A method for enhancing the de novo synthesis of 1,5-pentanediamine by regulating intracellular PLP supply

Abstract

This invention discloses a method for enhancing the de novo synthesis of 1,5-pentanediamine by regulating intracellular PLP supply, belonging to the field of biotechnology. Using *Escherichia coli* as the starting strain, this invention obtained recombinant *E. coli* by introducing and overexpressing four endogenous / exogenous genes: lysine decarboxylase gene cadA, 4-phosphate hydroxy-L-threonine dehydrogenase gene pdxA, glutaminase subunit gene pdxT, and PLP synthase subunit gene pdxS. Using this recombinant strain for fermentation synthesis, 1,5-pentanediamine can be produced from glucose under mild conditions, and cell growth and the production of the precursor lysine can also be promoted, showing great promise for applications.

Description

Technical Field

[0001] This invention relates to a method for improving the de novo synthesis of 1,5-pentanediamine by regulating intracellular PLP supply, and belongs to the field of biotechnology. Background Technology

[0002] 1,5-Pentanediamine is an important chemical that can be used as a raw material to synthesize a series of high-value-added products with important applications, such as high-grade polyurethane adhesives and polyurethane elastomers with special properties. Its applications cover multiple fields such as polyurethane, polyester, coatings, dyes, agriculture, and medicine, and it has broad market prospects. Currently, the low efficiency of de novo synthesis of 1,5-pentanediamine limits its production capacity and applications, but the global market consumes approximately 30 million tons of polyamide products annually, and market demand is showing an upward trend year by year.

[0003] Currently, most industrial production of 1,5-pentanediamine globally utilizes non-renewable petroleum fossil fuels through chemical methods and whole-cell catalytic biotransformation. This process involves complex equipment, high production costs, and causes some environmental pollution. Furthermore, industrial production equipment typically faces challenges such as demanding equipment requirements, severe corrosion, and poor catalyst stability.

[0004] The de novo fermentation method for synthesizing 1,5-pentanediamine can reduce fossil fuel consumption, save costs, improve the level of circular economy, and achieve low-carbon production. Currently, research on the fermentation synthesis of 1,5-pentanediamine mainly focuses on using biomass such as glucose and lignocellulose. However, due to the long metabolic pathway, the toxicity of 1,5-pentanediamine, and the shortage of cofactors for the key synthetic enzyme lysine decarboxylase, problems have not been well resolved, resulting in a low yield of 1,5-pentanediamine from de novo fermentation, hindering industrial-scale production. Currently, the team led by Chen Kequan at Nanjing University of Technology has conducted the most research on de novo fermentation of 1,5-pentanediamine and also has the highest yield (58.7 g / L). Therefore, it is necessary to develop a clean and efficient microbial de novo synthesis method for 1,5-pentanediamine.

[0005] Producing 1,5-pentanediamine via de novo fermentation is not only a mild reaction process but also has low production costs. Therefore, developing a biomanufacturing industry for producing 1,5-pentanediamine based on lysine as a precursor is of great significance for environmental protection and improving the level of the circular economy. Summary of the Invention

[0006] To address the aforementioned issues, this invention employs a synergistic approach using two PLP enhancement pathways and screens genes within these pathways to obtain the optimal combination of MypdxT and ScpdxS. Furthermore, it optimizes the promoter expression elements and induction time, ultimately yielding a novel, highly efficient, and high-yield method for de novo fermentation of 1,5-pentanediamine under mild conditions.

[0007] The first objective of this invention is to provide a method for increasing the yield of 1,5-pentanediamine synthesized de novo by recombinant Escherichia coli, wherein the method comprises overexpressing the lysine decarboxylase gene (cadA) shown in SEQ ID NO.1, the 4-phosphate hydroxy-L-threonine dehydrogenase gene (pdxA) shown in SEQ ID NO.2, the glutaminase subunit gene (MypdxT) shown in SEQ ID NO.9, and the PLP synthase subunit gene (ScpdxS) shown in SEQ ID NO.12 in an Escherichia coli host.

[0008] Furthermore, the promoter P is adopted. T5 Initiate the expression of the lysine decarboxylase gene.

[0009] Furthermore, the promoter P is adopted. J23108 The expression of the 4-phosphohydroxy-L-threonine dehydrogenase gene, the glutaminase subunit gene, and the PLP synthase subunit gene was initiated, respectively.

[0010] Furthermore, the expression of the 4-phosphate hydroxyl-L-threonine dehydrogenase gene is initiated using a first promoter, and the expression of the glutaminase subunit gene and the PLP synthase subunit gene is initiated using a second promoter. The first promoter is selected from P... T or P Trc The second promoter is selected from P T5 or P Tac Preferably, the first promoter and the second promoter are P... T5 and P Tac Or, the first promoter and the second promoter are P Trc and P Tac .

