A magnetic nanoprobes modified by alginate / polyethyleneimine and preparation method and application thereof

By using alginate/polyethyleneimine composite modified magnetic nanoprobes, the problems of erythrocyte lysis and non-specific adsorption in existing CTC enrichment methods have been solved, achieving efficient and specific sorting of circulating tumor cells in whole blood.

CN117160424BActive Publication Date: 2025-11-07SHEN ZHEN YI XIN YI LIAO KE JI YOU XIAN GONG SI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311109748.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-30
Publication Date
2025-11-07
Estimated Expiration
2043-08-30

AI Technical Summary

Technical Problem

Existing methods for enriching circulating tumor cells (CTCs) require erythrocyte lysis, resulting in low enrichment efficiency and non-specific protein adsorption affecting diagnostic accuracy. There is a lack of effective materials to resist non-specific adsorption.

Method used

A magnetic nanoprobe modified with alginate/polyethyleneimine composite was used to form a dense water-bound layer on the surface of the magnetic nanoparticles through layer-by-layer assembly technology, which resists the non-specific adsorption of red blood cells and proteins and directly sorts CTCs in whole blood.

Benefits of technology

It achieves efficient and specific sorting of circulating tumor cells without the need for erythrocyte lysis, significantly improving the enrichment efficiency and diagnostic accuracy of CTCs. The materials are readily available and the operation is simple.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117160424B_ABST
    Figure CN117160424B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological medicine, in particular to a alginate / polyethyleneimine composite modified magnetic nano probe and a preparation method and application thereof. The application discloses an alginate / polyethyleneimine composite modified magnetic nano probe, which comprises a composite polymer modified magnetic material and an aptamer connected to the composite polymer modified magnetic material; the composite polymer comprises alginate and polyethyleneimine; the magnetic material in the composite polymer modified magnetic material is Fe3O4 magnetic nano particle; and the aptamer comprises an amino-modified CSV aptamer and / or an amino-modified EpCAM aptamer. The magnetic probe disclosed by the application can sort circulating tumor cells directly in 1 milliliter of patient whole blood without lysing red blood cells, and has high sorting efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicines, in particular to a alginate / polyethyleneimine composite modified magnetic nano probe and a preparation method and application thereof. BACKGROUND

[0002] Lung cancer is one of the malignant tumors with the highest morbidity and mortality worldwide. Local recurrence and distant metastasis are the main causes of high mortality of lung cancer. In addition, the heterogeneity of tumors is an important reason why single biopsy cannot obtain all the molecular information of the tumor, and is also the basis of tumor drug resistance, so it is necessary to dynamically evaluate the molecular typing of the tumor. It is particularly important to establish a new test technology for early diagnosis and monitoring of lung cancer to improve the overall prognosis of patients.

[0003] Liquid biopsy as a non-invasive diagnostic technology for tumors has developed rapidly in recent years. Circulating tumor cells (CTCs) are defined as cancer cells that are spontaneously or affected by external factors to separate from the primary or metastatic tumor, leave the solid tumor lesion and enter the blood. CTCs can provide multi-level molecular information including DNA, RNA and protein, while other indicators can only provide abnormal information at the genetic level, thus reflecting the significant contribution of CTCs to the diagnosis, efficacy evaluation and prognosis prediction of lung cancer.

[0004] Existing CTC enrichment methods usually need to first lyse the red blood cells of the patient's blood, because there are a large number of red blood cells in the blood, which will be strongly adsorbed on the surface of the enrichment material, thereby affecting the enrichment efficiency of CTCs. In addition, the complex proteins in the patient's blood will also be non-specifically adsorbed on the enrichment material, causing the specificity and accuracy of CTC enrichment to decrease, and thus affecting the diagnosis results of cancer patients. Although researchers have been trying to find anti-protein non-specific adsorption materials and study their adsorption mechanism, so far, no anti-non-specific protein adsorption material has been obtained. Therefore, it is of great significance to find a new type of magnetic bead material with low cost, easy preparation, high specificity and resistance to non-specificity of blood proteins and red blood cells, and to combine the material with the CTC enrichment technology to realize the research of CTCs in whole blood.

