A molecular beacon probe and kit for detecting isoniazid-resistant Mycobacterium tuberculosis

Abstract

The present invention provides a molecular beacon probe and a kit thereof for detecting isoniazid-resistant Mycobacterium tuberculosis. The molecular beacon probe is composed of a single-stranded nucleic acid molecule labeled with a fluorescent excitation group and a quenching group, wherein the fluorescent excitation group is selected from any three of FAM, VIC, TEXRED, CY5, JOE, NED, TET, HEX, and TAMARA; and the fluorescent quenching group is selected from BHQ1, BHQ2, and / or TAMARA. The detection kit provided by the present invention rationally distributes primers and probes to two reaction systems, effectively avoiding mutual interference during the PCR reaction process, and at the same time has high sensitivity and specificity to pathogens, reduces the cost of detecting isoniazid resistance of Mycobacterium tuberculosis, improves detection efficiency and accuracy, and is conducive to rapid and accurate clinical diagnosis.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic microorganisms, in particular to a molecular beacon probe and a kit thereof for detecting isoniazid-resistant Mycobacterium tuberculosis. Background Art

[0002] The treatment of tuberculosis requires long-term use of multiple drugs, but Mycobacterium tuberculosis strains can develop resistance to one or more drugs and are difficult to cure. The four common first-line drugs used in anti-tuberculosis treatment are isoniazid (INH), rifampicin (RIF), ethambutol (EMB), and pyrazinamide (PZA). The mechanism of isoniazid resistance is relatively complex. Several genes related to the formation of active intermediates in the metabolism of isoniazid in vivo have been found. Among them, mutations in the catalase-peroxidase encoding gene katG and the enoyl reductase encoding gene inhA and the oxyR-ahpC spacer (i.e., the ahpC promoter region) involved in mycobacterial biosynthesis are the main mechanisms for the generation of INH resistance in Mycobacterium tuberculosis. By detecting the isoniazid resistance mutation region of Mycobacterium tuberculosis, the resistance of Mycobacterium tuberculosis to isoniazid can be quickly and accurately detected in nucleic acids prepared from the sputum of suspected resistant patients. This test allows doctors to make key patient management decisions about treatment in outpatient clinics.

[0003] Multiplex fluorescence quantitative PCR is a multiplex test developed based on real-time fluorescence quantitative PCR technology, which can achieve amplification and specific detection of multiple gene sequences in the same reaction tube. In the application of clinical pathogen detection, several detection targets in the same sample can be detected simultaneously, which is conducive to rapid identification of pathogens and early, rapid and accurate treatment of diseases. The successful implementation of multiplex PCR technology requires solving the following key technical problems: (1) Since multiple sets of primer / probe combinations need to be used, cross-linking between different primers / probes needs to be avoided during design. (2) Avoid cross-homology between each set of primers / probes to other target and non-target nucleic acid sequences to prevent false positive results. (3) The optimal amplification conditions for each amplicon are different, and the reaction conditions need to be optimized to ensure that each amplicon can be successfully amplified under a single amplification condition. (4) An internal control is required as a reference to eliminate interference from nucleic acid extraction and other aspects.

[0004] At present, there is no effective method for multiplex PCR detection of isoniazid resistance of Mycobacterium tuberculosis and ensuring detection accuracy and specificity. The present invention is more sensitive than other detection principles on the market for detection of isoniazid resistance of Mycobacterium tuberculosis. Summary of the invention

[0005] The object of the present invention is to provide a molecular beacon probe for detecting isoniazid-resistant Mycobacterium tuberculosis and a detection kit thereof, so as to solve the technical problems existing in the prior art of mutual interference between primers and probes in PCR reactions and the inability to perform multiple sets of fluorescent quantitative PCR reactions simultaneously.

