Circrna circnop14 and application thereof
By discovering and validating the role of circRNA circNOP14 in 125I particle therapy, and combining it with XRCC6 to enhance the DNA damage signaling pathway, the problem of low sensitivity of liver cancer to radioactive particle therapy was solved, achieving inhibition of liver cancer cells and enhancement of radiotherapy efficacy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
- Filing Date
- 2023-09-18
- Publication Date
- 2026-07-03
AI Technical Summary
In the existing technology, liver cancer has low sensitivity to radioactive particle therapy, resulting in poor radiotherapy effects, and the role of circRNAs in the tumor microenvironment in tumor radioresistance has not been fully studied.
We discovered that circRNA circNOP14 showed significant differential expression before and after 125I particle treatment. By binding to the RBP-binding protein XRCC6, it enhanced the radiobiological effects of 125I particles. Specific methods included constructing a circNOP14 overexpression plasmid and performing functional experiments to verify its inhibitory effects on proliferation, migration, and apoptosis in liver cancer cells.
circNOP14 can enhance the radiotherapy effect of 125I particles, inhibit the growth and metastasis of liver cancer cells, induce apoptosis of liver cancer cells, and improve the local tumor control rate of radiotherapy.
Smart Images

Figure CN117224559B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more particularly to a circRNA circNOP14 and its applications. Background Technology
[0002] The liver is the largest solid organ in the human body, with a rich blood supply. The incidence of primary liver cancer and liver metastasis is relatively high. Liver cancer has low sensitivity to common treatments such as chemotherapy and radiotherapy. The ideal treatment for liver cancer is radical resection of the tumor. However, in clinical practice, liver cancer is often discovered at an advanced stage, and only 10%-15% of cases can be surgically removed.
[0003] Radioactive particle implantation is a newly emerging treatment for malignant tumors in recent years. It is characterized by its definite efficacy, minimal invasiveness, and few complications, making it particularly suitable for conservative treatment of solid tumors. It is now widely used in clinical practice. 125I particle radiotherapy is one such method. When 125I (a radioactive isotope of iodine) particles are implanted into the tumor lesion, the microparticles continuously emit gamma rays. Within the half-life of 125I, the local tissue absorbs a dose of 140-160 Gy. This low-dose, continuous irradiation effectively damages tumor cell DNA, induces apoptosis, and inhibits tumor cell proliferation and migration. The tissue half-value layer of 125I particles is 1.7 cm, and the dose rapidly decreases with distance. Therefore, the absorbed dose by normal tissues and organs is very small, achieving the goal of treating the tumor while protecting normal tissues.
[0004] However, improving the radiosensitivity of solid tumors is a challenge in clinical radiotherapy, affecting the efficacy of 125I particle therapy.
[0005] Currently, the mainstream view on tumor radioresistance is the formation of the tumor microenvironment: tumor cells secrete radiation-resistant signals (transcription factors, RNA, etc.) outside the tumor, forming a tumor microenvironment that promotes tumor progression. In recent years, exosomes, which have received considerable attention, have been confirmed as the main carriers of the pre-metastatic microenvironment. Exosomes are 30-100 nm membrane-bound vesicles secreted by cells, widely distributed in various body fluids, and are important molecules for cell-cell communication. They participate in many physiological and pathological processes through pathways such as regulating immune function and directly acting on tumor cells. Exosomes contain not only protein components but also microRNAs (miRNAs), mRNAs, long non-coding RNAs, and circular RNAs (circRNAs). circRNAs are RNAs with a circular structure, no polyA tail, and important biological functions. Their expression is cell-specific, tissue-specific, and developmental stage-specific, and they possess very stable properties, making them difficult to degrade by RNases. circRNAs participate in the regulation of multiple signaling pathways. In recent years, a large number of dysregulated circRNAs have been found in liver cancer. Studies have shown that circRNAs have significant application value in the study of liver cancer development mechanisms, clinical prediction, and the identification of therapeutic targets. This suggests that circRNAs may be a novel and promising class of biomarkers and tumor therapeutic targets, with potential value in disease diagnosis, prevention, and treatment. Although increasing research indicates that non-coding RNAs play a crucial role in the development, progression, drug resistance, and radiation resistance of malignant tumors through epigenetic regulatory mechanisms, no studies have yet reported on whether specific circRNAs are involved in tumor radioresistance.