[0005] Retrieving the literatures and patents related to magnetic composite nanomaterials at home and abroad shows that there is no relevant report on the use of alginate / polyethyleneimine composite modified magnetic nano probe and layer-by-layer assembly technology for the sorting application of circulating tumor cells in the whole blood of lung cancer patients.

[0006] Therefore, we provide an alginate / polyethyleneimine composite modified magnetic nano probe and a preparation method and application thereof. SUMMARY

[0007] In order to overcome the deficiencies of the prior art, the present application provides a kind of alginate / polyethyleneimine composite modified magnetic nano probe and its preparation method and application, the magnetic probe described in the present application can be sorted in 1 milliliter of patient whole blood for circulating tumor cells without lysing red blood cells, and has high sorting efficiency.

[0008] The technical scheme adopted by the present application to solve its technical problems is:

[0009] The first object of the present application provides a kind of alginate / polyethyleneimine composite modified magnetic nano probe, which comprises a composite polymer modified magnetic material, and an aptamer connected to the composite polymer modified magnetic material.

[0010] The composite polymer comprises alginate and polyethyleneimine.

[0011] The magnetic material in the composite polymer modified magnetic material is Fe3O4 magnetic nanoparticle.

[0012] The aptamer comprises amino-modified CSV aptamer and / or amino-modified EpCAM aptamer.

[0013] Preferably, the number of layers of the composite polymer modified layer is 4-10 layers.

[0014] Preferably, the average particle size of the Fe3O4 magnetic nanoparticle is 230 nm, and the surface net charge is-18.56 mV.

[0015] More preferably, in the composite polymer modified magnetic material, the mass ratio of Fe3O4 magnetic nanoparticle, alginate and polyethyleneimine is 12:1:2.

[0016] The second object of the present application provides a preparation method of the above-mentioned probe, comprising the following steps:

[0017] (1) Preparation of Fe3O4 dispersion

[0018] Fe3O4 magnetic nanoparticles are prepared by hydrothermal method to prepare Fe3O4 dispersion;

[0019] (2) Preparation of multi-layer composite polymer modified magnetic material

[0020] Polyethyleneimine and alginate are alternately added to the Fe3O4 dispersion for reaction; after the reaction is completed, washing and separation are carried out to obtain a multi-layer composite polymer modified magnetic material;

[0021] (3) Activation

[0022] The multi-layer composite polymer modified magnetic material and the activator are mixed sufficiently to activate the surface carboxyl group.

[0023] (4) Incubation

[0024] The activated multi-layer composite polymer modified magnetic material and the aptamer are subjected to an incubation reaction to obtain a alginate / polyethyleneimine composite modified magnetic nanoprobe.

[0025] Preferably, the pH in step (2) is 4-5, and the reaction time is 3-4 h.

[0026] Preferably, the washing in step (2) is performed using a 0.15 mol / L NaCl solution.

[0027] Preferably, the activation time in step (3) is 0.5-1 h.

[0028] Preferably, the activator in step (3) comprises 1-ethyl-(3-dimethylaminopropyl) carbodiimide, N-hydroxysuccinimide.

[0029] Preferably, the multi-layer composite polymer modified magnetic material obtained in step (2) has an average particle size of 245 nm and a surface net charge of 52 mV.

[0030] Preferably, the molar mass ratio of the multi-layer composite polymer modified magnetic material to ZY5C and SYL3C in step (4) is 2.5 x 10 5 mol / mg and 2.8 x 10 5 mol / mg, respectively.

[0031] A third object of the present application is to apply the above probe to sorting circulating tumor cells in whole blood of lung cancer.

[0032] Further, the circulating tumor cells in whole blood of lung cancer are sorted, and the sorting step comprises:

[0033] After the above magnetic nanoprobe is prepared into a suspension, it is added to a PBS solution or whole blood containing a number of circulating tumor cells in the range of 5-80 per milliliter, and then incubated at room temperature for a certain period of time. The complex of the cells combined with the magnetic probe is added to an appropriate amount of PBS, resuspended, dyed with DAPI, and observed under a fluorescence microscope to observe the combination of the probe and the circulating tumor cells. The enrichment efficiency is calculated by a flow cytometer.

