Mercury ion detection probe, kit and mercury ion detection method based on CRISPR-Cas12a enzyme

Abstract

The present invention relates to a mercury ion detection probe, a kit and a mercury ion detection method based on CRISPR-Cas12a enzyme, and belongs to the technical field of heavy metal detection. The mercury ion detection probe group based on CRISPR-Cas12a enzyme provided by the present invention includes crRNA probe, DNA probe, mercury ion recognition probe TB and fluorescent probe AF. The crRNA probe, DNA probe and CRISPR-Cas12a enzyme can form a CRISPR-Cas12a protein complex, and the mercury ion recognition probe TB hybridizes with the fluorescent probe AF to form a double-stranded DNA probe TB-AF. When there is no mercury ion, since the TB-AF probe exists in a double-stranded form, the CRISPR-Cas12a protein complex cannot cut the double-stranded form of TB-AF, and the entire detection system has no fluorescence. When mercury ions are present, the mercury ion recognition probe TB forms 6 T-Hg 2+ The dimer of the CRISPR-Cas12a structure releases a single-stranded fluorescent probe AF, and the CRISPR-Cas12a protein complex can cut the single-stranded fluorescent probe AF, and the system produces fluorescence. By detecting the fluorescence intensity, the detection of mercury ions is achieved. The probe and kit provided by the present invention can achieve ultra-high sensitivity detection of mercury ions in water samples and serum samples, with strong specificity and high stability, and are not affected by other metal ions.

Description

Technical Field

[0001] The present invention relates to the technical field of heavy metal detection, and in particular to a mercury ion detection probe, a kit and a mercury ion detection method for a CRISPR-Cas12a enzyme. Background Art

[0002] Mercury, commonly known as quicksilver, is a heavy metal poison that can accumulate in organisms and damage the nervous system, cerebellum, brain and other organs, leading to fetal malformation and development problems. Currently, the detection of mercury in laboratories is mostly based on physical and chemical detection methods such as cold atomic absorption spectroscopy, hydride generation atomic fluorescence spectrometry, inductively coupled plasma mass spectrometry, etc. These methods require large instruments and equipment, are expensive, and the detection process is complicated, which is not conducive to timely on-site detection. In recent years, there have been some reports on metal ion detection based on the cleavage activity of CRISPR-Cas proteins (J.Am.Chem.Soc., 2020, 142, 207-213; ACS Sens.2020, 5, 970-977; Chem.Sci.2021, 12, 11740-11747). Most of them use aptamers or DNAzymes to selectively bind to metal ions to activate the cleavage activity of the CRISPR-Cas protein complex to achieve the purpose of detection. However, the screening of high-affinity aptamers and DNAzymes is a time-consuming and laborious process, and low-affinity aptamers and DNAzymes are prone to false positives. At present, there are relatively few reports on the use of CRISPR-Cas proteins for the detection of mercury ions. Summary of the invention

[0003] The present invention provides a mercury ion detection method based on CRISPR-Cas12a protein, which does not rely on nucleic acid aptamers or deoxyribozymes to activate the cutting activity of CRISPR-Cas12a protein, but utilizes a probe with a fluorescent label to identify mercury ions, releases the fluorescent probe when mercury ions are present, and CRISPR-Cas12a protein cuts the fluorescent probe, and the system generates fluorescence, and when mercury ions are not present, the fluorescent probe cannot be released, the CRISPR-Cas12a protein cannot cut the fluorescent probe, and the system generates no fluorescence.

[0004] The object of the present invention is to provide a mercury ion detection probe, a kit and a mercury ion detection method based on CRISPR-Cas12a protein. The probe and the kit provided by the present invention can realize ultra-high sensitivity detection of mercury ions in water samples and serum samples, with strong specificity and high stability, and are not affected by other metal ions.

[0005] The present invention provides a mercury ion detection probe group based on CRISPR-Cas12a protein, including a crRNA probe, a DNA probe, a mercury ion recognition probe TB, and a fluorescent probe AF.

