Use of rt3 as a medicament for treating glioma

Abstract

The application discloses application of RTN3 in preparation of a drug for treating glioma, an amino acid sequence of the RTN3 is shown as SEQ ID NO. 1, and a gene encoding the RTN3 is numbered as ENSG00000133318. It is found by the application that overexpression of RTN3 in a glioma cell line T98G can induce swelling and expansion of tumor cells, increase release of lactic acid dehydrogenase LDH and inflammatory factor IL-18, increase cell death, and significantly increase N-terminal cleavage of a pyroptosis key protein GSDMD, thereby prompting occurrence of pyroptosis. It is found by RNA-Seq sequencing that the expression amount of RTN3 mRNA of cells transfected with a plasmid vector group containing an RTN3 expression sequence (RTN3-myc group) is 20 times to 33 times higher than that of cells transfected with a blank vector plasmid group (Vector group) without the RTN3 expression sequence.

Description

Technical Field

[0001] This invention relates to the use of RTN3 as a drug for treating glioma. Background Technology

[0002] Primary brain tumors refer to a heterogeneous group of tumors originating from cells within the central nervous system. Gliomas account for 75% of primary malignant brain tumors in adults. Gliomas are neuroectodermal tumors originating from glial cells or precursor cells, including astrocytomas, oligodendrogliomas, and ependymomas. Gliomas are the most common malignant brain tumors, highly aggressive, and characterized by high early mortality, high drug resistance, poor prognosis, and high medical costs. According to the World Health Organization (WHO) classification scheme, gliomas can be divided into low-grade gliomas (LGG) and glioblastoma multiforme (GBM). Among them, glioblastoma has the worst prognosis, with a median survival of less than 1.5 years.

[0003] RTN3 (Reticulon 3), also known as endoplasmic reticulum-associated protein 3, belongs to the reticulon (RTN) protein family. Proteins in this family all possess a reticulon homologous domain (RHD) at their C-terminus, which is relatively conserved across species. In humans and rodents, the RTN family can be divided into four members, RTN1-4. These family members are primarily located on the endoplasmic reticulum and play important roles in various cellular physiological processes. Although current research on RTN3 mainly focuses on processes such as nervous system function and its role in the development of various neurodegenerative diseases, the functions of RTN3 are actually not limited to these areas. Summary of the Invention

[0004] This invention aims to provide the application of RTN3 in drugs for the treatment of glioma, by increasing the expression level of intracellular RTN3, inducing glioma cell death, and targeting the treatment of glioma.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] RTN3 is used in the preparation of drugs for treating glioma. The amino acid sequence of RTN3 is shown in SEQ ID NO.1, and the gene encoding RTN3 is numbered ENSG00000133318.

[0007] In one preferred embodiment, increasing RTN3 expression levels thereby treating glioma.

[0008] In another aspect, the present invention provides the use of RTN3 in the preparation of drugs that promote pyroptosis of glioma cells and as a prognostic drug for glioma.

[0009] In another aspect, the present invention provides the application of a reagent for increasing the expression level of RTN3 in the preparation of a drug for treating glioma, wherein the reagent for increasing the expression level of RTN3 includes any one of the following (1)-(4):

[0010] (1) Recombinant plasmids or recombinant viruses that express or encode the RTN3 protein;

[0011] (2) miRNA inhibitors that target the RTN3-encoded mRNA sequence;

[0012] (3) Expression plasmids or recombinant viruses containing circRNA that regulates the expression level of RTN3-encoded mRNA;

[0013] (4) Small molecule drugs that increase the expression level of RTN3-encoded mRNA or RTN3-encoded protein.

[0014] In one preferred embodiment, the sequence of the recombinant plasmid expressing or encoding the RTN3 protein is shown in SEQ ID NO.3.

[0015] In one preferred embodiment, the miRNA inhibitors targeting the RTN3-encoded mRNA sequence include hsa-miR-224-3p inhibitors, hsa-miR-522-3p inhibitors, hsa-miR-4775 inhibitors, hsa-miR-335-3p inhibitors, hsa-miR-367-5p inhibitors, hsa-miR-205-5p inhibitors, hsa-miR-590-3p inhibitors, hsa-miR-4684-3p inhibitors, or hsa-miR-671-5p inhibitors.

[0016] In one preferred embodiment, the sequence of the hsa-miR-224-3p inhibitor is shown in SEQ ID NO.4.