[0006] Therefore, it is urgent to find effective solutions to improve the efficacy of brachytherapy, and it is crucial to take targeted radiosensitization measures to improve the local tumor control rate and improve patient prognosis. Summary of the Invention
[0007] To address the aforementioned problems, this invention provides a circRNA, circNOP14, and its applications. Through in-depth research into the mechanism of action of radioactive 125I particles, it was discovered for the first time that circNOP14 (hsa_circ_0006737) is one of the circRNAs with differential expression before and after 125I particle treatment. Furthermore, it was discovered for the first time that circNOP14 can inhibit liver cancer growth and metastasis and induce apoptosis; it can also enhance the radiobiological effects of 125I particles. Its mechanism of action was also discovered: circNOP14 enhances the DNA damage signaling pathway acted upon by 125I particles by binding to the RBP-binding protein XRCC6. This indicates that circNOP14 can achieve both therapeutic effects on liver cancer and radiosensitization effects on 125I particles, demonstrating broad application prospects.
[0008] This application initially collected peripheral blood samples from 12 valuable liver cancer patients before and after 125I radioactive particle therapy as research subjects. Exosomes from the patients' peripheral blood were successfully isolated, and through longRNA high-throughput sequencing and bioinformatics data analysis, 56 significantly differentially expressed lncRNAs, 405 mRNAs, and 106 circRNAs were obtained. Combined with the results of 125I particle radiation on the DNA damage response (DDR) signaling pathway, in-depth analysis of GO data revealed that circRNAs are mainly involved in regulating the DDR-mediated tumor cell apoptosis signaling pathway. To further confirm the sequencing results, we selected 10 significantly differentially expressed circRNAs in paired liver cancer tissue samples, plasma samples, and cell samples before and after radioactive particle therapy using qPCR. Among them, circRNA-NOP14 (has_circ_0006737) was significantly expressed, and RNA Scope was used to detect the expression of circRNA-NOP14 in liver cancer tissue samples. The remaining 9 circRNAs were determined by subsequent experiments to have no significant correlation with liver cancer progression, prognosis, or the efficacy of 125I particle therapy.
[0009] The human NOP14 (nucleolar protein 14, NOP14) gene is located on chromosome 4p16.317. Studies have shown that it encodes a nucleoprotein that participates in the processing and maturation of 18S ribosomal RNA precursors and the synthesis of 40S ribosomal subunits. Loss of NOP14p expression leads to a reduction in the amount of 20S and 27S A2 ribosomal RNA precursors, while increasing the levels of 35S and 23S precursor ribosomal RNAs. Further research reveals that the NOP14 protein can promote the incorporation of Noc4p into the small ribosomal subunit processing apparatus by forming the Noc4p-NOP14p complex, thereby participating in the processing and maturation of small ribosomal subunits and ribosomal RNA. NOP14 exhibits multiple mutation sites in pancreatic cancer metastases, playing a regulatory role in pancreatic cancer invasion and metastasis, and possessing prognostic value, indicating its function as an oncogene. Furthermore, studies have shown that NOP14 inhibits melanoma proliferation and metastasis through the Wnt / β-catenin pathway. Recent research has revealed that lncRNA NOP14-AS1 is significantly upregulated and NOP14 mRNA is downregulated during DNA damage, both in a p53-dependent manner, suggesting that NOP14 may be a potential therapeutic target for tumors. However, the relationship between abnormal circNOP14 expression and radiotherapy for liver cancer and liver cancer progression remains unclear and warrants further attention.
[0010] We successfully constructed a plasmid overexpressing circNOP14, and functional experiments revealed that circNOP14 inhibits the proliferation and metastasis of liver cancer cells and induces apoptosis. It has been confirmed that continuous low-dose irradiation with 125I particles within tumor cells can cause DNA damage and thus induce apoptosis. Does circNOP14 follow the same mechanism of action as 125I particles? We analyzed the changes in genes in the DNA damage pathway of hepatocellular carcinoma cells after treatment with 125I particles and circNOP14, both alone and in combination, using DNA DAMAGE PCR Array. We found that circNOP14 directly affected fewer DNA damage genes, with only 5 genes showing differential expression, and these were associated with the BCL2 family of apoptosis genes. DNA damage caused by 125I particles activates DNA-PK / ATM / ATR kinases, which ultimately inactivate the Cyclin B-cdc2 complex through two parallel cascades: the first cascade rapidly inhibits cell entry into mitosis, phosphorylating chk2 kinase and inactivating cdc25, thereby blocking cdc2 activation; the second parallel cascade involves p53 phosphorylation, activating DNA binding and transcriptional regulation. The second cascade consists of downstream regulatory genes of p53, such as GADD45, BRCA1, and p21; circNOP14 can enhance the expression of key genes in the DDR signaling pathway of 125I. The 125I combined with circNOP14 overexpression group showed up to 69 differentially expressed genes, including XRCC6.