[0006] The 5' end of the crRNA probe is a neck ring structure, and the 20 bases at the 3' end are complementary to the 20 bases downstream of the positive strand 5'-TTTC-3' of the DNA probe. The DNA probe is a 100bp artificial synthetic sequence with no special structure. The mercury ion recognition probe TB is 6 consecutive T bases, and the fluorescent probe AF is 6 consecutive A bases.

[0007] The 5' end of the fluorescent probe AF contains a FAM fluorescent group, and the 3' end contains a BHQ fluorescent quenching group. In the presence of mercury ions, the six consecutive T bases of the mercury ion recognition probe TB can form a T-Hg 2+ -T structure.

[0008] Preferably, the sequence of the crRNA probe is as shown in SEQ ID NO.1.

[0009] Preferably, the sequence of the mercury ion recognition probe TB is as shown in SEQ ID NO.2.

[0010] Preferably, the sequence of the fluorescent probe AF is as shown in SEQ ID NO.3.

[0011] The present invention also provides a mercury ion detection kit based on the probe group described in the above technical solution, wherein the kit comprises the probe group of the above technical solution and a CRISPR-Cas12a protein.

[0012] The present invention also provides a method for detecting mercury ions based on the probe group described in the above technical solution or the kit described in the above technical solution, comprising the following steps:

[0013] (1) The crRNA probe and CRISPR-Cas12a protein were mixed in Tris-HCl buffer, incubated at 37° C. for 3 to 5 minutes, and then the DNA probe was added and incubated for 3 to 5 minutes for later use.

[0014] (2) The single-stranded DNA mercury ion recognition probe TB and the single-stranded fluorescent probe AF are mixed in a Tris-HCl buffer and incubated at 37° C. for 3 to 5 minutes to form a TB-AF double-stranded DNA probe.

[0015] (3) Mixing the product of step (2) with mercuric ions and incubating at 37° C. for 3 to 5 minutes.

[0016] (4) After mixing the product of step (1) and the product of step (3), the absorbance value is detected under fluorescence.

[0017] Preferably, the concentration of the crRNA probe in the reaction system of step (1) is: 0.10-0.5 μM; the concentration of CRISPR-Cas12a protein is: 0.10-0.5 μM, and the ratio of crRNA probe concentration to CRISPR-Cas12a protein concentration is 1: (1-2).

[0018] Preferably, in step (2), the concentration ratio of the single-stranded mercury ion recognition probe TB to the single-stranded fluorescent probe AF in the system is 1:(1-2).

[0019] Preferably, the fluorescence value detection in step (3) is performed at a wavelength of 490 nm.

[0020] The present invention provides a mercury ion detection kit based on CRISPR-Cas12a protein. The kit provided by the present invention is composed of CRISPR-Cas12a protein, crRNA probe, DNA probe, mercury ion recognition probe TB and fluorescent probe AF. CRISPR-Cas12a protein can be incubated with crRNA and DNA probe in advance, and the three form a CRISPR-Cas12a protein complex, which has the ability to cut single-stranded DNA. The mercury ion recognition probe TB contains 6 consecutive T bases, and the fluorescent probe AF contains 6 consecutive A bases and has a fluorescent label at the 5' end and a quenching label at the 3' end. The mercury ion recognition probe TB hybridizes with the fluorescent probe AF to form a double-stranded DNA probe TB-AF (1) When there is no mercury ion, since the TB-AF probe exists in a double-stranded form, the CRISPR-Cas12a protein complex cannot cut the double-stranded form of TB-AF, and no fluorescence is generated in the entire detection system. (2) When mercury ions are present, the mercury ion recognition probe TB forms 6 T-Hg 2+ -T structure dimer, releasing single-stranded fluorescent probe AF, CRISPR-Cas12a protein complex can cut single-stranded fluorescent probe AF, and the system produces fluorescence. (3) The intensity of fluorescence generated in the detection system is proportional to the concentration of mercury ions, that is, the fluorescence value of the system is high when the mercury ion concentration is high, and the fluorescence value of the system is low when the mercury ion concentration is low. The probe group provided by the present invention can achieve ultra-high sensitivity detection of mercury ions in water samples and serum samples, with strong specificity and high stability, and is not affected by other metal ions. The experimental results show that the detection limit of the probe of the present invention for detecting mercury ions in water samples is 0.01nmol / L, and the detection limit of mercury ions in serum samples is 0.5nmol / L, with high sensitivity and specificity, and is not affected by Pb 2+ 、Cd 2+ , Ca 2+ 、Zn 2+ 、Co 2+ , Cu2+ 、Ni 2+ , Fe 2+ The influence of metal ions. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the mercury ion detection method based on CRISPR-Cas12a provided by the present invention.