[0017] In one preferred embodiment, the circRNA that regulates the expression level of RTN3-encoded mRNA includes hsa_circ_0002848, hsa_circ_0004092, or hsa_circ_0033040.

[0018] The sequence of hsa_circ_0002848 is shown in SEQ ID NO.5.

[0019] The sequence of hsa_circ_0004092 is as follows (SEQ ID NO.6):

[0020] CTTGGAAACCATTTCCTTCCTTTGCATGCTTGGGTACAAGGTAAAATGGCTTTAGTCGTAGTTGCTTCCTAACTTTTGCTGAAAGCCAGTTTTGAATGCGCAGGCCTTCTTGGGTGCTAGCAGGCCAGCTACTTTTTGATTCCAAAGCCAGGGTTATATCCACAGATATTTTTTCACTAATAAGAAGTGTTACAGCAGGGCTCCCTCCTCTTTTCCTCTTCATGATGACATCTGTAT。

[0021] The sequence of hsa_circ_0033040 is as follows (SEQ ID NO.7):

[0022] CTCTATCTGCTATTCTTTTCATCAACTGATGCTCTCCCCATTTAATCAGATATTTAAGGATATCTTGTTCACTTGCCTATAATAAAAAATGGTTTATATTTATTTTAGTGAAATTAGATAAGTGGTTAATTTCATTAAGGACTTTTCGTAGGTGGGAAATAACAGCATGCAACTTACCATGTTTCACTCTTTCCATTGGCTGTTTGAAGTTTTAGTGTTAAATCTGTGGTCCATCAACAGGAAATATACAAGACTGCATTACATATATTTTATCCAGTAACCTCAATCTTGGCTCCAACTAATTTTTAAATTTCATTTCTATCTTCTTTTTCTGTAATCTGCTCCCTTCCTATTTTATTTTTTCATTTTAATTTTTCCTTTTGAGATGAAGTCGTACTCTATTGCCCAGGCTGGAGTGCAGCAGTGCCATCATGGGTCTCTGCAGCCTCAACCTCCTGGGCTCAAGTGATT