[0011] Our experiments, including flow cytometry, crystal violet staining, immunofluorescence staining, and subcutaneous tumor-bearing experiments in nude mice with human hepatocellular carcinoma, confirmed that circNOP14 can enhance the inhibitory effect of 125I particles on hepatocellular carcinoma cell proliferation and induce apoptosis. Previous literature has reported that irradiation of cell-derived exosomal RNA can induce DNA and chromosomal damage in paracellular cells. However, our study found that circNOP14 did not show direct effects such as DNA damage or cell cycle arrest. Therefore, we hypothesize that circNOP14 synergistically enhances the radiosensitizing effect of 125I particles by binding to DDR-related proteins. We detected the RNA binding protein (RBP) of circNOP14 using RNA pulldown, mass spectrometry, and RIP experiments. The highest binding protein was XRCC6: XRCC6 is a DNA repair gene involved in the repair pathway of non-homologous end joining of double-strand breaks. It can initiate DNA repair responses and rescue cellular senescence and autophagy flux, thereby resisting the progression of HCC. Western blotting and PCR array results suggest that increased XRCC6 expression may be involved in the hypersensitivity response of cells to 125I radiation. Meanwhile, we confirmed using RNA scope RNA in situ hybridization that radiation with 125I particles promotes increased expression of circNOP14 in hepatocellular carcinoma cells. Our study is the first to discover that circNOP14 can inhibit hepatocellular carcinoma growth and metastasis and induce apoptosis; it can also enhance the radiobiological effects of 125I particles. circNOP14 enhances the DNA damage signaling pathway mediated by 125I particle locking by binding to the RBP-binding protein XRCC6.
[0012] On one hand, the present invention provides the use of circRNA in the preparation of drugs for treating liver cancer, wherein the circRNA is has_circ_0006737 and the nucleic acid sequence is shown in Seq ID NO.1.
[0013] On the other hand, the present invention provides the use of circRNA in the preparation of an agent that inhibits the proliferation of liver cancer cells, wherein the circRNA is has_circ_0006737 and the nucleic acid sequence is shown in Seq ID NO.1.
[0014] On the other hand, the present invention provides the use of circRNA in the preparation of an agent that inhibits the migration of liver cancer cells, wherein the circRNA is has_circ_0006737 and the nucleic acid sequence is shown in Seq ID NO.1.
[0015] On the other hand, the present invention provides the use of circRNA in preparing a formulation for inducing apoptosis in liver cancer cells, wherein the circRNA is has_circ_0006737 and the nucleic acid sequence is shown in Seq ID NO.1.
[0016] On the other hand, the present invention provides the use of circRNA for preparing a formulation that enhances the biological effects of 125I particle radioactivity, wherein the circRNA is has_circ_0006737 and the nucleic acid sequence is shown in Seq ID NO.1.
[0017] Furthermore, has_circ_0006737 promotes the expression of DNA damage genes and enhances the DNA damage response.
[0018] Furthermore, the DNA damage gene includes the DNA repair gene XRCC6.
[0019] On the other hand, the present invention provides a circRNA for preparing a formulation that enhances the inhibitory effect of radioactive 125I particles on the growth of liver cancer cells, characterized in that the circRNA is has_circ_0006737, and the nucleic acid sequence is shown in Seq ID NO.1.
[0020] Furthermore, the has_circ_0006737, in conjunction with radioactive 125I particles, upregulates the expression of DNA damage-related genes; these DNA damage-related genes include: 53BP1, p53, pH2AX, BRCA1, and apoptosis genes caspase3 and Bax.
[0021] On the other hand, the present invention provides a sensitizer for 125I particle radiotherapy, the sensitizer comprising one or more of has_circ_0006737, has_circ_0006737 overexpression plasmid, and has_circ_0006737 promoter; the nucleic acid sequence of has_circ_0006737 is shown in Seq ID NO.1.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. There are currently no literature reports related to circNOP14 (hsa_circ_0006737). This application is the first to discover that circNOP14 is one of the circRNAs with differential expression before and after 125I particle therapy, indicating that circNOP14 can serve as a biomarker for radiotherapy and has potential applications in multiple fields.