[0011] Furthermore, the promoter P J23108 The nucleotide sequence is shown in SEQ ID NO.15, and the promoter P... T5 The nucleotide sequence is shown in SEQ ID NO.16, and the promoter P... Tac The nucleotide sequence is shown in SEQ ID NO.17, and the promoter P... Trc The nucleotide sequence is shown in SEQ ID NO.18.

[0012] Furthermore, the method involves fermentation production using recombinant Escherichia coli, and the fermentation production includes the following steps: adding an inducer when the strain is inoculated into the fermentation medium for 0 to 3 hours.

[0013] Furthermore, the initial glucose concentration during fermentation was 28-32 g / L.

[0014] Furthermore, the fermentation conditions are: 36-38℃, 170-220rpm, pH controlled at 6.6-6.7, residual sugar controlled at 0-10g / L, and ammonia nitrogen content controlled at 0.15%-0.18%.

[0015] Furthermore, the concentration of the inducer is 0.3-0.6 mmol / L.

[0016] Furthermore, the fermentation medium comprises the following components: anhydrous glucose 28-32 g / L, magnesium sulfate heptahydrate 0.2-0.6 g / L, corn steep liquor protein powder 8-12 g / L, ammonium sulfate 1.5-2.0 g / L, potassium dihydrogen phosphate 0.4-0.8 g / L, and dipotassium hydrogen phosphate 1.2-1.6 g / L.

[0017] Furthermore, E. coli MG1655 was used as the starting strain.

[0018] Furthermore, pEM was used as the expression vector.

[0019] A second objective of this invention is to provide a recombinant Escherichia coli strain, wherein the recombinant Escherichia coli strain overexpresses the lysine decarboxylase gene (cadA) shown in SEQ ID NO.1, the 4-phosphate hydroxy-L-threonine dehydrogenase gene (pdxA) shown in SEQ ID NO.2, the glutaminase subunit gene (MypdxT) shown in SEQ ID NO.9, and the PLP synthase subunit gene (ScpdxS) shown in SEQ ID NO.12 in an Escherichia coli host.

[0020] Furthermore, the promoter P is adopted. T5 Initiate the expression of the lysine decarboxylase gene.

[0021] Furthermore, the promoter P is adopted. J23108 The expression of the 4-phosphohydroxy-L-threonine dehydrogenase gene, the glutaminase subunit gene, and the PLP synthase subunit gene was initiated, respectively.

[0022] Furthermore, the expression of the 4-phosphate hydroxyl-L-threonine dehydrogenase gene is initiated using a first promoter, and the expression of the glutaminase subunit gene and the PLP synthase subunit gene is initiated using a second promoter. The first promoter is selected from P... T5 or P Trc The second promoter is selected from PT5 or P Tac Preferably, the first promoter and the second promoter are P... T5 and P Tac Or, the first promoter and the second promoter are P Trc and P Tac .

[0023] A third objective of this invention is to provide a method for constructing the above-mentioned recombinant Escherichia coli, comprising the following steps:

[0024] S1. Link the gene fragments cadA and pdxA and insert them into the vector pEM to obtain the recombinant plasmid pEM-cadA-pdxA;

[0025] S2. Link the gene fragments cadA, MypdxT and ScpdxS and insert them into the vector pEM to obtain the recombinant plasmid pEM-cadA-pdxS / T;

[0026] S3. Transform the recombinant plasmids pEM-cadA-pdxA and pEM-cadA-pdxS / T into the Escherichia coli host to construct the recombinant Escherichia coli strain.

[0027] Furthermore, it also includes the step of replacing the original promoters of pdxA and pdxS / T with the first and second promoters mentioned above.

[0028] A fourth object of the present invention is to provide the use of the above-mentioned recombinant Escherichia coli in the preparation of products containing 1,5-pentanediamine or its derivatives.

[0029] The beneficial effects of this invention are:

[0030] This invention provides a method for the de novo production of 1,5-pentanediamine via fermentation, which enables the production of 1,5-pentanediamine from glucose under mild conditions. This reaction is less costly and operates under milder conditions. Using glucose as a substrate, recombinant Escherichia coli is added, and after shake-flask fermentation for 48 hours, the concentration of 1,5-pentanediamine produced is 11.23 g / L. Attached Figure Description

[0031] Figure 1 This refers to the biomass generated during the fermentation process.

[0032] Figure 2 This represents the accumulation of 1,5-pentanediamine during the fermentation process.

[0033] Figure 3 This represents the amount of lysine accumulated during the fermentation process.

[0034] Figure 4 The accumulation of 1,5-pentanediamine supplied to PLP cells was manipulated by promoters of different strengths.

