[49.87±6.45 ## ]]>

[0165] Note: Compared with the control group, *P<0.05, **P<0.01; compared with the model group, # P<0.05, ## P<0.01.

[0166] Table 9 shows that, compared with the control group, the serum levels of both cytokines in the model group mice were significantly lower than those in the control group (P<0.05), indicating that cyclophosphamide can inhibit the normal secretion of IL-4 and IFN-γ. Compared with the model group, the low, medium, and high dose JP groups and the low, medium, and high dose AcJP groups all showed significant recovery in the levels of both cytokines. Among them, the low, medium, and high dose JP groups and the medium and high dose AcJP groups reached the level of the control group in IFN-γ, indicating that both JP and AcJP can significantly promote the secretion of IFN-γ.

[0167] 4. Effects of jujube polysaccharides and their derivatives on humoral immunity in immunosuppressed mice

[0168] Table 10

[0169]

[0170] Note: Compared with the control group, *P<0.05, **P<0.01; compared with the model group, # P<0.05, ## P<0.01.

[0171] As shown in Table 10, compared with the blank group, the serum levels of IgG, IgM, and IgA in the model group mice were significantly decreased (P<0.01). Compared with the model group, the serum levels of IgG, IgA, and IgM in the low, medium, and high dose groups of JP and AcJP were significantly increased. The levels of all three in the low, medium, and high dose groups of JP and AcJP were higher than those in the blank control group. The results indicate that both JP and AcJP can promote the recovery of humoral immunity in immunosuppressed mice. At the levels of IgG and IgM, AcJP has a stronger effect on the recovery of humoral immunity in immunosuppressed mice than JP, while at the level of IgA, JP has a stronger effect on the recovery of humoral immunity in immunosuppressed mice than AcJP.

[0172] Example 23: Effects of jujube polysaccharides and their derivatives on the gut microbiota of immunosuppressed mice

[0173] The effects of jujube polysaccharides prepared in Example 1 and acetylated jujube polysaccharides prepared in Example 19 on the intestinal flora of immunosuppressed mice were analyzed from the following aspects.

[0174] I. Experimental Methods

[0175] 1. Sample collection and processing

[0176] The contents of the mouse cecum were collected, placed in sterile cryovials, and immediately immersed in liquid nitrogen for storage at -80°C. The cecum contents samples were then sent to Shanghai Meiji Biotechnology Co., Ltd. for testing.

[0177] 2. DNA extraction from intestinal contents samples

[0178] Genomic DNA was extracted from the samples using a DNA extraction kit and detected by 1% agarose gel electrophoresis. The absorbance of the samples at 260 nm and 280 nm was measured using a UV spectrophotometer, with a mass concentration of OD0.05. 260 / OD 280 .

[0179] 3. PCR amplification and library construction

[0180] Using 20-30 ng of genomic DNA as a template, a series of PCR primers designed by Meiji Biotechnology were used to amplify the 338F_806R region on prokaryotic 16S rDNA. The primer sequence for 338F is “ACTCCTACGGGAGGCAGCAG”, and the primer sequence for 806R is “GGACTACHVGGGTWTCTAAT”.

[0181] Amplification conditions: TransGen AP221-02: TransStart Fastpfu DNA Polymerase, 20 μl reaction system, the reaction system is shown in Table 11.

[0182] Table 11

[0183] PCR amplification system reaction system 5×FastPfu Buffer 4μl 2.5mM dNTPs 2μl Forward Primer (5μM) 0.8μl Reverse Primer (5μM) 0.8μl FastPfu Polymerase 0.4μl BSA 0.2μl Template DNA 10ng ddH2O Add to a total volume of 20 μl

[0184] PCR reaction parameters: pre-denaturation parameter 95℃ 3min×1, denaturation parameter 95℃ 30sec, annealing parameter 55℃ 30sec, extension parameter 72℃ 45s, final extension parameter 72℃ 10min, for a total of 27 cycles.

[0185] PCR amplification results: detected by 2% agarose gel electrophoresis.

[0186] 4. Miseq sequencing

[0187] One end of the DNA fragment is complementary to the primer bases and then immobilized on a chip. Using the DNA fragment as a template and the base sequence on the chip as primers, PCR synthesis is performed. After denaturation and annealing to form a "bridge", four fluorescently labeled dNTPs and a modified DNA polymerase are added to the DNA single strand, and cyclic amplification is performed. The surface of the reaction plate is scanned with a laser to read the nucleotide types of the template sequence, and the fluorescence signal results collected each time are counted to obtain the template DNA fragment sequence.

[0188] 5. Statistical analysis of biological information

[0189] The main analysis included the composition and proportion of bacterial communities at the phylum and genus levels, as well as PCA analysis. Results are shown below. Figure 8-11 .

[0190] II. Experimental Results and Analysis

[0191] 1. Analysis of the effects of jujube polysaccharides and their derivatives on the composition of gut microbiota at the phylum level

[0192] from Figure 8 It can be seen that, compared with the control group, the proportion of Bacteroidetes decreased and the proportion of Firmicutes increased in the model group. The relative abundance of Firmicutes decreased with increasing JP concentration, showing a dose-dependent relationship. Compared with the model group, Bacteroidetes were increased to varying degrees in both the JP and AcJP medium-dose groups, and the proportion of Bacteroidetes was higher in the low, medium, and high-dose JP groups and the AcJP medium-dose group than in the control group. Among them, Firmicutes had the lowest proportion in the high-dose JP group, while Bacteroidetes had the highest proportion.