[0024] 2. This invention is the first to discover that circNOP14 can inhibit the growth and metastasis of liver cancer and induce apoptosis; it can also enhance the radiobiological effects of 125I particles. Furthermore, its mechanism of action was discovered: circNOP14 enhances the DNA damage signaling pathway of 125I particle locking by binding to the RBP-binding protein XRCC6. This indicates that circNOP14 can achieve both therapeutic effects on liver cancer and radiosensitization effects on 125I particles, demonstrating broad application prospects. Attached Figure Description
[0025] Figure 1 GO analysis of differentially expressed circRNAs before and after radiotherapy with 125I particles;
[0026] Figure 2 The relative expression differences of circNOP14 in hepatocellular carcinoma tissue samples, hepatocellular carcinoma plasma samples, hepatocellular carcinoma cell samples, and hepatocellular carcinoma xenograft samples before and after radiotherapy with 125I particles;
[0027] Figure 3 RNA scope technology was used to detect the expression of circNOP14 in tissue samples from liver cancer patients.
[0028] Figure 4 : qPCR detection and confirmation of the efficiency of circNOP14 overexpression;
[0029] Figure 5 Growth status of cells overexpressing circNOP14, HepG2, and PLC / PRF / 5;
[0030] Figure 6 The number of HepG2 and PLC / PRF / 5 cells migrating in the circNOP14 overexpression group;
[0031] Figure 7 Flow cytometry results of apoptosis in HepG2 and PLC / PRF / 5 cells overexpressing circNOP14;
[0032] Figure 8 A PCR array was used to detect and analyze DNA damage genes that showed significant differences among groups in the Human DNA Damage Signaling Pathway.
[0033] Figure 9 Western blot analysis was used to detect the expression of key genes in the DNA damage signal transduction pathway.
[0034] Figure 10 Plate cloning and flow cytometry analysis showed that circNOP14 combined with 125I particles inhibited the proliferation of HepG2 liver cancer cells and promoted apoptosis of liver cancer cells.
[0035] Figure 11 Western blot analysis was performed to detect XRCC6 expression in RIP-treated HepG2 liver cancer samples (125I irradiation group and blank control group).
[0036] Figure 12 Western blot analysis was performed to detect the expression of NOP14 and XRCC6 proteins in each group.
[0037] Figure 13 Tumor size in each group after 28 days of 125I irradiation: control is the untreated blank control group, 125I is the 125I continuous irradiation treatment group, circNOP14 is the intratumoral injection of circNOP14 overexpression control group, and 125I+circNOP14 is the 125I continuous irradiation combined with circNOP14 overexpression treatment group.
[0038] Figure 14 Schematic diagram of the interaction between circNOP14 and 125I. Detailed Implementation
[0039] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0040] The experimental samples and methods in the following examples are as follows:
[0041] 1. RT-qPCR
[0042] Total RNA was isolated from clinical samples and cell lines using an RNA rapid purification kit (ESscience, China) according to the manufacturer's instructions. Reverse transcription was performed using Evo M-MLV RT Premix (Accurate Biotechnology, China) to synthesize cDNA from 2 μg of total RNA for qPCR. Then, in… iTaq Universal is used in the 480 system (Roche, Switzerland) Green Supermix (Bio-Rad, USA) performs real-time PCR on cDNA.
[0043] 2. Subcutaneous xenograft model of liver cancer
[0044] A subcutaneous xenograft model of hepatocellular carcinoma was constructed using PLC / PRF / 5 liver cancer cells. Matrigel was thawed at 4°C one day in advance; PLC / PRF / 5 suspension was prepared by digestion and collection; an equal volume of Matrigel was added for dilution, and the mixture was gently blown and mixed with a frozen pipette tip; after anesthetizing nude mice, the skin was disinfected with iodine, and 50 μl of cell fluid was drawn with a microsyringe and slowly injected subcutaneously into the mice. Immediately after removing the needle, the puncture site was pressed with a cotton swab until no more bleeding occurred.
[0045] 3. Fluorescence in situ hybridization experiment
[0046] FISH was performed according to the manufacturer's protocol. In short, Cy3-labeled circEYA3 probes were purchased from GeneSeed, and PLC / PRF / 5 cells were fixed with 4% paraformaldehyde and infiltrated with 0.5% Triton X-100. The Cy3-labeled circEYA3 probes were dissolved in hybridization buffer, denatured in a PCR thermal cycler (Bio-Rad, USA), and added to PLC / PRF / 5 cells for overnight incubation. The next day, cell nuclei were stained with DAPI. Fluorescence images were captured using a TCS SP2 AOBS laser confocal microscope (Leica, Germany).