[0023] CTCCCCGCTTCAGCCTCCTGAGCAGCTGGGACTACAGGTATGTGCTACCACACCCAG

[0024] CTAATTTTTTTTTTTTTTTTTGAGAGGGAGTCTCGCGCTGTTGCCCAGGCTGGAGTGC

[0025] AGTGGTGTGATCTTGACTCACTGCAAGCTCCTCCTCCCAGGTTCACGCCATTCTCCTG

[0026] CCTCAGTCTCCCAAGTAGCTGGGACTACAGGCCGCCCGCCACCACGCCTGGCTAATTT

[0027] TTTTGTATTTTTAGTAGAGACAGGGTTTTACCTTGTTAGTCAGGATGGTCTCGATCTCC

[0028] TGACCTCGTGATCCGCCTGCCTTGGCCTCCCAAAATGGCTAATTTTTTTTTAAATTTTT

[0029] TGTACAAATGGGGTCCCACCTGTTGCCAAGGCTGGTCTCGTACTTCCGGGCTCAAGC

[0030] AACCCACTTCCTATTTTAAATTTATTTTATTCTTACTATGTGGTTTCTATATAGCTGCCTTA

[0031] AATTCTCTTTTGGAAGAAAACAGAGATAAGTAAATGAAAGTGTAAGTATAGGGTATAG

[0032] GCAGAGTAACTACTCTCTCCTGGAGGGACAGGAAAAACAAGTCAGTCAACTTGTTTT

[0033] GGCAGAAGAAACTACAATCTCTTACAAGGTATTCTACTGGTTAGTGAAGCACAATCTGT

[0034] GAAATGGCAATGTAGCCCTCATTTCTTTGTATTTTATTTAAAATCTTAGAGCAAATCTA

[0035] GGCTGCTCTCTGTTTTTTTTTTTTTTAATACTTTCTAAGAAGGAATGCAAAGCTCCTAA

[0036] AGACAATAATCTAAGAGAACTAACAACTTCTAACACAAACATAAAGCGTCCAGTTTT

[0037] GATCAGGACAATGAGACAAGGTTAATGAACAAAGATTCTCCATAAATCAAGCCCAAG

[0038] TATGCCATCTGTACTGCAATCAAAGCAACATACAAAGGAAAAGCACAGATGCTGAGT

[0039] GTATTATTTAACTCTCCACTGCATTTCTGACTAAAATGGTAGCATTTTATTATTTTTCTAG

[0040] TACAAATACAAAGAAATAGGAAGTGGTTCAATGGGTTTATGTCTTTAATAGCATTAAA

[0041] ACGGTTGTACAGTTTTTAGCATAAAATTCATATAGCCAATGCACAAAAATTAAGCTTGG

[0042] ATATACTTTGCCTGTAAGTATTTTCTGTAATGTATAAAATCTATTATTAATGTAAATTTCC

[0043] AAATTAAATTGACATTTAAGTCAAGAACACAAGAATTTGCTAAAAACTACTTCTGGTT

[0044] AAAAATAAGTAGTTGAAAACATTACCGTACTTTGGAAGAATACATGCACTGAGTTTTG

[0045] ATAAAAATGTGAGCAGATCAGAAATTGAATATTATTTTTACTTTGTGCTGCTGAAGCTA

[0046] CTGTCTTACAATCTAAGTATGTGATGCTCCACCAAAAGTAAGAAACCACTATAGAGAA

[0047] GCTACATTAATAGAAGTCAAGAAAATCATGTTGGGATGTGCTTCTGACCTTGCCTACT

[0048] GCCCCAATCTCTTTTTGGTGCATTTGGCTGGGACCTGGGCTTGTTCAATGTTGAGTCA

[0049] TGGTAGCAGTGTACATGAAGAGCCAGTGAGCCAGAAGGCTTTTGTTGTACAACTATG

[0050] AAAGAGGGCAGTCCTGGGTGGTTTGATCACAGCCTGTTTCTCTTCCCCTGCCCTACCCT

[0051] AGATGGAAGAGTAATAGAGCATAGATGGGTTTCTTGGCGCACATATGAATGACAGAGT

[0052] TTGAAGGTGTTTAAATGATTACCTGTAGGTAGTCAGACTGGATAGCAGTAAGCAGAT

[0053] GGTCTTTGCTGAGTTCATAAAAAACATCCGAAGTCATGACCTGGGAAAATTCCTCAC

[0054] AGAGGAAATGTAAAGCTTGTCGGTGCACCCATTTAGAGCCATATGGATGAGAACTCC

[0055] ACTTGAGGATGGCAATTAAGGTATCTAATGAGATGCTCTCAGCAATGATATCCTCACAGC.

[0056] In one preferred embodiment, the small molecule drug that increases the expression level of RTN3-encoded mRNA or RTN3-encoded protein includes tunicamycin.

[0057] In one preferred embodiment, increasing the expression level of RTN3 can also be achieved using existing gene editing technologies.

[0058] Gene editing technologies such as CRISPR / Cas9, transcription activator-like effector nuclease (TALEN), and zinc-finger nuclease (ZFN) are used.

[0059] In another aspect, the present invention provides the use of a reagent for increasing the expression level of RTN3 in the preparation of a drug that promotes pyroptosis of glioma cells and as a prognostic drug for glioma, wherein the reagent for increasing the expression level of RTN3 includes any one of the following (1)-(4):

[0060] (1) Recombinant plasmids or recombinant viruses that express or encode the RTN3 protein;

[0061] (2) miRNA inhibitors that target the RTN3-encoded mRNA sequence;

[0062] (3) Expression plasmids or recombinant viruses containing circRNA that regulates the expression level of RTN3-encoded mRNA;

[0063] (4) Small molecule drugs that increase the expression level of RTN3-encoded mRNA or RTN3-encoded protein.

[0064] In one preferred embodiment, the sequence of the recombinant plasmid expressing or encoding the RTN3 protein is shown in SEQ ID NO.3.

[0065] In one preferred embodiment, the miRNA inhibitors targeting the RTN3-encoded mRNA sequence include hsa-miR-224-3p inhibitors, hsa-miR-522-3p inhibitors, hsa-miR-4775 inhibitors, hsa-miR-335-3p inhibitors, hsa-miR-367-5p inhibitors, hsa-miR-205-5p inhibitors, hsa-miR-590-3p inhibitors, hsa-miR-4684-3p inhibitors, or hsa-miR-671-5p inhibitors.

[0066] In one preferred embodiment, the sequence of the hsa-miR-224-3p inhibitor is shown in SEQ ID NO.4.