[0034] The present application has the following beneficial effects:

[0035] 1. The probe of the present application forms a dense combined water layer on the surface of the magnetic material by using a composite polymer modified magnetic material through solvation and hydrogen bonding, thereby resisting the adsorption of proteins, red blood cells, etc., and thereby realizing the enrichment of CTCs in whole blood.

[0036] 2. The probe of this application combines layer-by-layer assembly, polymer coating and magnetic separation technology; compared with commercial magnetic beads, this alginate / polyethyleneimine composite modified magnetic nanoprobe has excellent resistance to non-specific adsorption of proteins, red blood cells and other substances in blood; the probe can not only be used for efficient and specific sorting of circulating tumor cells, but also can directly sort very trace amounts of circulating tumor cells in whole blood without any pretreatment of the collected fresh patient blood.

[0037] 3. The probes used in this application involve readily available raw materials and are easy to operate, showing broad application prospects in the clinical detection and analysis of circulating tumor cells. Attached Figure Description

[0038] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0039] Figure 1 These are SEM images of Fe3O4 and Fe3O4@(PEI / AA)4 (scale bar is 250 nm);

[0040] Figure 2 This is a comparison of the Zeta-potentials of Fe3O4 and magnetic beads modified with different numbers of layers of composite polymer;

[0041] Figure 3 This is an inverted fluorescence image of Cy5-labeled EpCAM and 6-FAM-labeled CSV aptamers after incubation with Fe3O4@(PEI / AA)4;

[0042] Figure 4 This is a schematic diagram showing the results of the resistance of Fe3O4, Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer to BSA adsorption.

[0043] Figure 5 This is a schematic diagram showing the results of Fe3O4, Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer's resistance to erythrocyte adsorption.

[0044] Figure 6 Fe3O4@Aptamer and Fe3O4@(PEI / AA)4@Aptamer in PBS ( Figure 6 A) and in simulated blood ( Figure 6 B) Schematic diagram of sorting efficiency for different numbers of A549 cells;

[0045] Figure 7 This is a schematic diagram illustrating the sorting efficiency of Fe3O4, Fe3O4@(PEI / AA)4, and Fe3O4@(PEI / AA)4@Aptamer on 200 A549 cells. DETAILED DESCRIPTION

[0046] For the convenience of those skilled in the art, the present application is further described below in conjunction with examples, and the content mentioned in the embodiments is not a limitation on the present application.

[0047] As used herein, "and / or" includes the term "and", "or" and any one or more associated listed terms. The term used herein is only used to describe specific embodiments, and is not intended to limit the present application. As used herein, the singular forms "a", "an" and "the" are also intended to include the plural forms, unless the context clearly indicates otherwise. It is further understood that "comprising" is used in this specification to specify the stated features, integers, steps, operations, elements, and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or combinations thereof.

[0048] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0049] The exemplary application described herein can be appropriately absent any one or more of the elements not specifically disclosed herein. Therefore, the terms "comprise", "include", "contain" and the like should be understood broadly and non-restrictively. In addition, the terms used herein are used as description, not limitation, and it is not intended that the use of these terms excludes any equivalent characteristics, but only describes some of their characteristics, but according to the right, various modifications are possible within the scope of the present application. Therefore, although the present application has been specifically disclosed by preferred embodiments and optional features, modifications disclosed herein to embody variations of the present application can be recorded by those skilled in the art, and such modifications and variations will be considered within the scope of the present application.

[0050] The raw materials or reagents used in the examples and comparative examples of the present application are purchased from mainstream manufacturers in the market. If the manufacturer is not specified or the concentration is not specified, it is an analytical grade raw material or reagent that can be obtained routinely, without special limitation, as long as it can play the expected role. The instruments and equipment used in the examples, such as magnetic stirrers, are purchased from major manufacturers in the market, as long as they can play the expected role, without special limitation. If the specific technology or condition is not specified in the examples, it is carried out according to the technology or condition described in the literature in the art or according to the product instruction.