[0022] Figure 2 This is a graph showing the results of detecting different concentrations of mercury ions in water samples provided in Example 2 of the present invention.

[0023] Figure 3 This is a result diagram of different concentrations of mercury ions in serum samples provided in Example 3 of the present invention.

[0024] Figure 4 This is a graph showing the results of detecting other different metal ions provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0025] The present invention provides a mercury ion detection probe group based on CRISPR-Cas12a protein, comprising a crRNA probe, a DNA probe, a mercury ion recognition probe TB and a fluorescent probe AF.

[0026] The 5' end of the crRNA probe is a stem-loop structure, and the 20 bases at the 3' end are complementary to the 20 bases downstream of the positive strand 5'-TTTA-3' of the DNA probe.

[0027] In the present invention, the sequence of the crRNA probe is as shown in SEQ ID NO.1: 5'-UAAUUUCUACUAAGUGUAGAUACAAGTGGTAAGTTCCGGTC-3', wherein the bold portion sequence (UAAUUUCUACUAAGUGUAGAU) is a stem-loop structure forming sequence, and the 3' end (ACAAGTGGTAAGTTCCGGTC) sequence is a 20 base complementary sequence downstream of the positive chain 5'-TTTA-3' in the DNA probe, so that the crRNA can recognize and bind to the DNA probe.

[0028] The mercury ion recognition probe TB is a single-stranded DNA composed of 6 consecutive T bases; the fluorescent probe AF is a single-stranded DNA composed of 6 consecutive A bases, the 5' end of the fluorescent probe AF contains a FAM fluorescent marker, and the 3' end contains a BHQ fluorescent quenching marker; the T base can form a T-Hg complex with the mercury ion in the presence of mercury ions. 2+ -T structure.

[0029] In the present invention, the sequence of the mercury ion recognition probe TB is shown in SEQ ID NO.2: 5'-TTTTTT-3', and the sequence of the fluorescent probe AF is shown in SEQ ID NO.3: 5'-FAM-AAAAAA-BHQ-3'. In the present invention, the mercury ion recognition probe TB can form T-Hg with mercury ions in the presence of mercury ions. 2+ -T structure, when the fluorescent probe AF is cut, the fluorescent label and the quenching label are separated, and fluorescence can be generated.

[0030] The method for preparing the probe of the present invention is not particularly limited, and the probe can be synthesized by entrusting a biological company familiar to those skilled in the art.

[0031] The present invention also provides a mercury ion detection kit based on the probe group described in the above technical solution, the kit comprising the probe group described in the above technical solution and CRISPR-Cas12a protein. In the present invention, the kit also preferably includes Tris-HCl buffer, which is used as a reaction solvent.

[0032] The present invention also provides a method for detecting mercury ions based on the probe set described in the above technical solution or the kit described in the above technical solution, comprising the following steps:

[0033] (1) The crRNA probe and CRISPR-Cas12a protein were mixed in Tris-HCl buffer, incubated at 37° C. for 3 to 5 minutes, and then the DNA probe was added and incubated for 3 to 5 minutes for later use.

[0034] (2) The single-stranded DNA mercury ion recognition probe TB and the single-stranded fluorescent probe AF are mixed in a Tris-HCl buffer and incubated at 37° C. for 3 to 5 minutes to form a TB-AF double-stranded DNA probe.