[0067] In one preferred embodiment, the circRNA that regulates the expression level of RTN3-encoded mRNA includes hsa_circ_0002848, hsa_circ_0004092, or hsa_circ_0033040.

[0068] The sequence of hsa_circ_0002848 is shown in SEQ ID NO.5.

[0069] The sequence of hsa_circ_0004092 is as follows (SEQ ID NO.6):

[0070] CTTGGAAACCATTTCCTTCCTTTGCATGCTTGGGTACAAGGTAAAATGGCTTTAGTCGTAGTTGCTTCCTAACTTTTGCTGAAAGCCAGTTTTGAATGCGCAGGCCTTCTTGG GTGCTAGCAGGCCAGCTACTTTTTGATTCCAAAGCCAGGGTTATATCCACAGATATTTTTTCACTAATAAGAAGTGTTACAGCAGGGCTCCCTCCTCTTTTCCTCTTCATGATGACATCTGTAT.

[0071] The sequence of hsa_circ_0033040 is as follows (SEQ ID NO.7):

[0072]

[0073] In one preferred embodiment, the small molecule drug that increases the expression level of RTN3-encoded mRNA or RTN3-encoded protein includes tunicamycin.

[0074] The present invention will be further explained below:

[0075] In 2002, Huang Xiaowei proposed that RTN3 expression was increased in gliomas. However, this study contradicts the conclusions drawn from the applicant's extensive collection of clinical samples (detected using Western blotting or immunohistochemistry) and cytological examinations. The applicant found that RTN3 is highly expressed in normal human brain tissue, but generally lowly expressed in glioma tissue. Furthermore, increasing RTN3 expression levels can significantly inhibit gliomas and their malignancy. Even after glioma surgery, increasing RTN3 expression levels can improve prognosis and treatment outcomes.

[0076] Compared with the prior art, the beneficial effects of the present invention are: the present invention provides the application of reagents that enhance the expression of RTN3 in the preparation of drugs for treating or treating glioma, which can effectively promote pyroptosis of glioma cells, thereby effectively treating glioma. Attached Figure Description

[0077] Figure 1 This is a pathological image of tumor tissue removed from patients with RTN3 at different stages of glioma, obtained using immunohistochemistry.

[0078] Figure 2 Images showing the expression of RTN3 in excised tumor tissue from glioma patients at different stages, using the immunoblotting method.

[0079] Figure 3 This image is an optical microscope photograph taken to illustrate the increased cell death following overexpression of RTN3 in glioma cell lines after transfection with a plasmid vector containing the RTN3 expression sequence / hsa-miR-224-3p inhibitor.

[0080] Figure 4 This figure shows a flow cytometry analysis of cell death after transfecting glioma cell lines with a plasmid vector containing the RTN3 expression sequence / hsa-miR-224-3p inhibitor to achieve RTN3 overexpression.

[0081] Figure 5This figure shows the results of ELISA assays on the cell supernatant after transfecting glioma cell lines with a plasmid vector containing the RTN3 expression sequence / hsa-miR-224-3p inhibitor to achieve RTN3 overexpression, followed by detection of lactate dehydrogenase (LDH) and interleukin-18 (IL-18).

[0082] Figure 6 This image shows the detection of GSDMD, a key pyroptosis molecule, after transfecting glioma cell lines with a plasmid vector containing the RTN3 expression sequence / hsa-miR-224-3p inhibitor to overexpress RTN3 using the Western blotting method. Detailed Implementation

[0083] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of the present invention can be combined with each other. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available. The amino acid sequence of the RTN3 protein involved in the following embodiments is shown in SEQ ID NO. 1 (SEQ ID NO. 1) of the sequence listing, and its encoding gene sequence is shown in SEQ ID NO. 2 (SEQ ID NO. 2) of the sequence listing.

[0084] Example 1: Detection results of RTN3 expression in tumor tissues of glioma patients at different stages. Subjects: Tumor tissues removed from glioma patients.