[0035] Figure 5 The accumulation of 1,5-pentanediamine at different induction times. Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0037] The solution involved in this invention is as follows:

[0038] Escherichia coli itself cannot efficiently synthesize 1,5-pentanediamine via fermentation. Therefore, the lysine decarboxylase gene cadA from Escherichia coli, the 4-phosphate hydroxyl-L-threonine dehydrogenase gene pdxA from Escherichia coli, the glutaminase subunit gene pdxT from M. tuberculosis, and the PLP synthase subunit gene pdxS from S. cerevisiae were introduced into E. coli to obtain a recombinant E. coli strain (lysWT-3) that efficiently produces 1,5-pentanediamine. Subsequently, the recombinant E. coli lysWT-3 was subjected to expression element analysis (specifically, first using the original promoter P...). J23108 The expressions of pdxA, pdxT, and pdxS were started separately. To further optimize the promoter, different combinations of promoters were screened, and ultimately, promoter P was found to be the most suitable. T5 Replace the original promoter P of pdxA J23108 , with P Tac Replace the original promoter P of pdxT and pdxS J23108 The yield of the target product increased by 28.7%, and the optimization of fermentation conditions further improved the yield of 1,5-pentanediamine.

[0039] The materials involved in this invention are as follows:

[0040] LB medium (g / L): yeast extract 5g, trypsin 10g, sodium chloride 10g, pH adjusted to 7.0 with NaOH, autoclaved at 121°C for 20 min.

[0041] TB medium (g / L): tryptone 11.8, yeast extract 23.6, K2HPO4 9.4, g / L KH2PO4 2.2, glycerol 4 ml / L, pH adjusted to 7.0, autoclaved at 121℃ for 20 min.

[0042] Slant culture medium (g / L): tryptone 10, sodium chloride 5, sodium pyruvate 0.5, yeast extract 5, agar powder 20. Each test tube contains 20–25 mL of liquid, with cotton plugs, and is sterilized at 121°C for 15 min.

[0043] Primary seed culture medium (g / L): yeast extract 5, sucrose 3, tryptone 3, potassium dihydrogen phosphate 0.5, dipotassium hydrogen phosphate 1.0, pH = 7.5-7.6, sterilized at 121℃ for 15 min.

[0044] Secondary seed culture medium (g / L): anhydrous glucose 20, corn steep liquor protein powder 5, potassium dihydrogen phosphate 1.44, ammonium sulfate 14.4, pH = 7.5–7.6, sterilized at 121℃ for 20 min, glucose sterilized at 115℃ for 15 min. Fermentation culture medium (g / L): anhydrous glucose 30, magnesium sulfate heptahydrate 0.4, corn steep liquor protein powder 10.36, ammonium sulfate 1.8, potassium dihydrogen phosphate 0.6, dipotassium hydrogen phosphate 1.4, sterilized at 121℃ for 15 min, glucose sterilized at 115℃ for 15 min.

[0045] Example 1: Construction of recombinant Escherichia coli lysWT-1 and lysWT-2

[0046] 1. Construction of recombinant plasmid pEM-cadA

[0047] (1) Using cadA U and cadAD as primers and the cadA gene (nucleic acid sequence as shown in SEQ ID NO.1) as template, the cadA fragment with restriction enzyme sites was amplified.

[0048] cadA U:

[0049] GGATCGCATCACCATCACCATCACGGATCCATGAACGTTATTGCAATATTGAATCAC;

[0050] cadA D:

[0051] AGATCTACCAGACTCGAGTTATTTTTTGCTTTCTTCTTTCAATACCT;

[0052] (2) Linearized vector pEM was obtained by reverse amplification using pEM U and pEM D.

[0053] pEM U:CTCGAGTCTGGTAGATCT;

[0054] pEM D:GGATCCGTGATGGTGATG;

[0055] (3) Connect the linearized vector obtained in step (2) with the gene fragment cadA obtained in step (1) to obtain the recombinant plasmid pEM-cadA.

[0056] 2. Construction of recombinant plasmid pEM-cadA-pdxA

[0057] (1) Using pdxA U and pdxA D as primers, the pdxA gene (nucleic acid sequence as shown in SEQ ID NO.2) optimized by artificially synthesized codons was used as a template to amplify the pdxA fragment.

[0058] pdxA U:

[0059] AGAAAGCAAAAAATAACTCGAGTCTGGTAGATCTGGATCCTTGACA ATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTC ACACAGGAAACAGAATTCATGGTTAAAACCCAACGTGTT;

[0060] pdxA D:

[0061] AGCCATATGGGTGGCAGCAGTCATTGGGTGTTAACAATCATTTTG;

[0062] (2) The linearized vector pEM-cadA was obtained by reverse amplification using pEM-cadA U and pEM-cadA D.

[0063] pEM-cadA U:CTGCTGCCACCCATATG;

[0064] pEM-cadA D:GAATTCTGTTTCCTGTGTGAAAT;

[0065] (3) The enzyme digestion plasmid obtained in step (2) is ligated with the gene fragment pdxA obtained in step (1) to obtain the recombinant plasmid pEM-cadA-pdxA.