[0051] The current existing CTCs enrichment method usually needs to first lyse red blood cells of the patient blood, because a large number of red blood cells in the blood can be strongly adsorbed on the surface of the enrichment material, thereby affecting the enrichment efficiency of the CTCs. In addition, a plurality of proteins in the patient blood can also be non-specifically adsorbed on the enrichment material, thereby reducing the specificity and accuracy of the CTCs enrichment, and further affecting the diagnosis result of the cancer patient; the present inventors have found through careful research that polyethyleneimine (PEI) is a water-soluble polymer, and the hydroxyl group in the structure has high reactivity and can react with the carboxyl group and cross-link polymerization. Alginic acid (AA) is a natural polysaccharide uronic acid existing in the cell wall of kelp, giant kelp and other brown algae, and contains a large number of carboxyl groups in the structure, which can continue to react and polymerize with the hydroxyl groups on the polyethyleneimine. After the polyethyleneimine and the alginic acid are compounded, the zwitterions (composite polymers) formed have electrostatic interaction with water and their own charge balance, which can resist non-specific adsorption. After the above composite polymer is further connected with the magnetic beads, a dense bound water layer is formed on the surface of the magnetic beads through solvation and hydrogen bonding, thereby resisting the adsorption of proteins, red blood cells and the like, and thereby realizing the enrichment of CTCs in whole blood. In addition, through the layer-by-layer assembly (LBL) strategy, the physical and chemical properties and the anti-fouling ability of the above polymer antifouling layer can be conveniently regulated.

[0052] Therefore, a preparation method of an alginic acid salt / polyethyleneimine composite modified magnetic nanoprobe is provided, which comprises the following steps:

[0053] (1) Preparation of Fe3O4 dispersion liquid

[0054] Fe3O4 magnetic nanoparticles are prepared by a hydrothermal method to prepare a Fe3O4 dispersion liquid;

[0055] (2) Preparation of a multi-layer composite polymer modified magnetic material

[0056] Polyethyleneimine (molecular weight 1800, CAS number: 9002-98-6) and alginic acid are alternately added to the Fe3O4 dispersion liquid for reaction; after the reaction is completed, the multi-layer composite polymer modified magnetic material is obtained through washing and separation;

[0057] (3) Activation

[0058] The multi-layer composite polymer modified magnetic material and the activating agent are thoroughly mixed to activate the surface carboxyl groups;

[0059] (4) Incubation

[0060] The activated multi-layer composite polymer modified magnetic material and the aptamer are incubated to obtain the alginic acid salt / polyethyleneimine composite modified magnetic nanoprobe.

[0061] Wherein: step (1), mainly to provide Fe3O4 dispersion, namely using the prior art, such as hydrothermal method for preparing Fe3O4 magnetic nanoparticles, Fe3O4 magnetic nanoparticles dispersed in anhydrous ethanol, Fe3O4 magnetic nanoparticles and anhydrous ethanol mass ratio can be 1:1, 1:3, 1:5 or 1:10, to meet the dispersion effect of Fe3O4 magnetic nanoparticles.

[0062] Specifically, the ferric chloride hexahydrate, sodium acetate and sodium citrate are dissolved in ethylene glycol, stirred at 170℃ for 1h, and then continue to react for 8h; after the reaction is completed, it is cooled to room temperature, and after washing, Fe3O4 magnetic nanoparticles are obtained; the average particle size of Fe3O4 magnetic nanoparticles is 230nm, and the surface net charge is-18.56mV.

[0063] Wherein: step (2) prepares alginate (AA) and polyethyleneimine (PEI) into aqueous solution, then adds positively charged polyethyleneimine and negatively charged alginate into Fe3O4 dispersion alternately, under pH=4-5, the reaction time is 3-4h; after the reaction is completed, it is washed with 0.15mol / L NaCl solution, and the magnetic separation is carried out, to prepare the multi-layer composite polymer modified magnetic material Fe3O4@(PEI / AA)4 probe;

[0064] The average particle size of Fe3O4@(PEI / AA)4 probe is 245nm, and the surface net charge is 52mV; the number of layers of the composite polymer modified in Fe3O4@(PEI / AA)4 probe is 4-10 layers, and the mass ratio of Fe3O4 magnetic nanoparticles, alginate and polyethyleneimine is 12:1:2.