[0047] 4. Annexin-V / PI double staining flow cytometry analysis
[0048] To measure the apoptosis rate, the Annexin-V / PI apoptosis kit (ESscience, China) was used. Cells seeded into 6-well plates were digested with 0.25% trypsin, centrifuged, and resuspended in PBS buffer. Then, 10 μL of Annexin-V and 5 μL of propidium iodide (PI) were added to the cell suspension, and the cells were incubated in the dark for 5 minutes. Finally, flow cytometry was performed on a CytoFLEX flow cytometer (Beckman Coulter, USA).
[0049] 5. Agarose gel electrophoresis experiment
[0050] Two hours after external irradiation or 125 Two days after I-particle irradiation, cells were resuspended in PBS and mixed with a low-melting-point agarose gel. The mixture was then spread onto a cured normal-melting-point agarose gel and incubated at 4°C in the dark for 30 minutes. After immersing the slides in lysis buffer, electrophoresis was performed at 25V for 30 minutes. Next, 40 μL of PI was added for staining, and the cells were observed using an inverted fluorescence microscope, ECLIPS Ti-2 (Nikon, Japan).
[0051] 6. Immunofluorescence assay
[0052] In short, the cells were fixed and infiltrated. Next, the cells were washed twice with PBS and blocked with 5% bovine serum albumin (BSA). The cells were then incubated sequentially with γH2A.X antibody and the corresponding secondary antibody, followed by DAPI staining. Finally, fluorescence images were captured using an OLYMPUS FV1000 laser confocal microscope.
[0053] 7. Construction of circNOP14 overexpression plasmid
[0054] The 412bp sequence of circNOP14 was amplified using 293T cell cDNA as a template and ligated into pLCDH-ciR with EcoRI and BamHI. The forward primer had the sequence shown in Seq NO ID.2 and the reverse primer had the sequence shown in Seq NO ID.3.
[0055] 8. RNA-seq
[0056] In short, total RNA obtained from PLC / PRF / 5 cells was purified, reverse transcribed, and sequenced. We then identified differentially expressed circRNAs using Fold Change > 2.0 and P < 0.05 as criteria.
[0057] 9. RNA Immunoprecipitation Assay
[0058] RIP assays were performed using the Magna RIP RNA-binding Protein Immunoprecipitation Kit (Millipore, USA), following the manufacturer's protocol. In short, cells were lysed with lysis buffer and incubated overnight with Anit-IGF2BP2 antibody or negative control immunoglobulin IgG. Magnetic beads were then added and resuspended with proteinase κ to remove proteins. RNA was purified and analyzed by qRT-PCR.
[0059] 10. Western Blot Experiment
[0060] In short, the process begins with collecting cell samples, extracting total protein, and determining the protein concentration. Electrophoresis gels are prepared and loaded for electrophoresis. After electrophoresis, a transfer electrophoresis apparatus is used to transfer the protein onto a PVDF membrane at 4°C and 300 mA constant current for 150 min. The PVDF membrane is then blocked with BSA at room temperature for 1 h or overnight at 4°C. Primary antibody incubation is then performed: the antibody is diluted with blocking buffer and incubated with the blocked PVDF membrane at room temperature for 2 h or overnight at 4°C, followed by washing with TBST. Secondary antibody incubation is then performed: the corresponding secondary antibody is diluted with blocking buffer and incubated with the PVDF membrane at room temperature for 1.5 h, followed by washing with TBST. Finally, the membrane is exposed and developed.
[0061] 11.A PCR Array Human DNA Damage Signaling Pathway
[0062] Total RNA was extracted using method 1, and cDNA was collected via reverse transcription. RT-PCR was then used to collect the cDNA. 2 Profiler TM The PCR Array Human DNA Damage Signaling Pathway Detection Kit performs gene-level quantitative measurements of molecules related to DNA damage pathways. The detection method is described in the manufacturer's instructions. In short, the cDNA reaction system is added to the PCR Array plate for real-time PCR.