[0066] 3. Construction of recombinant Escherichia coli lysWT-1 and lysWT-2

[0067] (1) The recombinant plasmid pEM-cadA was introduced into competent cells of Escherichia coli MG1655, and the correct recombinant strain was obtained on LB plates containing 100 mg / L ampicillin and named lysWT-1.

[0068] (2) The recombinant plasmid pEM-cadA-pdxA was introduced into competent cells of Escherichia coli MG1655, and the correct recombinant strain was obtained on LB plates containing 100 mg / L ampicillin and named lysWT-2.

[0069] Example 2: Screening of pdxS / T

[0070] 1. Construction of recombinant plasmids pET28a-StpdxT, pET28a-BlglsA, pET28a-PfpdxT, pET28a-GepdxT, pET28a-BcpdxT, pET28a-ScpdxT, pET28a-MypdxT, pET28a-GepdxS, pET28a-BcpdxS, pET28a-ScpdxS, pET28a-MypdxS, and pET28a-PfpdxS

[0071] (1) Using StpdxT U and StpdxT D as primers, the StpdxT gene (nucleic acid sequence as shown in SEQ ID NO.3) optimized by artificially synthesized codons was used as a template to amplify the StpdxT fragment.

[0072] StpdxT U:

[0073] AGCAAATGGGTCGCGGATCCATGACAATAATGTCAAGTCAATTTCAGC;

[0074] StpdxT D:

[0075] GTGGTGGTGGTGGTGCTCGAGTTAGAAAACGCTCAGGCCAG;

[0076] (2) Using BglsA U and BglsA D as primers, the BglsA gene (nucleic acid sequence as shown in SEQ ID NO.4) optimized by artificially synthesized codons was used as a template to amplify and obtain the BglsA fragment.

[0077] BlglsA U:

[0078] CAGCAAATGGGTCGCGGATCCTTAAATTGTAGGCACAACGAAGAAC;

[0079] BlglsA D:

[0080] GTGGTGGTGGTGGTGCTCGAGTTAAAAGATGGAAAGGCTATAATTCGCC;

[0081] (3) Using PfpdxT U and PfpdxT D as primers, the PfpdxT gene (nucleic acid sequence as shown in SEQ ID NO.5) optimized by artificially synthesized codons was used as a template to amplify and obtain the PfpdxT fragment.

[0082] PfpdxT U:

[0083] AGCAAATGGGTCGCGGATCCATGAGTGAAATAACAATTGGAGTACTATCATT;

[0084] PfpdxT D:

[0085] GTGGTGGTGGTGGTGCTCGAGTTAAGAGTATTTGTAGTTCTTAACCTTCT CG;

[0086] (4) Using GepdxT U and GepdxT D as primers, the GepdxT gene (nucleic acid sequence as shown in SEQ ID NO.6) optimized by artificially synthesized codons was used as a template to amplify and obtain the GepdxT fragment.

[0087] GepdxT U:

[0088] GTGGTGGTGGTGGTGCTCGAGTTAAGAGTATTTGTAGTTCTTAACCT TCT CG;

[0089] GepdxT D:

[0090] GTGGTGGTGGTGGTGCTCGAGTTACTTCAGGCTGCTGGTCA;

[0091] (5) Using BcpdxT U and BcpdxT D as primers, the BcpdxT gene (nucleic acid sequence as shown in SEQ ID NO.7) was used as a template to amplify and obtain the BcpdxT fragment.

[0092] BcpdxT U:

[0093] AGCAAATGGGTCGCGGATCCATGTTAACAATAGGTGTACTAGGACT;BcpdxT D:

[0094] TGGTGGTGGTGGTGCTCGAGTTATACAAGTGCCTTTGCTTATATTC CT;

[0095] (6) Using SnpdxT U and SnpdxT D as primers, the SnpdxT gene (nucleic acid sequence as shown in SEQ ID NO.8) was used as a template to amplify and obtain the SnpdxT fragment.

[0096] ScpdxT U:

[0097] CAGCAAATGGGTCGCGGATCCATGCACAAAACCCACAGTAC;

[0098] ScpdxT D:

[0099] TGGTGGTGGTGGTGGTGCTCGAGTTAATTAGAAACAAACTGTCTGA TAA ACCAAT;

[0100] (7) Using MypdxT U and MypdxT D as primers, MypdxT fragments were amplified using the MypdxT gene (nucleic acid sequence as shown in SEQ ID NO.9) with optimized artificially synthesized codons as templates.