[0065] Wherein: step (3), the above Fe3O4@(PEI / AA)4 probe is added into the mixed solution of 1-ethyl-(3-dimethylaminopropyl) carbonyl diimide (EDC) and N-hydroxysuccinimide (NHS), to activate the surface carboxyl group;

[0066] Wherein: (4), the epithelial expression and interstitial expression aptamer is added into the above probe, incubated, and after the magnetic separation, the magnetic nanoprobe (Fe3O4@(PEI / AA)4@Aptamer) for sorting circulating tumor cells in whole blood is obtained;

[0067] The aptamer includes amino modified CSV aptamer (ZY5C) and / or amino modified EpCAM aptamer (SYL3C).

[0068] The molar mass ratio of the magnetic probe and ZY5C and SYL3C in step (4) is 2.5×10 52.8 x 10 5 mol / mg.

[0069] The Fe3O4@(PEI / AA)4@Aptamer magnetic probe is used for analysis of circulating tumor cells in whole blood. The application includes the ability of the probe to resist non-specific adsorption of proteins and red blood cells in the whole blood environment, and the sorting effect of circulating tumor cells in whole blood. The specific sorting steps are as follows: after the magnetic nanoprobe is prepared into a suspension, it is added to a PBS solution containing 5-80 circulating tumor cells per milliliter or whole blood. After incubation at room temperature for a certain period of time, the complex of circulating tumor cells combined with the magnetic probe is separated by magnetism, resuspended in an appropriate amount of PBS, stained with DAPI, and observed under a fluorescence microscope to observe the binding of the probe to the circulating tumor cells. The enrichment efficiency is calculated by flow cytometry. In the sorting step, human non-small cell lung cancer A549 cells are selected as the circulating tumor cell model, and THP-1 is used as the negative control cell.

[0070] In order to better illustrate the purpose and technical effects of the present application, the following experimental process is carried out.

[0071] I. Experimental method

[0072] 1. Preparation of Fe3O4 magnetic nanoparticles

[0073] 0.30 g of ferric chloride hexahydrate, 0.8 g of sodium acetate, and 0.9 g of sodium citrate were weighed into a round-bottom flask and stirred at 200°C for 1.5 h. Then, the mixture was transferred to a reaction kettle and heated to 200°C for 10 h. After cooling to room temperature, the mixture was washed thoroughly and dispersed for use.

[0074] 2. Preparation of Fe3O4@(PEI / AA)4@Aptamer composite magnetic nanoprobe

[0075] First, alginic acid (AA) and polyethyleneimine (PEI) were dissolved in a NaCl solution. Then, AA and PEl were added to the Fe3O4 dispersion liquid in multiple times and alternately, and the washing liquid was added. According to the order of AA, PEl, and washing liquid, the process was repeated four times to obtain Fe3O4@(PEI / AA)4 magnetic material modified with four layers of composite polymer coating.

[0076] Take 5 mg Fe3O4@(PEI / AA)4, add a mixed solution containing 100 μL EDC solution (20 mg / mL) and 100 μL NHS solution (20 mg / mL), and mix for 30 min. After magnetic separation to remove the supernatant, continue to add 200 μL of a mixed solution of amino-modified CSV aptamer ZY5C (150 mM) and EpCAM aptamer SYL3C (150 mM), and incubate at room temperature for 10 h to obtain a dual-aptamer linked immunomagnetic probe (Fe3O4@(PEI / AA)4@Aptamer). The synthesis process of single CSV or single EpCAM aptamer linked immunomagnetic beads is the same as above. The amino-modified CSV aptamer and the amino-modified EpCAM aptamer are from Shengong Bioengineering (Shanghai) Co., Ltd., and their specific sequences are as follows: NH2-5'-CACGCATAGCCTTTGCTCCTCGTCTGGAACGTCGCAGCTTTAGTTCTGGGCCTATGCGTG

[0077] and

[0078] NH2-5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG.5 ’ The method for modifying the amino group at the end is to couple the phosphoramidite monomer on the amino C6 with the hydroxyl group at the end of the Oligo (see the following structure for details)

[0079]

[0080] 3. Fe3O4@(PEI / AA)4@Aptamer magnetic nanoprobes for sorting lung cancer circulating tumor cells in different media

[0081] Add 5, 10, 20, 40, and 80 A549 cells to 1 mL of PBS solution and healthy adult blood, respectively, and then add 0.05 mg / mL Fe3O4@(PEI / AA)4@Aptamer probes, react for 20 min, and use magnetic separation to capture the captured and uncaptured cells. Add DAPI dye to the captured cells, incubate in the dark for 30 min, and then observe under a microscope. At the same time, count the uncaptured cells in the supernatant using a flow cytometer to calculate the sorting efficiency.