[0085] (1) Operation steps

[0086] Informed consent was obtained, and peripheral blood and glioma tissue specimens (glioma tissue from glioma patients, and normal control tissue from accidental donations from individuals who had not developed glioma) and clinical data were collected from both normal and glioma patients. Peripheral blood specimens were centrifuged at 1000 rpm for 5 minutes, serum was extracted, and the samples were stored at -80°C. A portion of the glioma tissue was soaked in 4% paraformaldehyde fixative overnight at room temperature. The fixed samples were dehydrated with graded ethanol, cleared with xylene, embedded in paraffin at 52-54°C, and routinely sectioned to a thickness of 4-10 mm. The sections were then mounted on clean, treated slides and baked overnight at 34°C. The remaining samples were preserved in liquid nitrogen to establish a comprehensive clinical resource bank for gliomas.

[0087] Subsequently, the paraffin sections were subjected to immunohistochemical staining.

[0088] Paraffin sections of glioma tissue from the patient were obtained, followed by dewaxing and gradient alcohol dehydration: the sections were sequentially immersed in xylene I for 15 min, xylene II for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% ethanol for 5 min, 75% ethanol for 5 min, and washed with distilled water. The sections were then permeabilized by soaking in 0.25% Triton-X 100 solution for 5 minutes. Citric acid retrieval solution (pH 6.0) (Wuhan Pinofi Biotechnology Co., Ltd., P0026) was then placed in a microwave oven and heated to boiling. The sections, placed on a heat-resistant plastic rack, were then heated in the microwave for 3 minutes. After natural cooling, the slides were placed in PBS (pH 7.4) and washed three times on a decolorizing shaker for 5 minutes each time. Then, 5% goat serum solution (Beijing Solarbio Science & Technology Co., Ltd., SL038) was added to the tissue sections for blocking, and the sections were soaked for 1 hour. Finally, the sections were incubated overnight at 4°C with RTN3 primary antibody (Abcam, USA, ab68328). The next day, after rinsing with the primary antibody, the tissue was incubated with the corresponding secondary antibody (Pinofi Biotechnology Co., Ltd., Wuhan, PN0046). After rinsing three times or more, DAB working solution (Solepro Biotechnology Co., Ltd., Beijing, DA1010) was added dropwise to the tissue. The slide was then observed under a microscope. Once specific brown expression appeared, the DAB chromogenic solution was rinsed off with water, and the slide was then immersed in water. The expression is typically brown, while the background is relatively lighter in color, or even colorless.

[0089] On the other hand, protein extraction was performed on glioma tissue preserved in liquid nitrogen, and the specific procedures are as follows:

[0090] ① Add the appropriate amount of protease inhibitor (Shanghai Lanmu Chemical Co., Ltd., B14001) to the RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd., R0010), cut the tumor tissue into small pieces, add the appropriate amount of RIPA lysis buffer containing protease inhibitor, and grind and lyse the tumor tissue with a tissue grinder.

[0091] ②Then it was placed in a rotary pyrolysis apparatus at 4°C for 2 hours;

[0092] ③ After high-speed centrifugation, transfer the supernatant into a new tube;

[0093] ④ The protein concentration of each sample was determined using the BCA reagent kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd., BCA01). The specific procedure was as follows: Prepare BCA working solution with 50 volumes of solution A and 1 volume of solution B. Add standards to 96-well plates at volumes of 0, 1, 2, 4, 6, 8, and 10 μL. Add 2 μL of the sample to be tested to each well. Balance the volume of each well to 10 μL with PBS. Add 200 μL of BCA working solution to each well and incubate at 37°C for 30 minutes. Then, measure the A562nm value using a microplate reader and calculate the protein concentration.

[0094] Subsequently, the RTN3 protein level in each sample was detected using Western blotting, as detailed below:

[0095] Each protein lysate sample was diluted with protein loading buffer, then subjected to SDS gel electrophoresis, and then wet-processed to transfer the membrane. The PVDF membrane (MillIPORE, IPFL85R) was activated with methanol and then sandwiched together with the gel in a protein transfer system (Bio-Rad, 1703930) for wet-processing. Immerse the membrane in 5% skim milk and place it on a decolorizing shaker with slow shaking. Block for 1 hour, then incubate with RTN3 primary antibody (Abcam, USA, ab68328) and GAPDH primary antibody (Wuhan Sanying Biotechnology Co., Ltd., 60004-1-Ig), respectively. Rinse, incubate with the corresponding secondary antibody (CST, USA, 7074 or 7076), rinse, and develop color and photograph using an ECL kit (MillIPORE, USA, WBULS0500). Add the working solution, a 1:1 mixture of solution A and solution B, to the membrane to induce luminescence and develop color, and then photograph.