[0006] In order to solve the above technical problems, the present invention provides a molecular beacon probe for detecting isoniazid-resistant Mycobacterium tuberculosis, which is composed of a single-stranded nucleic acid molecule with a fluorescent excitation group labeled at one end and a fluorescent quenching group labeled at the other end;

[0007] The fluorescent excitation group of the probe is selected from FAM, VIC, TEXRED, CY5, JOE,

[0008] Any three of NED, TET, HEX, and TAMARA;

[0009] The fluorescence quenching group of the probe is selected from BHQ1, BHQ2 and / or TAMARA;

[0010] The fluorescent excitation group of the probe is labeled at the 5' end;

[0011] The fluorescent quencher group of the probe is labeled at the 3' end.

[0012] Preferably, the nucleotide sequence of the probe is as shown in Table 1:

[0013] Table 1 is the probe nucleotide sequence

[0014] SEQ ID NO.1 5'-FAM-CCGAGGCACCACCGGCATCGACCTCGG-BHQ1-3'(katG)

[0015] SEQ ID NO.2 5'-FAM-CCGAGGCACCAACGGCATCGACCTCGG-BHQ1-3'(katG)

[0016] SEQ ID NO.3 5'-HEX-CGCTCGCAAGCAAAGGTGATATATCACGAGCG-BHQ1-3'(ahp)

[0017] SEQ ID NO.4 5'-HEX-CCACGGCAC GATGGAATGTCGCC GTGG-BHQ1-3'(ahp)

[0018] SEQ ID NO.55'-HEX-CGAGGGGCGAGACGATAGGTTGTC CCTCG -BHQ1-3'(inhA)

[0019] SEQ ID NO.6 5'-HEX- CGAGGG GCGAGACGATAGGATGT CCCTCG -BHQ1-3'(inhA)

[0020] SEQ ID NO.7 5'-HEX- CGAGGG GCGAGACGATAGGCTGT CCCTCG -BHQ1-3'(inhA)

[0021] SEQ ID NO.8 5'-HEX- CGAGGG GCGAGATGATAGGTTGT CCCTCG -BHQ1-3'(inhA)

[0022] SEQ ID NO.9 5'-FAM-AACCCTGCCCAGGTC-BHQ1-3'(IS6110)

[0023] SEQ ID NO. 10 5'-TexRed-CA CGAGCT GAC GAC AGCCAT GCA-BHQ1-3' (IC).

[0024] The present invention also provides a detection kit comprising the above-mentioned molecular beacon probe, wherein the kit further comprises a container A1 and a container A2;

[0025] The container A1 contains a first set of primer-probe combinations targeting katG, ahpC and / or IC;

[0026] The container A2 contains a second set of primer-probe combinations targeting inhA, Mycobacterium tuberculosis IS6110 and / or IC.

[0027] Further, the first set of primers includes: the upstream primer and downstream primer shown by KatG, the upstream primer and downstream primer shown by ahpC, and the upstream primer and downstream primer shown by IC;

[0028] The first group of probes includes probes SEQ ID NOs: 1-4 shown in KatG and ahpC and probe NO: 10 shown in IC.

[0029] Further, the second set of primers is the upstream primer and downstream primer shown in i nhA, the upstream primer and downstream primer shown in I S6110, and the upstream primer and downstream primer shown in IC;

[0030] The second group of probes includes the probes shown in i nhA and the probes shown in IS6110 and IC SEQ ID NOs: 5-10.

[0031] Preferably, the nucleotide sequence of the primer is as shown in Table 2:

[0032] Table 2 Primers for detection of Mycobacterium tuberculosis and its resistance to isoniazid by fluorescence quantitative PCR and internal control

[0033] The sequences of the katG primers katG-F and katG-R are as follows:

[0034] SEQ ID NO.11katG-F:5'-CGTCGGCGGTCACACTTTCGGTAAGA-3'

[0035] SEQ ID NO.12katG-R:5'-TTGTCCCATTTCGTCGGGGTGTTCGT-3'

[0036] The sequences of the ahpC primers ahpC-F and ahpC-R are as follows:

[0037] SEQ ID NO.13ahpC-F:5'-ACTGCTGAACCACTGCTT-3'

[0038] SEQ ID NO.14ahpC-R:5'-CTCGTCATTGAGCTTGCT-3'

[0039] The sequences of the inhA primers inhA-F and inhA-R are as follows:

[0040] SEQ ID NO.15i nhA-F:5'-GTCACACCGACAAACGTCAC-3'

[0041] SEQ ID NO.16i nhA-R:5'-CTCCGGTAACCAGGACTGAA-3'

[0042] The sequences of the IS6110 primers IS-SF and IS-R are as follows:

[0043] SEQ ID NO.17ISFCGGTGACAAAGGCCACGTA

[0044] SEQ ID NO.18I SR GGGTAGCAGACCTCACCTATGTG

[0045] The sequences of the IC primers 1 CF and IC-R are as follows:

[0046] SEQ ID NO.19I CF TGG AGC ATG TGG TTT AAT TCGA

[0047] SEQ ID NO.20I CR TGCGGGACT TAA CCC AAC A

[0048] Furthermore, the fluorescent excitation groups of each probe in the same group correspond to a fluorescent channel in a complementary and repeated manner.

[0049] Preferably, the fluorescence channels are three channels, F1, F2, and F3, which correspond to different fluorescence excitation groups respectively.

[0050] Furthermore, the detection kit also includes an enzyme reaction solution, a positive control and a negative control.

[0051] The present invention provides a method for detecting Mycobacterium tuberculosis complex and isoniazid resistance, and the detection steps are as follows:

[0052] Step S1, obtaining a sample to be tested and extracting a nucleic acid template from the sample to be tested;

[0053] Step S2, the kit performs multiplex fluorescence quantitative PCR reaction on the sample;

[0054] Step S3, detecting the fluorescence value of the reaction, and detecting Mycobacterium tuberculosis in the sample and its resistance to isoniazid.

[0055] Preferably, the multiplex fluorescence quantitative PCR reaction is a triple fluorescence quantitative PCR reaction;

[0056] The multiplex fluorescence quantitative PCR reaction procedure is as follows:

[0057] 94°C for 10 minutes;

[0058] 94°C for 10 seconds, 71°C for 15 seconds (1°C decrease per cycle), 72°C for 15 seconds, 10 cycles;

[0059] 94°C for 10 s, 61°C for 30 s, 72°C for 15 s, 40 cycles, and the fluorescence signal was collected at 61°C.

[0060] Preferably, the sample to be tested in step S1 includes sputum and culture.

[0061] Preferably, in the multiplex fluorescence quantitative PCR reaction of step S2, the final concentration of each primer is 0.5 μM, and the final concentration of each probe is 0.3 μM.

[0062] Furthermore, in the step S2, the fluorescent label of the reaction product is distinguished to determine the fluorescent channel thereof, and further determine the corresponding detection target thereof.

[0063] Furthermore, in step S3, a positive control test and a negative control experiment are performed while the sample is being tested.

[0064] Furthermore, the detection sensitivity of the primer-probe combination to Mycobacterium tuberculosis in a sample is: Mycobacterium tuberculosis with a concentration of ≤100 bacteria / ml (preferably ≤10 bacteria / ml) can be detected.

[0065] Furthermore, the primer-probe combination has a detection sensitivity for the isoniazid resistance of Mycobacterium tuberculosis in a sample: the detectable concentration is ≤100 bacteria / ml.

[0066] By adopting the above technical solution, the present invention has the following beneficial effects:

[0067] The present invention provides a tuberculosis molecular beacon probe for detecting isoniazid-resistant tuberculosis and a detection kit thereof. On the one hand, the probe has excellent stability and specificity; on the second hand, the detection kit effectively avoids mutual interference in the PCR reaction process by reasonably allocating primers and probes to two reaction systems, so that a multiplex fluorescence quantitative PCR method can be realized; on the third hand, the present invention also finds the reaction conditions for amplification through a large number of experiments, which can quickly, sensitively and highly specifically detect Mycobacterium tuberculosis and its resistance to isoniazid. The present invention can be used for timely and accurate diagnosis of tuberculosis patients in clinic. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0069] Figure 1A is the amplification curve of katG and negative control group;

[0070] Figure 1B is the amplification curve of ahp and negative control group;