[0101] MypdxT U:

[0102] AGCAAATGGGTCGCGGATCCGTAAGTGTACCCAGGGTCG;

[0103] MypdxT D:

[0104] GTGGTGGTGGTGGTGCTCGAGTTACGCGGCCGAGGT;

[0105] (8) Using GepdxS U and GepdxS D as primers, the GepdxS gene (nucleic acid sequence as shown in SEQ ID NO.10) optimized with artificially synthesized codons was used as a template to amplify and obtain the GepdxS fragment.

[0106] GepdxS U:

[0107] CAGCAAATGGGTCGCGGATCCTTAGCTCTAACTGGAACAGATAGGG;

[0108] GepdxS D:

[0109] GTGGTGGTGGTGGTGCTCGAGTTACCAACCACGTTCTTGCATA;

[0110] (9) Using BcpdxS U and BcpdxS D as primers, the BcpdxS gene (nucleic acid sequence as shown in SEQ ID NO.11) was used as a template to amplify and obtain the BcpdxS fragment.

[0111] BcpdxS U:

[0112] AGCAAATGGGTCGCGGATCCATGGCTCAAACAGGTACTGA;

[0113] BcpdxS D:

[0114] TGGTGGTGGTGGTGCTCGAGTTACCAGCCGCGTTCTTG;

[0115] (10) Using SnpdxS U and SnpdxS D as primers, the SnpdxS gene (nucleic acid sequence as shown in SEQ ID NO.12) was used as a template to amplify and obtain the SnpdxS fragment.

[0116] ScpdxS U:

[0117] CAGCAAATGGGTCGCGGATCCATGACTGGAGAAGACTTTAAGATCA;

[0118] ScpdxS D:

[0119] GGTGGTGGTGGTGGTGCTCGAGTCACCACCCAATTTCGGAAAG;

[0120] (11) Using MypdxS U and MypdxS D as primers, the MypdxS gene (nucleic acid sequence shown in SEQ ID NO.13) with optimized artificially synthesized codons was amplified to obtain the MypdxS fragment. MypdxS U: AGCAAATGGGTCGCGGATCCATGGACCCCGCTGGAAA; MypdxS D: TGGTGGTGGTGGTGCTCGAGTTACCAGCCACGCTGGG;

[0121] (12) Using PfpdxS U and PfpdxS D as primers, the PfpdxS gene (nucleic acid sequence as shown in SEQ ID NO.14) optimized by artificially synthesized codons was used as a template to amplify and obtain the PfpdxS fragment.

[0122] PfpdxS U:

[0123] ACAGCAAATGGGTCGCGGATCCATGGAAAATCACAAAGATGACGC;PfpdxS D:

[0124] TGGTGGTGGTGGTGCTCGAGTTATTGCGGAGTCAGGAACTTG;

[0125] (13) The linearized vector pET28a was obtained by reverse amplification using pET28a U and pET28a D.

[0126] pET28a U: CTCGAGCACCACCACC;

[0127] pET28a D: GGATCCGGACCCATT;

[0128] (14) Ligate the linearized vector obtained in step (13) with the gene fragments StpdxT, BlglsA, PfpdxT, GepdxT, BcpdxT, SnpdxT, MypdxT, GepdxS, BcpdxS, SnpdxS, MypdxS, and PfpdxS obtained in steps (1) to (12) to obtain the corresponding recombinant plasmids pET28a-StpdxT and pET2 8a-BlglsA, pET28a-PfpdxT, pET28a-GepdxT, pET28a-BcpdxT, pET28a-ScpdxT, pET28a-My pdxT, pET28a-GepdxS, pET28a-BcpdxS, pET28a-ScpdxS, pET28a-MypdxS, pET28a-PfpdxS.

[0129] (15) The recombinant plasmids pET28a-StpdxT, pET28a-BlglsA, pET28a-PfpdxT, pET28a-GepdxT, pET28a-BcpdxT, pET28a-ScpdxT, pET28a-MypdxT, pET28a-GepdxS, pET28a-BcpdxS, pET28a-ScpdxS, pET28a-MypdxS, and pET28a-PfpdxS obtained in step (14) were introduced into E. coli BL21(DE3) competent cells to construct the recombinant strain E. coli. BL21(DE3)pET28a-StpdxT / pET28a-BlglsA / pET28a-PfpdxT / pET28a-GepdxT / pET28a-BcpdxT / pET28a-Sc pdxT / pET28a-MypdxT / pET28a-GepdxS / pET28a-BcpdxS / pET28a-ScpdxS / pET28a-MypdxS / pET28a-PfpdxS.