[0035] (3) Mix the product of step (2) with mercuric ions and incubate at 37° C. for 3 to 5 minutes

[0036] (4) After mixing the product of step (1) and the product of step (3), the absorbance value is detected under fluorescence.

[0037] In the present invention, the crRNA and CRISPR-Cas12a proteins are mixed in a Tris-HCl buffer solution, incubated at 37°C for 3 to 5 minutes, and then a DNA probe is added. The concentration of the crRNA probe in the reaction system of the present invention is: 0.10 to 0.5 μM, more preferably 0.2 μM; the CRISPR-Cas12a protein concentration is: 0.10 to 0.5 μM, more preferably 0.2 μM. The ratio of the crRNA probe concentration to the CRISPR-Cas12a protein concentration is 1: (1 to 2), more preferably 1: 1. The concentration ratio of the single-stranded mercury ion recognition probe TB to the single-stranded fluorescent probe AF in the system is: 1: 1. The concentration of the Tris-HCl buffer described in the present invention is preferably 50 mM, the pH value is preferably 8.0, and preferably comprises 50 mM potassium acetate, 10 mM magnesium acetate, and 1 mM dithiothreitol.

[0038] In the present invention, the concentration of the TB-AF probe in the system is 0.50-2.0 μM, more preferably 1.0 μM.

[0039] In the present invention, the role of incubation at 37° C. for 3 to 5 minutes is to enable the CRISPR-Cas12a protein to bind to the crRNA and form a complex in advance, which is conducive to the rapid reaction and prevents the degradation of crRNA.

[0040] The purpose of adding the DNA probe and incubating at 37° C. for 3 to 5 minutes in the present invention is to allow the complex of CRISPR-Cas12a and crRNA to bind to and recognize the DNA probe, forming a complex that can exert cleavage activity.

[0041] In the present invention, the detection method preferably detects a sample having a mercury ion concentration between 0.001 nmol and 5 nmol.

[0042] In the present invention, the concentration of the CRISPR-Cas12a protein in the detection system is 0.10 to 0.5 μM, more preferably 0.2 μM; the total volume of the detection system is 20 μL to 50 μL, more preferably 35 μL.

[0043] The types of samples to be tested in the present invention include water samples and serum samples. In the present invention, the water samples and serum samples are preferably filtered before testing, and the filtration is preferably filtered using a 0.22 μm filter membrane. After filtering, the present invention preferably stores the samples at 4°C.

[0044] The principle diagram of the mercury ion detection method based on CRISPR-Cas12a in the present invention is as follows Figure 1As shown. The principle of mercury ion detection in the present invention is as follows: CRISPR-Cas12a protein can form a protein complex with crRNA probe and DNA probe, and the complex has the characteristic of cutting single-stranded mercury ion recognition probe. When mercury ions exist in the detection system, mercury ions combine with mercury ion recognition probe TB to form T-Hg 2+ -T structure, releasing the fluorescent probe AF. At this time, the CRISPR-Cas12a protein complex can cut the fluorescent probe AF, so that the fluorescent group and the quenching group labeled at both ends of the fluorescent probe are separated, and the system produces fluorescence. When there is no mercury ion in the detection system, the mercury ion recognition probe TB forms a double-stranded DNA with the fluorescent probe AF, and the CRISPR-Cas12a protein complex cannot cut the TB-AF probe, and the system does not produce fluorescence. The fluorescence value can be detected under 490nm wavelength light or observed by the naked eye.

[0045] After the cleavage reaction is completed, the fluorescence intensity of the detection system is detected. The detection of the present invention preferably detects the fluorescence value at a wavelength of 490nm.

[0046] The detection method and detection system provided by the present invention are very simple, comprising only a TB-AF probe and a CRISPR-Cas12a protein complex, and can achieve ultra-high sensitivity detection of mercury ions in water samples and serum samples. The detection limit of mercury ions in water samples is 0.01nmol / L, and the detection limit of mercury ions in serum is 0.5nmol / L. The mercury ion detection technology described in the present invention has good specificity, and other common metal ions (Pb 2+ 、Cd 2+ , Ca 2+ 、Zn 2+ 、Co 2+ , Cu 2+ 、Ni 2+ , Fe 2+ ) has little effect on detection when it coexists with mercury ions.