[0096] (2) The results are as follows Figure 1 and Figure 2 As shown, Figure 1 Pathological images showing the staining of tumor tissue removed from patients with RTN3 at different stages of glioma; Figure 2 Images showing the expression of RTN3 in excised tumor tissue from patients with glioma at different stages.

[0097] Findings: RTN3 protein expression is correlated with the stage of glioma patients. Patients with higher stages have lower RTN3 protein expression.

[0098] Example 2: Results of RTN3 overexpression inducing glioma cell death

[0099] Subject: Human glioma cell line T98G

[0100] (1) Operation steps

[0101] First, the cultured cells were transfected with the plasmid vector / hsa-miR-224-3p inhibitor containing the RTN3 expression sequence to increase its expression. The specific procedure is as follows:

[0102] ① For human glioma cell line T98G cultured in 6-well cell culture plates, transfection can be performed when its density grows to 70-80%.

[0103] ② Change the medium in each well, leaving only 2 mL of fresh, antibiotic-free complete culture medium (90% DMEM high glucose medium + 10% fetal bovine serum, both purchased from Wuhan Pronosai Life Science Technology Co., Ltd., models PM150210 and 164210-50 respectively) in each well;

[0104] ③ For each well of cells, prepare a sterile 1.5mL centrifuge tube and add 125μL of OPTI-MEM medium (Gibco, USA, 31985070) and 5μL of Lipofectamine 3000 reagent (Thermo Fisher Scientific, USA, L3000015) to the tube and gently mix.

[0105] ④ Prepare another sterilized 1.5mL centrifuge tube. Add 125μL of OPTI-MEM medium and 1μg of recombinant plasmid / has-miR-224-3p inhibitor (has-miR-224-3p inhibitor was synthesized from Suzhou Gemma Gene Co., Ltd., sequence: UGUAGUCACUAGGGCACCAUUUU (direction: 5'→3')), and gently mix. Each group has 3 replicate wells. The controls are empty vector plasmid without RTN3 expression sequence / control inhibitor RNA (synthesized from Suzhou Gemma Gene Co., Ltd., B04003). The sequence of the recombinant plasmid is shown in SEQ ID NO.3.

[0106] ⑤ Add the DNA-OPTI medium diluted in ④ to the Lipofectamine-OPTI medium diluted in ③, and gently mix.

[0107] ⑥ Incubate at room temperature for 10 minutes;

[0108] ⑦ Add the mixed DNA liposomes into each cell well, mix gently, and return to a 37°C incubator for 2 more days before proceeding to the next experiment.

[0109] Image of increased cell death under an optical microscope

[0110] The cell culture plates were placed in an optical microscope, focused, and observed and photographed using 20x and 40x objectives. The results are as follows: Figure 3As shown, the number of cells exhibiting swelling and enlargement (indicated by the white arrow) in the RTN3-myc group was significantly higher than that in the Vector group; the number of cells exhibiting swelling and enlargement (indicated by the white arrow) in the control inhibitor group was significantly higher than that in the hsa-miR-224-3p inhibitor group.

[0111] Flow cytometry was then performed, and the specific procedure is as follows:

[0112] The Annexin V-FITC / PI double staining apoptosis detection kit (Annolon (Beijing) Biotechnology Co., Ltd., 640914) was used. Diluted FITC (Annolon (Beijing) Biotechnology Co., Ltd., 640914) was added to each group of cell samples at a ratio of 1:30. The Vector group consisted of empty vector plasmids without RTN3 expression sequences; the RTN3-myc group consisted of plasmid vectors containing RTN3 expression sequences; the control inhibitor group consisted of RNA transfection; and the hsa-miR-224-3p inhibitor group consisted of hsa-miR-224-3p inhibitor transfection. After incubation for 1 hour, the culture medium was discarded, and the cells were washed three times with PBS. Apoptosis washing buffer was added, and propidium iodide (PI) was added to each sample before flow cytometry analysis. Results are as follows: Figure 4 As shown, the number of Annexin V-FITC and PI double-positive cells in the RTN3-myc group (i.e., in the second quadrant of the figure) was significantly higher than that in the Vector group; the number of double-positive cells in the control inhibitor group was significantly higher than that in the hsa-miR-224-3p inhibitor group.

[0113] Cell supernatant culture medium was used for enzyme-linked immunosorbent assay (ELISA).