[0130] 2. Collect bacteria and obtain pure enzymes

[0131] (1) First, strains E. coli BL21(DE3)pET28a-StpdxT / pET28a-BlglsA / pET28a-PfpdxT / pET28a-GepdxT / pET28a-BcpdxT / pET28a-ScpdxT / pET28a-MypdxT / pET28a-GepdxS / pET28a-BcpdxS / pET28a-ScpdxS / pET28a-MypdxS / pET28a-PfpdxS were inoculated into liquid LB medium at a 1% inoculum and cultured at 37°C and 200 rpm for 24 h. Then, they were transferred to TB medium at a 5% inoculum and cultured at 37°C and 200 rpm until OD280 was reached. 600 When the concentration of the bacteria is 0.6 to 0.8, add IPTG to a final concentration of 0.5 mM for induction. Then, continue to culture at 37°C and 200 rpm for 16-18 h. Centrifuge at 4°C and 5000 rpm for 5 min. Store the collected excess bacteria at -80°C.

[0132] (2) The bacterial cells collected after induction expression obtained in step (1) were washed three times with 100mM PBS solution (pH 7.4), and then centrifuged at 4℃ and 7000rpm for about 15min to collect the bacterial cells. 1g of bacterial cells were weighed and about 10mL of binding solution A (20mM sodium phosphate, 0.5mM NaCl, 20mM imidazole, 1% glycerol, and pH adjusted to 7.4 with hydrochloric acid) was added. After resuspending the bacterial cells, they were sonicated for about 10min. The lysate was centrifuged at 4℃ and 7000rpm for about 10min. The supernatant was filtered through a 0.22um microporous membrane to obtain crude enzyme solution.

[0133] (3) Equilibrate the nickel ion affinity chromatography column with binding buffer A (approximately 10 times the column volume); pour the crude enzyme solution prepared above into the column until the liquid flows out completely; first rinse the column with binding buffer A to remove impurities, then add elution buffer C (20 mM sodium phosphate, 0.5 mM NaCl, 50 mM imidazole, pH 7.4) to wash the column until the liquid flows out, and finally add elution buffer B (20 mM sodium phosphate, 0.5 mM NaCl, 500 mM imidazole, pH 7.4) to collect the target protein.

[0134] 3. Determination of enzyme activity and enzyme kinetic parameters

[0135] (1) Determination of glutaminase activity and enzyme kinetic parameters—determination of coupled enzymes

[0136] PdxT activity was determined by a coupling reaction with glutamate dehydrogenase (NCBI Gene ID: 946802). In this assay, glutamine is hydrolyzed by PdxT to glutamate, which is then converted to α-ketoglutarate by glutamate dehydrogenase, simultaneously reducing 3-acetylpyridinium adenine dinucleotide (APAD), an analog of NAD, which alters the unfavorable equilibrium of the glutamate dehydrogenase reaction. This reduction is observed as an increase in absorbance at 363 nm. Samples were measured at 37 °C, with a total reaction volume of 300 μL containing 50 mM Tris-Cl buffer (pH 8.0), 0.5 mM APAD, 7 units of glutamate dehydrogenase, and 10 mM glutamine. 4 μM PdxT was used to determine the kinetic constant. Protein concentration was determined using Bradford reagent (Pierce) with bovine serum albumin as a standard.

[0137] (2) Determination of PLP enzyme activity and enzyme kinetic parameters

[0138] The activity of PdxS was monitored by UV-Vis spectrophotometry. A maximum value at 414 nm indicated the enzymatic formation of a Schiff base, likely resulting from the reaction product and the primary amine in the Tris buffer (2-amino-2-hydroxymethyl-1,3-propanediol) used in the assay. The reaction was carried out in 50 mM Tris-Cl buffer (pH 8.0) at 37 °C, containing 40 μM of isolated PdxS and 0.5 mM of substrate: ribose-5-phosphate and DL-glyceraldehyde-3-phosphate (1 mM). 10 mM glutamine or 10 mM ammonium sulfate was added as a nitrogen source.

[0139] 4. Results

[0140] Table 1 Kinetic parameters of glutaminase from different sources

[0141]

[0142] Table 2 Kinetic parameters of PLP synthase from different sources

[0143]

[0144] Therefore, ScpdxS and MypdxT were selected for subsequent experiments.

[0145] Example 3: Construction of recombinant Escherichia coli lysWT-3

[0146] 1. Construction of recombinant plasmid pEM-cadA-pdxS / T

[0147] (1) Using SnpdxS U2 and SnpdxS D2 as primers, the SnpdxS gene (nucleic acid sequence as shown in SEQ ID NO.12) was used as a template to amplify and obtain the SnpdxS fragment.

[0148] ScpdxS U2:

[0149] AGTCTGGTAGATCTGGATCCTTGACAATTAATCATCGGCTCGTATAAT

[0150] GTG

[0151] TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGAATTCATGACTGGAGAAGACTTTAAGATCA;

[0152] ScpdxS D2:

[0153] GCTACCGCTACCGCTACCCCACCCAATTTCGGAAAGTCTTA;

[0154] (2) Using MypdxT U2 and MypdxT D2 as primers, MypdxT fragments were amplified using the MypdxT gene (nucleic acid sequence as shown in SEQ ID NO.9) with optimized artificially synthesized codons as templates.