[0047] The following is a further detailed introduction to a mercury ion detection probe group, a kit and a mercury ion detection method based on CRISPR-Cas12a described in the present invention in conjunction with specific examples. The technical scheme of the present invention includes but is not limited to the following examples.

[0048] Example 1

[0049] Design of crRNA probe, DNA probe, mercury ion recognition probe TB and fluorescent probe AF

[0050] The sequence structure of the crRNA probe is as follows (5'-3'):

[0051] 5'- UAAUUUCUACUAAGUGUAGAUACAAGTGGTAAGTTCCGGTC-3'

[0052] The bold underlined sequence (UAAUUUCUACUAAGUGUAGAU) is the stem-loop part of crRNA, which is related to the formation of a complex between crRNA and CRISPR-Cas12a protein; the sequence without bold underlined part (ACAAGTGGTAAGTTCCGGTC) is the 20 base complementary sequence downstream of crRNA and the 5'-TTTA-3' of the positive strand in the DNA probe, and this sequence is related to the recognition of the DNA probe by crRNA.

[0053] The DNA probe sequence structure is as follows (5'-3'):

[0054] 5'-AATGCACTGGTTTAGCTTGGGAATGGTGGAGAACGGTAATTGAT GACCGGAACTTACCACTTGT GAAAAATAGAAATATCTCCATCTGGGGCACCACGCTTTATCCGAAAT-3'

[0055] The bold sequence (GACCGGAACTTACCACTTGT) is complementary to crRNA and is related to crRNA recognition of DNA probe.

[0056] The sequence structure of the mercury ion recognition probe TB is as follows (5'-3'):

[0057] 5'- TTTTTT -3'

[0058] The bold sequence (TTTTTT) can react with Hg 2+ Formation of 6 T-Hg 2+ -T structure, so that the mercury ion recognition probe TB forms T-Hg 2+ -T structure.

[0059] The sequence structure of the fluorescent probe AF is as follows (5'-3'):

[0060] 5'-FAM-AAAAAA-BHQ-3'

[0061] The FAM marker is a fluorescent marker that can show visible fluorescence at a wavelength of 490nm; the BHQ marker is a fluorescence quenching marker. In Tris-HCl buffer, the mercury ion recognition probe TB and the fluorescent probe AF can hybridize to form a TB-AF double-stranded DNA probe.

[0062] Example 2

[0063] Detection of different concentrations of mercury ions in water samples

[0064] Take a sterilized 0.2 ml centrifuge tube, add 1 μL of crRNA probe (0.5 μM) in Example 1, add 1 μL of CRISPR-Cas12a protein (0.5 μM), add 7 μL of RNase-free sterile water, and incubate at 37 ° C for 3 min; then add 1 μL of DNA probe (0.1 μM) in Example 1 and 5 μL of 50 mM Tris-HCl buffer (pH = 8.0, 50 mM CH3COOK, 10 mM (CH3COO)2Mg, 1 mM DTT) and incubate at 37 ° C for 3 min; then take out for use. Take another 0.2 ml centrifuge tube, add 10 μL of TB-AF probe (1 μM) in Example 1 and 10 μL of the sample to be tested (mercury ion concentration between 0.001 nmol / L and 5 nmol / L), incubate at 37°C for 5 min, then add 20 μL of the incubated product to the spare CRISPR-Cas12a protein complex, react at 37°C for 15 min, select the fluorescence value at a wavelength of 490 nm as the measurement value, and define ΔF 490nm =F 490nm -F0, where F 490nm is the sample measurement value, and F0 is the background value when the mercury ion concentration is 0. When the mercury ion concentration is between 0.001nmol / L and 4nmol / L, a good linear relationship is shown ( Figure 2 ), the regression equation is ΔF 490nm =551427x+68185, linear correlation coefficient R2=0.99.