[0071] Figure 1C is the amplification curve of i nhA and negative control group;

[0072] Figure 1D is the amplification curve of IS6110 and negative control group;

[0073] Figure 1E is the amplification curve of the internal quality control and negative control group;

[0074] Figure 2A The results of the multiplex test of group A, which included katG, ahpC, and IC;

[0075] Figure 2B The results of the multiplex panel test of group B, which included i nhA, I S6110, and IC;

[0076] Figure 3 This is the ROC curve of the test results of 100 clinical samples; DETAILED DESCRIPTION

[0077] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0078] The present invention is further explained below in conjunction with specific implementation modes.

[0079] The experimental methods for which specific conditions are not indicated in the following examples are usually carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and parts by weight.

[0080] like Figure 1A -E, Example 1 is a single-plex fluorescence quantitative PCR detection of Mycobacterium tuberculosis and three drug resistance genes:

[0081] 1.1 Preparation of fluorescent quantitative PCR primer sets

[0082] The nucleic acid sequences of the Mycobacterium tuberculosis specific gene IS6110 and three genes resistant to isoniazid, namely ahpC, katG, and inhA, were obtained from GenBank for homology comparison analysis to determine the conservative sequence regions of each target, and then appropriate sequences were selected within the conservative regions to design four pairs of specific primers and nine probes using Primer 3.0 software. At the same time, one pair of primers and one probe for the internal quality control gene were designed using Primer 3.0 software.

[0083] The primer pairs and probe sequences of the specific genes of Mycobacterium tuberculosis, the three genes of isoniazid resistance and the internal quality control genes detected by fluorescence quantitative PCR are shown in Table 1.

[0084] 1.2 Preparation of DNA reference

[0085] According to the conserved sequence regions of different gene targets, five genes (IS6110, ahpC, katG, inhA, and internal quality control gene) were constructed using the PUC57 plasmid as a vector and the multiple cloning site EcoRV as the insertion point. The above plasmids were constructed into nine plasmids and one endogenous control plasmid. After each plasmid was quantified by a standard, the reference was diluted 10 times with sterile distilled water, from 5×10 4 Dilute to 5×10 1 bacteria / ml.

[0086] 1.3 Single-plex fluorescence quantitative PCR detection of DNA pathogens

[0087] Single-plex fluorescence quantitative PCR was performed to detect nine DNA genes and one internal control, using the DNA gene detection primers and probes listed in Table 1.

[0088] Single gene detection reaction system: Take 5 μl of amplicon as template (the final concentration of the template is 1×10 4 bacteria / ml, 1×10 3 bacteria / ml, 1×10 2 bacteria / ml and 1×10 1 bacteria / ml), 12.5 μl of 2x amplification buffer, a gene primer probe set (final primer concentration of 0.5 μM, final probe concentration of 0.3 uM), and supplemented with DNase / RNase-free water to a total volume of 25 μl.

[0089] The following program was run on the Shanghai Hongshi SLAN-96S real-time fluorescence quantitative PCR instrument for 9 genes and 1 internal quality control test: 94°C for 10 min; 94°C for 10 s, 71°C for 15 s (1°C decrease in each cycle), 72°C for 15 s, 10 cycles; 94°C for 10 s, 61°C for 30 s, 72°C for 15 s, 40 cycles, and fluorescence (FAM, HEX, TexRed, CY5) signals were collected at 61°C.

[0090] Results: The amplification curves of different genes detected by single-plex fluorescence quantitative PCR (molecular beacon method) are shown in Figure 1. The template concentrations were 10,000 bacteria / ml, 1,000 bacteria / ml, 100 bacteria / ml and 10 bacteria / ml, respectively. Figure 1A -E shows the detection results of katG, ahpC, i nhA, I S6110 and internal quality control, respectively.