[0155] MypdxT U2:

[0156] GGTAGCGGTAGCGGTAGCGGATCCGTAAGTGTACCCAG;

[0157] MypdxT D2:

[0158] GGCAGCAGGTGGTGCTCGAGGTGGTGCTCGAGTTACG;

[0159] (3) The linearized vector pEM-cadA was obtained by reverse amplification of pEM-cadA U2 and pEM-cadA D2.

[0160] pEM-cadA U2: CACCACCTGCTGCCAC;

[0161] pEM-cadA D2: AGCAAATAAATTTTTTATGACATATGGGTGGCAGCAG;

[0162] (4) Connect the linearized vector obtained in step (3) with the gene fragments pdxS and pdxT obtained in steps (1) and (2) to obtain the recombinant plasmid pEM-cadA-pdxS / T.

[0163] 2. Construction of recombinant strains

[0164] The recombinant plasmids pEM-cadA-pdxA and pEM-cadA-pdxS / T were transformed into competent cells of Escherichia coli MG1655. The correct recombinant strain was obtained on LB agar plates containing 100 mg / L ampicillin and named lysWT-3.

[0165] Example 4: Synthesis of 1,5-Pentanediamine by Fermentation

[0166] First, Escherichia coli lysWT-1, lysWT2, and lysWT-3 were selected and activated on slant solid culture medium for 24 hours.

[0167] Secondly, the activated Escherichia coli lysWT-1, lysWT2, and lysWT-3 were inoculated into the primary seed culture medium and cultured at 37°C for 7.5-8 hours. Then, the activated primary seed culture medium was transferred to the secondary seed culture medium at an inoculation rate of 10% and cultured at 37°C for 14-16 hours. Finally, the activated secondary seed culture medium was transferred to the fermentation medium at an inoculation rate of 15%-16% and cultured at 37°C.

[0168] Finally, in the initial stage of cultivation, IPTG was added at a final concentration of 0.42 mmol / L to induce the expression of lysine decarboxylase, which catalyzes the synthesis of 1,5-pentanediamine from lysine. The fermentation conditions were: 37±1℃, 190 rpm, pH controlled at 6.6-6.7, residual sugar controlled at 0-10 g / L, ammonia nitrogen content controlled at 0.15%-0.18%, and the fermentation cycle was 48 h.

[0169] After fermentation, the sample was centrifuged at 12000 rpm for 10 min at 4 °C, and the supernatant was collected. The production of 1,5-pentanediamine and lysine was detected by high-performance liquid chromatography (HPLC). The detection conditions were as follows: L-lysine and 1,5-pentanediamine were first derivatized with DEEMM. The derivatization system consisted of 75 μL of reaction mixture sample, 4.5 μL of DEEMM, 70.5 μL of distilled water, 150 μL of 100% methanol, and 450 μL of 50 mmol / L borate buffer (pH 9.0). The derivatized mixture was vigorously mixed in a vortex mixer and then heated at 70 °C for 2 h to remove excess DEEMM and byproducts. Subsequently, the sample was centrifuged at 10000 rpm for 5 min, filtered through a 0.22 μm membrane, and then analyzed by HPLC (SB-C18 column). The column temperature was set at 35℃, the injection volume was 10 μL, and the mobile phase consisted of 100% acetonitrile (A) and 25 mmol / L sodium acetate aqueous solution (pH 4.8) (B). The flow rate was 1 mL / min, and the solvent gradient was as follows: 0–2 min, 20%–25% A; 2–20 min, 25%–60% A; 20–25 min, 60%–20% A. The actual concentrations of each component were calculated based on the standard curve.

[0170] The results showed that: (1) the maximum OD of strains lysWT-1, lysWT-2, and lysWT-3 was higher than that of strains lysWT-1, lysWT-2, and lysWT-3. 562 The values ​​were 19.34, 32.19, and 31.37, respectively. Increasing the intracellular supply of PLP increased the maximum OD by approximately 64.32%. Figure 1As shown. (2) The lysWT-1, lysWT-2, and lysWT-3 strains produced 1,5-pentanediamine at concentrations of 1.78 g / L, 5.83 g / L, and 7.77 g / L after 48 hours of shake-flask fermentation, with conversion rates (1,5-pentanediamine production / glucose consumption) of 7.5%, 18.67%, and 24.00%, respectively. Figure 2 (3) Increased PLP supply also significantly increased the synthesis of precursor lysine. The lysine accumulation of LysWT-1, LysWT-2, and LysWT-3 was 0.095 g / L, 18.66 g / L, and 10.48 g / L, respectively. LysWT-2 and LysWT-3 were 195.42% and 109.32% higher than LysWT-1, respectively. Figure 3 As shown.