[0082] 4. Investigation of Fe3O4@(PEI / AA)4@Aptamer magnetic nanoprobes against protein-specific adsorption in whole blood environment

[0083] BSA protein was used to investigate the ability of the probe to resist protein adsorption in whole blood: 0.5 mg / mL BSA protein solution was prepared, and then diluted to 0.25 mg / mL, 0.1 mg / mL and 0.05 mg / mL, and UV-vis detection was performed to draw the standard curve of BSA at different concentrations. Then 0.5 mg of Fe3O4, Fe3O4@ (PEI / AA) 4 and Fe3O4@ (PEI / AA) 4@Aptamer probe was added to 0.25 mg / mL BSA, respectively, and reacted for 1 h. The supernatant was separated by magnetism and detected by UV-vis to detect the change of BSA absorbance. Another 0.25 mg / mL of FITC fluorescently labeled BSA solution was prepared, and 1 mg of the above three probes was added, respectively, and reacted and separated, and then observed under a fluorescence microscope.

[0084] 5. Investigation of Fe3O4@ (PEI / AA) 4@Aptamer magnetic nanoprobe resistance to non-specific cell adhesion in whole blood environment

[0085] A549 cells were used to investigate the ability of the probe to resist non-specific cell adhesion in whole blood: A549 cells were collected, resuspended, counted and diluted. 200 μL of resuspended solution containing 1000 cells was taken, and 0.05 mg / mL of Fe3O4, Fe3O4@4PEI4AA and Fe3O4@4PEI4AA@Aptamer magnetic beads was added, respectively, and reacted for 20 min. The captured and uncaptured cells were separated by magnetism. DAPI was added to the captured cells, and after incubation in the dark for 30 min, they were observed under a microscope. At the same time, flow cytometry was used to count the uncaptured cells in the supernatant to calculate the capture efficiency.

[0086] 6. Human non-small cell lung cancer A549 cells were selected as the circulating tumor cell model, and THP-1 was used as the negative control cell.

[0087] II. Results and discussion

[0088] 1. Structural characterization of Fe3O4@ (PEI / AA) 4@Aptamer composite magnetic nanoprobe

[0089] Reference Figure 1 Compared with Fe3O4 alone, the magnetic nanoparticles after reaction with the composite polymer showed a highly cross-linked characteristic, and the surface of Fe3O4 became smooth, and the particle size increased from 230 nm to about 245 nm.

[0090] Figure 2The change of zeta potential of Fe3O4 and Fe3O4 coated with different layers of {PEI / AA} composite polymer was shown. The zeta potential of Fe3O4 was negative (-18.56 mV) due to the abundant carboxyl groups on the surface. With the increase of the layers of {PEI / AA} composite coating, the net negative charge on the surface of Fe3O4 became smaller and smaller. When the layers of coating were 3, the magnetic beads had turned into positive charge, and with the increase of the layers of coating, the net positive charge on the surface of Fe3O4 became higher and higher. This result showed the interaction between Fe3O4 and {PEI / AA} composite coating, and also confirmed the successful preparation of Fe3O4@(PEI / AA)4 composite magnetic beads.

[0091] Next we used fluorescence microscopy imaging technology to verify whether EpCAM and CSV aptamer were successfully modified on Fe3O4@(PEI / AA)4. First, we labeled EpCAM and CSV aptamer with Cy5 and 6-FAM fluorescent dyes respectively, and then modified them on Fe3O4@(PEI / AA)4 according to the same experimental method. Referring to Figure 3 , we observed obvious red fluorescence of Cy5 and green fluorescence of 6-FAM on the surface of Fe3O4@(PEI / AA)4@Aptamer, and yellow appeared in the combined image, indicating the co-localization of the two dyes on the surface of Fe3O4@(PEI / AA)4@Aptamer. The above results showed the successful modification of the two aptamers on the magnetic beads.