[0091] like Figure 2A -B, Example 2 is the detection of Mycobacterium tuberculosis and isoniazid resistance gene by multiplex fluorescence quantitative PCR after optimization:

[0092] 2.1 Preparation of DNA reference material: 10 5 The concentration of each plasmid was 5×10 4 bacteria / ml, 5×10 3 bacteria / ml, 5×10 2 bacteria / ml and 5×10 1 bacteria / ml, single gene detection reaction system: take 5 μl of amplicon as template (template concentration is 1×10 4 bacteria / ml, 1×10 3 bacteria / ml, 1×10 2 bacteria / ml and 1×10 1 bacteria / ml).

[0093] 2.2 Multiplex fluorescence quantitative PCR detection of DNA pathogens

[0094] According to the classification combination of different genes, the 9 probes of 4 genes were grouped into two groups, and multiplex (triplet) fluorescence quantitative PCR was performed separately. Each group detected 2 genes and 1 internal quality control. The grouping is shown in Table 1.

[0095] Use the DNA pathogen detection primers and probes in Table 1 to prepare the following primer pairs:

[0096] Primer pairs in group A: katG, ahpC genes and internal quality control;

[0097] Primer pairs of group B: two genes, i nhA and IS6110, and internal quality control.

[0098] 5 μL of DNA sample, 12.5 μL of 2× amplification buffer and 7.5 μL of primer set mixture were added to the reaction system, wherein the concentration of each primer was 0.5 μM and the concentration of each probe was 0.3 μM, and DNase / RNase-free water was added to the total volume of 25 μL.

[0099] Four genes and one internal quality control were divided into two groups (each group was subjected to triple fluorescence quantitative PCR). Eight reaction wells (replicate wells) were required for detection. The following program was run on the Shanghai Hongshi SLAN-96S real-time fluorescence quantitative PCR instrument: 94°C for 10 minutes; 94°C for 10 seconds, 71°C for 15 seconds (1°C decrease in each cycle), 72°C for 15 seconds, 10 cycles; 94°C for 10 seconds, 61°C for 30 seconds, 72°C for 15 seconds, 40 cycles, and fluorescence (FAM, HEX, TexRed) signals were collected at 61°C.

[0100] Results: The linear graphs of multiplex fluorescence quantitative PCR (molecular beacon method) detecting multi-component amplification of different groups of genes are as follows Figure 2A -B, where the template concentration is 100 bacteria / ml. As can be seen from the figure, the gene amplification results in each group are good. This example proves that the reaction conditions constructed by the present invention can efficiently amplify four genes at the same time.

[0101] Example 3, sensitivity experiment of multiplex fluorescence quantitative PCR detection of Mycobacterium tuberculosis after optimization:

[0102] To evaluate the detection sensitivity of triple fluorescence quantitative PCR (molecular beacon method), the concentration of 5×10 5 The pathogen plasmid of each gene was 5×10 / ml as the mother solution. Two groups of mixed reference products were prepared according to the combination in Table 1. Each group contained two genes and an internal reference. The concentration of each gene plasmid was 5×10 4 bacteria / ml, and dilute the sterilized in vitro diagnostic reagent with water to the following gradient concentrations as a sensitivity reference:

[0103] 1000 bacteria / ml sensitivity reference;

[0104] 100 bacteria / ml sensitivity reference;

[0105] 10 bacteria / ml sensitivity reference;

[0106] Results: The detection Ct values ​​are shown in Table 3.

[0107] Table 3 Target pathogen sensitivity detection results

[0108]

[0109] It can be seen from the test results that the primers and probes of the present invention can simultaneously detect two genes and internal quality control in a triple quantitative PCR reaction. Among them, the minimum detection limit of IS6110 is 10 bacteria / ml, the detection limit of ahpC for isoniazid resistance gene is 100 bacteria / ml, the detection limit of katG for isoniazid resistance gene is 100 bacteria / ml, and the detection limit of inhA for isoniazid resistance gene is 100 bacteria / ml.

[0110] This example shows that the primer pairs and probe detection reagents of the present invention are highly sensitive to pathogens.

[0111] Example 4, optimized multiplex fluorescence quantitative PCR detection of clinical pathogen specificity experiment:

[0112] Preparation of specific reference materials:

[0113] In order to evaluate the detection specificity of the method, 10 verified DNA extracts were detected by the molecular beacon method of the present invention. The 10 pathogens are: Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium terrestris, Mycobacterium minor, Mycobacterium avium, Mycobacterium ulcerans, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium phlei.