[0063] 12. Plate cloning
[0064] In short, cells in the logarithmic growth phase are trypsinized, resuspended in culture medium to form a cell suspension, and counted. 400-1000 cells / well are seeded into each experimental group in a 6-well plate. Culture continues until 14 days or until the cell count in most individual clones exceeds 50. The medium is changed every 3 days, and cell status is observed. After cloning, cells are photographed under a microscope, washed once with PBS, and fixed with 1 mL of 4% paraformaldehyde per well for 30-60 min, followed by another wash with PBS. 1 mL of crystal violet staining solution is added to each well for 10-20 min. Cells are washed several times with PBS, air-dried, and photographed.
[0065] 13. Transwell migration
[0066] In short, transwell culture chambers were placed in well plates. The control group had serum-free culture medium added to the lower layer of the chamber, while the experimental treatment groups had an equal volume of culture medium containing 10% fetal bovine serum added to the lower chamber, and an equal volume of single-cell suspension added to the lower chamber. After 12 hours of routine culture, the transwell chambers were removed, fixed with methanol for 15 minutes, stained with 0.1% crystal violet for 20 minutes, and the cells on the upper layer of the microporous membrane were carefully wiped away with cotton swabs. The cells were washed twice with PBS. Cells in the lower layer of the microporous membrane were photographed and counted under a fluorescence microscope.
[0067] 14. Silver Dye
[0068] Immerse the gel in at least 5 times its volume of fixative and gently shake at room temperature for 4-12 hours to fix the protein. Discard the fixative, add at least 5 times its volume of 30% ethanol, and gently shake at room temperature for 30 minutes. Discard the ethanol, add 10 times its volume of pure water (deionized water), and gently shake at room temperature for 10 minutes. Repeat this step twice. Discard the washing water, add 5 times its volume of silver nitrate solution, and gently shake at room temperature for 30 minutes. Discard the silver nitrate solution, rinse both sides of the gel with pure water (deionized water) for 20 seconds on each side. Add 5 times its volume of fresh developing solution, and gently shake at room temperature. Staining bands of the protein will appear within minutes; continue until the bands are clear. Stop the reaction by washing the gel with 1% acetic acid, and then rinse several times with pure water (deionized water) for 10 minutes each time. The silver-stained gel is then photographed using a scanner.
[0069] 15. Mass spectrometry
[0070] In simple terms, after obtaining a protein sample, mass spectrometry for protein determination mainly involves three steps: protein digestion, mass spectrometry analysis, and database retrieval and protein identification. Trypsin is used to digest the protein into polypeptide fragments of 6-20 amino acids, which are then detected by tandem mass spectrometry (MS / MS). Database retrieval software is used to select a protein database for analysis and identification of the actual detected mass spectrometry data.
[0071] Example 1: Screening of circNOP14
[0072] In paired liver cancer tissue samples, plasma samples, and cell samples before and after radioactive particle therapy, we selected 10 significantly differentially expressed circRNAs using qPCR for validation. Among them, circRNA-NOP14 (has_circ_0006737) was significantly expressed, and RNA Scope was used to detect the expression of circRNA-NOP14 in liver cancer tissue samples. The other 9 circRNAs selected above were determined by subsequent experiments to have no significant correlation with liver cancer progression, prognosis, or efficacy of 125I particle therapy.
[0073] This invention prepared blood samples from 12 patients with liver cancer after 125I particle therapy. RNA was extracted from exosomes, and longRNA expression profiles were obtained using longRNA-seq. Further differential mRNA and circRNA profiles were obtained. The same differentially expressed gene, NOP14, was found in both the mRNA and circRNA profiles. The p-value of circNOP14 (hsa_circ_0006737) showed a more significant difference. TCGA (The Cancer Genome Atlas) data showed that NOP14 was significantly associated with the prognosis of liver cancer.
[0074] GO analysis was performed on differentially expressed circRNAs, such as... Figure 1 As shown in the figure. GO Biological Process analysis results indicate that the cells have a significant response to DNA damage, consistent with our previous study on the effects of 125I particles on hepatocellular carcinoma cells. GO Molecular Function analysis suggests that circRNAs may function by binding to chromatin, RNA, and proteins. GO Cellular Component analysis results indicate that the differentially expressed components are mainly concentrated in the cell nucleus, and the noc4p-nop14p complex was found. The noc4p-nop14p complex is one of the main mechanisms by which NOP14 functions, as previously reported, suggesting that NOP14 is involved in the effects of 125I particles on hepatocellular carcinoma cells.