[0092] 2. Investigation of the ability of Fe3O4@(PEI / AA)4@Aptamer magnetic nanoprobe to resist non-specific adsorption of proteins in whole blood

[0093] Because the blood environment is extremely complex, containing numerous proteins, which will affect the capture ability of the probe for circulating tumor cells, therefore, we investigated whether Fe3O4@(PEI / AA)4@Aptamer probe could resist non-specific adsorption of proteins in whole blood. Fe3O4, Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer were incubated with FITC-labeled BSA respectively, and then the characteristic absorption of BSA at 277 nm was determined by UV-vis spectrum. Referring to Figure 4It can be found that the unmodified Fe3O4 has almost no anti-fouling ability, and the adsorption amount of BSA on its surface is as high as 92 mg / g. When the {PEI / AA} multilayer polymer is modified on the surface of Fe3O4, the adsorption amount of BSA is significantly reduced, which has a significant difference compared with Fe3O4 alone, and exhibits excellent anti-fouling ability. And this significant anti-fouling effect does not decrease with the modification of Aptamer on Fe3O4@(PEI / AA)4. There is no significant difference in the ability of Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer to resist the adsorption of BSA protein.

[0094] 3. Investigation of the ability of Fe3O4@(PEI / AA)4@Aptamer magnetic nanoprobe to resist non-specific adsorption of red blood cells in whole blood

[0095] In the process of capturing circulating tumor cells in whole blood, in addition to proteins affecting the capture ability of the probe, the presence of a large number of red blood cells will also lead to a decrease in capture efficiency. And the red blood cells are small in size and numerous, which are difficult to remove. Therefore, we continue to evaluate the ability of Fe3O4@(PEI / AA)4@Aptamer probe to resist non-specific adsorption of red blood cells in whole blood.

[0096] Fe3O4, Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer were incubated with red blood cells for 30 minutes, respectively. Reference Figure 5 It can be found that the unmodified Fe3O4 has almost no anti-fouling ability, and the adsorption amount of BSA on its surface is as high as 92 mg / g. When the {PEI / AA} multilayer polymer is modified on the surface of Fe3O4, the adsorption amount of BSA is significantly reduced, which has a significant difference compared with Fe3O4 alone, and exhibits excellent anti-fouling ability. And this significant anti-fouling effect does not decrease with the modification of Aptamer on Fe3O4@(PEI / AA)4. There is no significant difference in the ability of Fe3O4@(PEI / AA)4 and Fe3O4@(PEI / AA)4@Aptamer to resist the adsorption of BSA protein.

[0097] 4. Fe3O4@(PEI / AA )4 @Aptamer magnetic nanoprobe for sorting lung cancer CTCs

[0098] We added a small amount of A549 cells to 1 mL of fresh blood samples of healthy volunteers to simulate clinical blood samples, and then investigated and compared the ability of Fe3O4@(PEI / AA)4@Aptamer magnetic nanoprobe and unmodified Fe3O4@Aptamer magnetic probe to sort a small amount of A549 cells in PBS and simulated blood samples. Reference Figure 6 In PBS ( Figure 6A), Fe3O4@(PEI / AA)4@Aptamer and Fe3O4@Aptamer probe have no difference in sorting 5-80 A549 cells, and the number of captured A549 cells increases with the increase of added cells, and the two linear regression equations are Y=0.959X (R2=0.999) and Y=0.950X (R2=0.999), and the two curves almost overlap. However, in the simulated blood, we found that although the number of A549 cells captured by the two probes increased with the increase of added cells, the number of circulating tumor cells captured from the blood by Fe3O4@Aptamer without (PEI / AA)4 modification was significantly less than that by Fe3O4@(PEI / AA)4@Aptamer. There is a significant difference between the two linear regression curves, that is, the slope of the Fe3O4@Aptamer curve is lower than that of the Fe3O4@(PEI / AA)4@Aptamer regression curve. This result fully shows that due to the modification of the four-layer composite polymer (PEI / AA)4, the probe can resist the non-specific adsorption of proteins and red blood cells in the complex environment of blood, thereby improving the sorting efficiency of circulating tumor cells.