[0114] Results: The specific test results are shown in Table 4. All the test results for these 10 pathogens were negative.

[0115] Table 4 Target pathogen-specific detection results

[0116]

[0117] From the above test results, it can be seen that the primer pairs and probe detection reagents corresponding to the targets of the molecular beacon method of the present invention can detect the endogenous control 16sRNA gene containing bacteria, and there is basically no Ct value for samples that do not contain the detection target, which proves that it is not easy to produce false positive results.

[0118] Example 5: 100 clinical samples were tested to further verify the accuracy of this detection method:

[0119] like Figure 3 As shown, 100 clinical samples were tested, and the Cutoff value of the kit was calculated to be 29, that is, the Ct value of the test result of the positive sample was less than 29, which was positive, and greater than 29 or no Ct value was negative.

[0120] Table 5 Specificity data

[0121] Ct value cut-off point Sensitivity 1-Specificity Specificity total 28.97 0.984 0 1.00 1.984

[0122] like Figure 3 The results show that the primer pair and probe detection reagent of the present invention can specifically detect the corresponding pathogen specimens and does not produce false positive results for other types of pathogens, which proves that the primer and probe combination of the present invention has excellent specificity.

[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A kit for detecting isoniazid-resistant Mycobacterium tuberculosis, characterized in that: The kit comprises a first set of primer-probe combinations, a second set of primer-probe combinations, a container A1 and a container A2; The container A1 contains the first set of primer-probe combinations for katG, ahpC and IC; wherein, KatG probe: 5'-FAM-CCGAGGCACCACCGGCATCGACCTCGG-BHQ1-3' 5'-FAM-CCGAGGCACCAACGGCATCGACCTCGG-BHQ1-3' katG primer: katG-F: 5'- CGTCGGCGGTCACACTTTCGGTAAGA -3' katG-R: 5'-TTGTCCCATTTCGTCGGGGTGTTCGT -3' ahpC probe: 5'-HEX- CGCTCGCAAGCAAAGGTGATATATCACGAGCG - BHQ1-3' 5'-HEX- CCACGGCAC GATGGAATGTCGCC GTGG - BHQ1-3' ahpC Primers: ahpC-F: 5'- ACTGCTGAACCACTGCTT -3' ahpC-R: 5'-CTCGTCATTGAGCTTGCT-3' IC probe: 5'-TexRed- CA CGAGCT GAC GAC AGCCAT GCA- BHQ1-3' IC Primers: IC-F TGG AGC ATG TGG TTT AAT TCGA IC-R TGCGGGACT TAA CCC AAC A The container A2 contains a second set of primer-probe combinations targeting inhA, Mycobacterium tuberculosis IS6110 and IC; wherein, inhA probe: 5’-HEX-CGAGGGGCGAGACGATAGGTTGTC CCTCG - BHQ1-3’ 5’-HEX- CGAGGG GCGAGACGATAGGATGT CCCTCG - BHQ1-3’ 5’-HEX- CGAGGG GCGAGACGATAGGCTGT CCCTCG - BHQ1-3’ 5’-HEX- CGAGGG GCGAGATGATAGGTTGT CCCTCG - BHQ1-3’ inhA Primers: inhA-F: 5'- GTCACACCGACAAACGTCAC -3' inhA-R: 5'-CTCCGGTAACCAGGACTGAA-3' IS6110 Probe: 5'-FAM-AACCCTGCCCAGGTC-BHQ1-3' IS6110 Primers: IS-F CGGTGACAAAGGCCACGTA IS-R GGGTAGCAGACCTCACCTATGTG Among them, the primers and probes for IC in the second group were the same as those in the first group.

2. The kit according to claim 1, characterized in that The fluorescent excitation group of each probe in the same group corresponds to a fluorescent channel without duplication.

3. The kit according to claim 1, characterized in that The kit also includes an enzyme reaction solution, a positive control and a negative control.

Images