[0075] qPCR was used to detect the expression of circNOP14 in cell samples (HepG2) before and after 125I particle irradiation, mouse hepatocellular carcinoma xenograft samples (PLC-T), clinical hepatocellular carcinoma patient samples (HCC-T), and blood samples from clinical hepatocellular carcinoma patients (HCC-P). Figure 2 As shown, this initially indicates a difference in expression in samples before and after 125I particle therapy. Due to the unique characteristics of circRNA, we used RNA Scope technology to design a specific probe for circNOP14. Fresh liver cancer tissue specimens obtained surgically were sectioned in paraffin, and RNA Scope detection revealed circNOP14 expression in the liver cancer tissue; the target probe signal was red, as shown in the image. Figure 3 As shown.
[0076] Example 2: circNOP14 inhibits the proliferation of liver cancer cells and induces apoptosis in liver cancer cells.
[0077] We first constructed a circNOP14 overexpression plasmid (pLCDH-circNOP14) containing a circular RNA reading frame and the circNOP14 sequence: The 412 bp sequence of circNOP14 was amplified using 293T cell cDNA as a template, ligated into pLCDH-ciR with EcoRI and BamHI, and then transfected into 293T cells with pLCDH-circNOP4. qPCR was used to detect and confirm the efficiency of circNOP14 overexpression, such as... Figure 4 As shown, the results indicate that overexpression is circNOP14 specific. Sequencing of the PCR product verified the overexpressed circNOP14 sequence and circularization site, as shown below. Figure 4 As shown.
[0078] After overexpression of circNOP14, MTT assay results showed that circNOP14 could inhibit HCC cell growth. Consistent results were obtained in two cell lines (HepG2 and PLC / PRF / 5). Figure 5 As shown in the results, overexpression of circNOP14 inhibited the growth of HepG2 and PLC / PRF / 5 cells, indicating that circNOP14 can inhibit the proliferation of liver cancer cells.
[0079] Transwell migration experiment results are as follows: Figure 6 As shown in the figure, Control is the blank control group, PLCDH is the PLCDH transfection control group, and circNOP14 is the circNOP14 overexpression group (10×10 images). The results show that compared with the control group, the number of migrating cells in the overexpression group was significantly reduced, suggesting that circNOP14 can inhibit the migration of PLC / PRF / 5 and HepG2 cells, that is, circNOP14 can inhibit the migration of liver cancer cells.
[0080] Streaming results as follows Figure 7 As shown, the proportion of apoptotic cells in the circNOP14 overexpression group was significantly increased, suggesting that circNOP14 can promote apoptosis of HepG2 and PLC / PRF / 5 cells in vitro, that is, circNOP14 can induce apoptosis of liver cancer cells.
[0081] Example 3: circNOP14 enhances the radiobiological effects of 125I particles
[0082] Previous functional experiments demonstrated that overexpression of circNOP14 can inhibit the growth and migration of liver cancer cells and induce apoptosis. Does circNOP14 coordinate the radiobiological effects of 125I particle-induced apoptosis in liver cancer cells? We then used plate cloning, PCR array, RT-qPCR, and flow cytometry to detect the synergistic effect, finding that overexpression of circNOP14 enhances the radiobiological effects of 125I particles.
[0083] RT 2 Profiler TM The Human DNA Damage Signaling Pathway PCR Array kit was used to detect DNA damage in hepG2 cells, including a blank control group, a circNOP14 overexpression group, a 125I irradiation group, and a 125I combined with circNOP14 overexpression group. Significantly different DNA damage genes among the groups were detected and analyzed. The PCR array contained 84 DNA damage genes, and the results are as follows: Figure 8As shown: Compared with the blank control group, the circNOP14 overexpression group had 5 significantly different genes; compared with the blank control group, the 125I irradiation group had 32 significantly different genes; compared with the overexpression control group, the 125I irradiation group had 34 significantly different genes; compared with the blank control group, the 125I combined with circNOP14 overexpression group had 69 significantly different genes; compared with the overexpression control group, the 125I combined with circNOP14 overexpression group had 62 significantly different genes; and compared with the 125I irradiation group, the 125I combined with circNOP14 overexpression group had 44 significantly different genes. This indicates that the DNA damage genes significantly increased after irradiating liver cancer cells with 125I particles combined with circNOP14 overexpression. Cross-comparison analysis of significantly different genes in each group revealed that 125I particle irradiation had effects on DNA damage response, DNA breakage, DNA repair, and cell cycle, with a large number of differentially expressed genes concentrated in the DNA damage response. Therefore, circNOP14 does not directly cause DNA damage, but circNOP14 overexpression enhances the irradiation effect of 125I particles.