[0099] In addition, we can see from Figure 7 that the sorting efficiency of Fe3O4@(PEI / AA)4@Aptamer magnetic probe for 200 lung cancer A549 cells can be as high as nearly 94%. Under the same conditions, Fe3O4 and Fe3O4@(PEI / AA)4 material without aptamer modification have poor sorting ability for A549 cells. At the same time, we found that Fe3O4 magnetic material without aptamer and polymer coating modification has a sorting efficiency of about 19%, which is higher than that of Fe3O4@(PEI / AA)4. This result is mainly due to the fact that the non-polymer modified Fe3O4 has more active and non-active sites exposed outside, which is prone to strong non-specific adsorption. Fe3O4@(PEI / AA)4 nanomaterial has strong resistance to non-specific adsorption, and its surface has no aptamer, so it has little ability to identify and sort CTCs, which further shows that the (PEI / AA)4 polymer coating has a significant advantage in obtaining high-purity CTCs from whole blood, and has broad prospects in clinical applications.

[0100] The above embodiment is a preferred implementation of the present application, in addition to this, the present application can be realized in other ways, without departing from the concept of the present application, any obvious replacement within the protection scope of the present application.

Claims

1. A alginate / polyethylenimine complex modified magnetic nanoprobe, characterized in that, The composite polymer modified magnetic material, the aptamer connected to the composite polymer modified magnetic material; The composite polymer comprises alginic acid and polyethyleneimine; the number of layers of the composite polymer modification is 4-10 layers; The magnetic material in the composite polymer modified magnetic material is Fe3O4 magnetic nanoparticle; The aptamer comprises amino-modified CSV aptamer and / or amino-modified EpCAM aptamer; The preparation method of the alginic acid / polyethyleneimine composite modified magnetic nanoprobe comprises the following steps: (1) preparing Fe3O4 dispersion liquid Fe3O4 magnetic nanoparticles are prepared by a hydrothermal method to prepare Fe3O4 dispersion liquid; (2) preparing the multi-layer composite polymer modified magnetic material Polyethyleneimine and alginic acid are alternately added to the Fe3O4 dispersion liquid for reaction; after the reaction is completed, washing and separation are performed to obtain the multi-layer composite polymer modified magnetic material; (3) activation The multi-layer composite polymer modified magnetic material and an activating agent are fully mixed to activate the surface carboxyl group; (4) incubation The activated multi-layer composite polymer modified magnetic material and the aptamer are incubated to obtain the alginic acid / polyethyleneimine composite modified magnetic nanoprobe.

2. The probe of claim 1, wherein The average particle size of the Fe3O4 magnetic nanoparticles is 230 nm.

3. The probe of claim 1, wherein In the composite polymer modified magnetic material, the mass ratio of Fe3O4 magnetic nanoparticles, alginic acid and polyethyleneimine is 12:1:

2.

4. The method of claim 1-3, wherein the probe is prepared by, The method comprises the following steps: (1) preparing Fe3O4 dispersion liquid Fe3O4 magnetic nanoparticles are prepared by a hydrothermal method to prepare Fe3O4 dispersion liquid; (2) preparing the multi-layer composite polymer modified magnetic material Polyethyleneimine and alginic acid are alternately added to the Fe3O4 dispersion liquid for reaction; after the reaction is completed, washing and separation are performed to obtain the multi-layer composite polymer modified magnetic material; (3) activation The multi-layer composite polymer modified magnetic material and an activating agent are fully mixed to activate the surface carboxyl group; (4) incubation The activated multi-layer composite polymer modified magnetic material and the aptamer are incubated to obtain the alginic acid / polyethyleneimine composite modified magnetic nanoprobe.

5. The production method according to claim 4, characterized by, In step (2), the pH of the reaction is 4-5, and the reaction time is 3-4 h.

6. The preparation method according to claim 4, characterized in that, In step (2), 0.15 mol / L NaCl solution is used for washing.

7. The preparation method according to claim 4, characterized in that, In step (3), the activation time is 0.5-1 h.

8. The preparation method according to claim 4, characterized in that, In step (3), the activating agent comprises 1-ethyl-(3-dimethylaminopropyl) carbonyl diimide and N-hydroxysuccinimide.

Citation Information

Patent Citations

  • Reversibly assembled and decomposable fluorescent magnetic nano material and nano biological probe and preparation methods thereof

    CN103396786A