[0065] Example 3

[0066] Detection of different concentrations of mercury ions in serum samples

[0067] Take 5 sterile 0.2ml centrifuge tubes, add 50μL of mercury ions of different concentrations to each tube, then add 50μL of serum without mercury ions, mix well and mark them. At this time, the mercury ion concentrations in each tube are 4nM, 2nM, 1nM, 0.5nM, 0.1nM, and 0.05nM.

[0068] Take a sterilized 0.2 ml centrifuge tube, add 1 μL of crRNA probe (0.5 μM) in Example 1, add 1 μL of CRISPR-Cas12a protein (0.5 μM), add 7 μL of RNase-free sterile water, and incubate at 37 ° C for 3 min; then add 1 μL of DNA probe (0.1 μM) in Example 1 and 5 μL of 50 mM Tris-HCl buffer (pH = 8.0, 50 mM CH3COOK, 10 mM (CH3COO)2Mg, 1 mM DTT) and incubate at 37 ° C for 3 min; then take out for use. Take another 0.2 ml centrifuge tube, add 10 μL of TB-AF probe (1 μM) in Example 1 and 10 μL of the sample to be tested (mercury ion concentration between 0.001 nmol / L and 5 nmol / L), incubate at 37°C for 5 min, then add 20 μL of the incubated product to the spare CRISPR-Cas12a protein complex, react at 37°C for 15 min, select the fluorescence value at a wavelength of 490 nm as the measurement value, and define ΔF 490nm =F 490nm -F0, where F 490nm is the sample measurement value, and F0 is the background value when the mercury ion concentration is 0. When the mercury ion concentration is between 0.05nmol / L and 4nmol / L, a good linear relationship is shown ( Figure 3 ), the regression equation is ΔF 490nm =606650x-40648, linear correlation coefficient R2=0.99.

[0069] Example 4

[0070] Analysis of the anti-interference ability of mercury ion detection probe group based on CRISPR-Cas12a

[0071] In order to test the specificity of the mercury ion detection system based on CRISPR-Cas12a protein, eight other metal ions (Pb 2+ 、Cd 2+ , Ca 2+ 、Zn 2+ 、Co 2+ , Cu 2+ 、Ni 2+ , Fe 2+ ), and the fluorescence values ​​of the systems under the same conditions were tested. 1 nM of the other metal ions mentioned above were added to the system to react with the TB-AF probe, and then the reaction solution was added to the CRISPR-Cas12a protein complex to react. The detection conditions were the same as those in Example 2 and Example 3. The fluorescence value of the system did not change significantly compared with the blank (such as Figure 4 ), while the positive control Hg 2+ Fluorescence visible to the naked eye.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and modifications without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A mercury ion detection kit for CRISPR-Cas12a enzyme, characterized in that, Including CRISPR-Cas12a enzyme, crRNA probe, DNA probe, mercury ion recognition probe TB and fluorescent probe AF; The 5' end of the crRNA probe is a stem-loop structure, and the 20 bases at the 3' end are complementary to the 20 bases downstream of the positive strand 5'-TTTA-3' of the DNA probe. The DNA probe is a 111bp artificially synthesized sequence with no special structure. The mercury ion recognition probe TB is a single-stranded DNA composed of 6 consecutive T bases; the fluorescent probe AF is a single-stranded DNA composed of 6 consecutive A bases; The 5' end of the fluorescent probe AF contains a FAM fluorescent group, and the 3' end contains a BHQ fluorescent quenching group; under the condition of the presence of mercury ions, the six consecutive T bases of the mercury ion recognition probe TB can form a T-Hg 2+ -T structure.

2. The mercury ion detection kit for CRISPR-Cas12a enzyme according to claim 1, characterized in that The sequence of the crRNA probe is shown in SEQ ID NO.

1.

3. The mercury ion detection kit for CRISPR-Cas12a enzyme according to claim 1, characterized in that The 111 bp artificially synthesized sequence is shown as SEQ ID NO.4.

Images