[0114] Using commercially available LDH detection kits (Vancovel, F0350-A) and IL-18 detection kits (Vancovel, F0138-A), the detection method was as follows: Blank wells, standard wells, and sample wells were prepared separately. 50 μL of standard (LDH or IL-18 standard) was added to each well, and 40 μL of diluent and 10 μL of stock sample solution were added to each sample well. The plate was incubated at 37°C for 30 minutes. The liquid was discarded and the plate was dried. Washing buffer was added and discarded, and this process was repeated 5 times. 50 μL of enzyme-labeled reagent was added to each well. Incubation and washing were continued. Then, chromogenic reagents A and B were added to each well for color development, and the reaction was terminated with 50 μL of stop solution. The plate was zeroed using a blank well (without any prior treatment, only AB chromogenic reagents and stop solution were added), and the absorbance of each well was measured sequentially at 450 nm. The results are shown below. Figure 5 As shown.

[0115] The method for Western blot detection of proteins is as described in Example 1. The results are as follows: Figure 6 As shown. Figure 6 In the N-ter GSDMD, the N-terminal splice of the key pyroptosis protein GSDMD is represented, and the intensity of the corresponding band indicates the degree of expression of this splice.

[0116] The results showed that transfection of plasmid vectors containing the RTN3 expression sequence into the T98G glioma cell line...

[0117] Following the administration of the / hsa-miR-224-3p inhibitor, overexpression of RTN3 induced tumor cell swelling, increased release of lactate dehydrogenase (LDH) and the inflammatory factor IL-18, increased cell death, and significantly increased N-terminal cleavage of the key pyroptosis protein GSDMD, suggesting the occurrence of pyroptosis. In this study, we found through RNA-Seq sequencing that cells transfected with plasmid vectors containing RTN3 expression sequences (RTN3-myc group) showed a 20-33 fold increase in RTN3 mRNA expression compared to cells transfected with empty vector plasmids without RTN3 expression sequences (Vector group). This indicates that high RTN3 expression (15-50 fold) can induce pyroptosis in glioma cells.

[0118] The above embodiments should be understood as being used only to illustrate the present invention more clearly, and not to limit the scope of the present invention. After reading the present invention, any modifications of the present embodiments by those skilled in the art will fall within the scope defined by the appended claims.

Claims

1. The application of RTN3 in the preparation of drugs for treating glioma, characterized in that, The amino acid sequence of RTN3 is shown in SEQ ID NO.1, and the gene encoding RTN3 is numbered ENSG00000133318.

2. The application according to claim 1, characterized in that, Increasing RTN3 expression levels can help treat glioma.

3. The application of RTN3 in the preparation of drugs that promote pyroptosis of glioma cells and in the preparation of prognostic drugs for glioma, characterized in that, The amino acid sequence of RTN3 is shown in SEQ ID NO.1, and the gene encoding RTN3 is numbered ENSG00000133318.

4. The application of a reagent that increases the expression level of RTN3 in the preparation of drugs for treating glioma, characterized in that, The reagents for increasing the expression level of RTN3 include any one of the following (1)-(2): (1) Recombinant plasmids or recombinant viruses that express or encode the RTN3 protein; (2) miRNA inhibitors targeting the RTN3-encoded mRNA sequence; the miRNA inhibitor is an hsa-miR-224-3p inhibitor, the sequence of which is UGUAGUCACUAGGGCACCAUUUU; The amino acid sequence of RTN3 is shown in SEQ ID NO.1, and the gene encoding RTN3 is numbered ENSG00000133318.

5. The application according to claim 4, characterized in that, The sequence of the recombinant plasmid expressing or encoding the RTN3 protein is shown in SEQ ID NO.

3.

6. The application of a reagent that enhances the expression level of RTN3 in the preparation of drugs that promote pyroptosis of glioma cells and in the preparation of prognostic drugs for glioma, characterized in that, The reagents for increasing the expression level of RTN3 include any one of the following (1)-(2): (1) Recombinant plasmids or recombinant viruses that express or encode the RTN3 protein; (2) miRNA inhibitors targeting the RTN3-encoded mRNA sequence; the miRNA inhibitor is an hsa-miR-224-3p inhibitor, the sequence of which is UGUAGUCACUAGGGCACCAUUUU; The amino acid sequence of RTN3 is shown in SEQ ID NO.1, and the gene encoding RTN3 is numbered ENSG00000133318.

Images