[0193] 2. Analysis of the impact of jujube polysaccharides and their derivatives on the composition of gut microbiota at the genus level

[0194] from Figure 9 It can be seen that, compared with the control group, the proportions of norank_f__Muribaculaceae, Bacteroides, and unclassified_f__Lachnospiraceae in the model group of immunosuppressed mice were significantly reduced, while the proportions of Lachnospiraceae_NK4A136_group and Alloprevotella were significantly increased. After gavage administration of JP, the proportions of Lachnospiraceae_NK4A136_group, unclassified_f__Lachnospiraceae, norank_f__Lachnospiraceae, and Alloprevotella were significantly reduced, while the proportions of norank_f__Muribaculaceae and Bacteroides were significantly increased. After gavage administration of AcJP, the proportions of unclassified_f__Lachnospiraceae and Alloprevotella were significantly reduced, while the proportions of norank_f__Muribaculaceae, Lachnospiraceae_NK4A136_group, and Blautia were significantly increased. The results indicate that JP and AcJP have a certain regulatory effect on the gut microbiota composition of immunosuppressed mice.

[0195] 3. Analysis of the influence of jujube polysaccharides and their derivatives on the principal component (PCA)

[0196] from Figure 10-11It can be seen that the JP group samples were closer to the blank group samples and farther from the model group samples, indicating that JP intervention altered the structure of the gut microbiota in the model group mice to some extent, bringing it closer to normal, but not completely restoring it to a normal microbiota state. The AcJP group samples partially overlapped with the blank group samples, indicating that AcJP intervention altered the structure of the gut microbiota in the model group mice to some extent, bringing it closer to normal. The results show that acetylated jujube polysaccharide is more effective than jujube polysaccharide in improving the gut microbiota structure of immunosuppressed mice.

[0197] The above studies suggest that there is a certain correlation between the immunomodulatory effects of jujube polysaccharides and their derivatives and the regulation of gut microbiota.

[0198] The embodiments described above are merely preferred embodiments of the present invention, and not an exhaustive list of all possible implementations of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a jujube polysaccharide derivative in the preparation of immunomodulators, characterized in that, The jujube polysaccharide derivative is acetylated jujube polysaccharide, which is obtained by acetylation modification of jujube polysaccharide by acetic anhydride method, and the jujube polysaccharide is an acidic polysaccharide prepared by water extraction and alcohol precipitation method. The preparation method of the jujube polysaccharide includes the following steps: Step a, Pretreatment: Soak the jujube powder in 2.5-3.5 times its volume of 95% ethanol solution, change the ethanol solution every 22-26 hours, and repeat 2-4 times to pretreat the jujube powder and remove fat-soluble impurities. Step b, water extraction: On a dry weight basis, add distilled water to the pretreated jujube powder at a ratio of 1g:(18-22)mL, extract in a boiling water bath for 1.5h-2.5h, filter, and repeat the extraction 2-4 times on the filter residue. Combine the filtrates and concentrate by rotary evaporation to obtain the concentrate. Step c, alcohol precipitation: Add 95% ethanol solution to the concentrate at a volume ratio of 1:3-5, precipitate overnight at 4°C, filter with filter cloth to collect the precipitate, wash the precipitate with anhydrous ethanol, acetone and diethyl ether in sequence to remove small molecule impurities, dialyze the precipitate with running water for 3 days, and freeze dry under vacuum to obtain crude jujube polysaccharide. Step d, protein removal: After adding water to the crude polysaccharide of jujube to make a crude polysaccharide solution, the protein is removed by the Sevage method. The protein removal is repeated 5-7 times. After the protein removal, the polysaccharide solution is concentrated by evaporation, dialyzed with distilled water for 70-75 hours, and then freeze-dried under vacuum to obtain jujube polysaccharide. The jujube powder is made from dried and pulverized golden thread jujube fruits. The preparation method of acetylated jujube polysaccharide includes the following steps: The reaction mixture was prepared according to the following mass-volume ratio: jujube polysaccharide, distilled water, and acetic anhydride 1g:30mL:8-10mL. First, the jujube polysaccharide was dissolved in distilled water and stirred until dissolved. Then, acetic anhydride was added dropwise. After the addition was complete, the pH of the reaction solution was adjusted to 9.

0. The reaction was then carried out at a constant temperature of 40℃-60℃ for 2-4 hours. After the reaction was completed, the pH was adjusted to 7.0 with concentrated hydrochloric acid. The mixture was dialyzed with distilled water for 3 days and then freeze-dried under vacuum to obtain acetylated jujube polysaccharide.

2. The application of the jujube polysaccharide derivative according to claim 1 in the preparation of immunomodulators, characterized in that, The jujube polysaccharide includes rhamnose, arabinose, xylose, mannose, glucose, and galactose, and also includes uronic acid; The average molecular weight of the jujube polysaccharide is 2.75 × 10⁻⁶. 5 .

3. The application of the jujube polysaccharide derivative according to claim 2 in the preparation of immunomodulators, characterized in that, The molar ratio of rhamnose, arabinose, xylose, mannose, glucose and galactose in the jujube polysaccharide is 1.05:1.00:1.61:0.05:0.10:0.07; the mass content of uronic acid in the jujube polysaccharide is 39.84%.

4. The application of the jujube polysaccharide derivative according to claim 1 in the preparation of immunomodulators, characterized in that, The acetylated jujube polysaccharide includes rhamnose, arabinose, xylose, mannose, glucose, and galactose; it also includes uronic acid. The average molecular weight of acetylated jujube polysaccharide is 3.38 × 10⁻⁶. 5 .

5. The application of the jujube polysaccharide derivative according to claim 4 in the preparation of immunomodulators, characterized in that, The molar ratio of rhamnose, arabinose, xylose, mannose, glucose and galactose in the acetylated jujube polysaccharide is 0.39:1.00:1.21:0.02:0.05:0.10; the mass content of uronic acid in the acetylated jujube polysaccharide is 36.07%.

Images