[0171] Example 5: Enhancing PLP Intracellular Supply - Optimizing Promoters

[0172] The specific method for de novo synthesis of 1,5-pentanediamine in this embodiment is the same as in Example 4, except that the promoters are changed so that the promoters of the two PLP synthesis modules are P T5 P Tac P Trc Nine combined strains were obtained: LysWT-5+5, LysWT-5+C, LysWT-5+A, LysWT-A+5, LysWT-A+C, LysWT-A+A, LysWT-C+5, LysWT-C+C, and LysWT-C+A. With other reaction conditions unchanged, the concentrations of 1,5-pentanediamine in the reaction solution after 48 hours were 8.17 g / L, 6.45 g / L, 10.00 g / L, 4.63 g / L, 6.00 g / L, 5.33 g / L, 8.48 g / L, 6.61 g / L, and 9.58 g / L, respectively. Figure 4 ).

[0173] Example 6 Fermentation conditions - Shake flask level optimization of induction time

[0174] The specific method for de novo synthesis of 1,5-pentanediamine in this embodiment is the same as that in the LysWT-5+A group in Example 5, except that the time of IPTG addition is changed so that the induction start time is changed to fermentation at 0h, 3h, 8h, and 16h, respectively. Other reaction conditions remain unchanged. After 48h, the concentrations of 1,5-pentanediamine in the reaction solution are 10.00g / L, 11.23g / L, 7.23g / L, and 6.33g / L, respectively. Figure 5 ).

[0175] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A method for increasing the yield of 1,5-pentanediamine synthesized de novo by recombinant Escherichia coli, characterized in that, The method involves overexpressing the lysine decarboxylase gene shown in SEQ ID NO.1, the 4-phosphohydroxy-L-threonine dehydrogenase gene shown in SEQ ID NO.2, the glutaminase subunit gene shown in SEQ ID NO.9, and the PLP synthase subunit gene shown in SEQ ID NO.12 in an Escherichia coli host.

2. The method according to claim 1, characterized in that, Using promoter P J23108 The expression of the 4-phosphohydroxy-L-threonine dehydrogenase gene, the glutaminase subunit gene, and the PLP synthase subunit gene was initiated, respectively.

3. The method according to claim 1, characterized in that, The expression of the 4-phosphate hydroxy-L-threonine dehydrogenase gene was initiated using a first promoter, and the expression of the glutaminase subunit gene and the PLP synthase subunit gene was initiated using a second promoter. The first promoter was selected from P... T5 or P Trc The second promoter is selected from P T5 or P Tac .

4. The method according to claim 1, characterized in that, The method involves fermentation production using recombinant Escherichia coli, and the fermentation process includes the following steps: adding an inducer when the strain is inoculated into the fermentation medium for 0-3 hours.

5. The method according to claim 4, characterized in that, Fermentation conditions are: 36-38℃, 170-220 rpm, pH controlled at 6.6-6.7, residual sugar controlled at 0-10 g / L, and ammonia nitrogen content controlled at 0.15%-0.18%.

6. The method according to claim 1, characterized in that, by E. coli MG1655 is the starting strain.

7. A recombinant strain of Escherichia coli, characterized in that: The recombinant Escherichia coli strain overexpresses the lysine decarboxylase gene shown in SEQ ID NO.1, the 4-phosphohydroxy-L-threonine dehydrogenase gene shown in SEQ ID NO.2, the glutaminase subunit gene shown in SEQ ID NO.9, and the PLP synthase subunit gene shown in SEQ ID NO.12 in the Escherichia coli host.

8. The recombinant Escherichia coli according to claim 7, characterized in that, The expression of the 4-phosphate hydroxy-L-threonine dehydrogenase gene was initiated using a first promoter, and the expression of the glutaminase subunit gene and the PLP synthase subunit gene was initiated using a second promoter. The first promoter was selected from P... T5 or P Trc The second promoter is selected from P T5 or P Tac .

9. The method for constructing recombinant Escherichia coli according to claim 7 or 8, characterized in that, Includes the following steps: S1. The lysine decarboxylase gene shown in SEQ ID NO.1 and the 4-phosphate hydroxy-L-threonine dehydrogenase gene shown in SEQ ID NO.2 are ligated and inserted into the vector pEM to obtain the recombinant plasmid pEM- cadA-pdxA ; S2. The lysine decarboxylase gene shown in SEQ ID NO.1, the glutaminase subunit gene shown in SEQ ID NO.9, and the PLP synthase subunit gene shown in SEQ ID NO.12 are ligated and inserted into the vector pEM to obtain the recombinant plasmid pEM- cadA-pdxS / T ; S3, recombinant plasmid pEM- cadA-pdxA and pEM- cadA-pdxS / T The recombinant Escherichia coli was constructed by transforming it into an Escherichia coli host.

10. The use of the recombinant Escherichia coli according to claim 7 or 8 in the preparation of products containing 1,5-pentanediamine.

Images