[0084] Overexpression of circNOP14 combined with 125I particles compared with other groups revealed 30 uniquely significant differentially expressed genes. Western blot analysis was performed to detect the expression of key genes in the DNA damage signaling pathway. The results are as follows: Figure 9 As shown, the results indicate that after overexpression of circNOP14 combined with 125I particle treatment, the number of differentially expressed DDR genes in DNA damage response, DNA double-strand breaks (H2AFX, etc.), DNA repair (XRCC6, etc.), and cell cycle (GADD45, CDC25, etc.) increased significantly. Most of these genes are p53 and chk2 regulatory target genes. Therefore, circNOP14 does not directly cause DNA damage, but overexpression of circNOP14 enhances the radioactive effect of 125I particles.
[0085] Plate colony and flow cytometry analysis: control group consisted of untreated hepatocellular carcinoma cells; 125I group consisted of hepatocellular carcinoma cells continuously irradiated with 125I; circNOP14 group consisted of hepatocellular carcinoma cells overexpressing circNOP14; and 125I+circNOP14 group consisted of hepatocellular carcinoma cells continuously irradiated with 125I combined with those overexpressing circNOP14 (10×10 images). Figure 10 As shown, the results of the plate cloning experiment indicate that circNOP14 combined with 125I particles can inhibit the proliferation of HepG2 liver cancer cells, and flow cytometry also found that the proportion of apoptosis in liver cancer cells combined with circNOP14 and 125I particles increased.
[0086] To investigate the mechanism of action of circNOP14, we employed RNA pull-down, mass spectrometry, and RIP to detect circNOP14-binding proteins. We first constructed a recombinant plasmid of circNOP14, which was sequenced correctly. The in vitro transcription product was verified by agarose gel electrophoresis. Silver staining of circNOP14 showed three differentially expressed protein bands, which were then detected by mass spectrometry. The differentially expressed bands were located in the 150 kDa, 75 kDa, and 25–37 kDa regions. The proteins whose molecular weights corresponded to those in the silver staining pattern in the mass spectrometry results were mainly: HADHA, MCCC1, RPS2 (40S ribosomal protein S2), XRCC6 (X-ray repair cross-complementing protein 6, Ku70), COPA, HNRNPR, DDX21, AZGP1, and RPS6 (40S ribosomal protein S6). XRCC6 was clearly detected in the mass spectrometry results, consistent with the previous PCR array experiments. Next, a RIP (RNA Immunoprecipitation) experiment was performed to detect the intracellular binding of circNOP14 and XRCC6 (Ku70). In the XRCC6 IP group, a 5% input was used in the Western blot (WB). Based on the WB results, as... Figure 11 As shown, the IP (immunoprecipitation) efficiency of XRCC6 was inferred to be between 5% and 10%, indicating that XRCC6(Ku70) binds to circNOP14 intracellularly. XRCC6(Ku70) is a DNA repair gene involved in the non-homologous end joining repair pathway of double-strand breaks. It can initiate DNA repair responses and rescue cellular senescence and autophagy flux, thereby resisting the development and progression of HCC. Western blot and PCR array results showed that XRCC6 expression was enhanced after circNOP14 combined with 125I particle treatment, suggesting that this response may be involved in the cell's hypersensitivity to 125I particle radiation. Finally, Western blot was used to detect the expression of NOP14 and XRCC6 proteins in each group, and the results are shown below. Figure 12 As shown, this further confirms the positive correlation between XRCC6 expression changes and circNOP14 overexpression.
[0087] In summary, circNOP14 enhances the DNA damage response at each stage of the DDR pathway acted upon by 125I particles by binding to RBPs (RNA-binding proteins), thereby enhancing the radiobiological effects of 125I particles.
[0088] Example 4: circNOP14 synergistically inhibits the growth of liver cancer xenografts with 125I particles
[0089] In vivo experiments were conducted to verify the functions of circNOP14 and radioactive 125I particles. We used a PLC / PRF / 5-human hepatocellular carcinoma nude mouse subcutaneous tumor-bearing model to observe the effects of circNOP14 overexpression and 125I particle implantation on tumor growth. The control group was an untreated blank control group, the 125I group was the 125I continuous irradiation treatment group, the circNOP14 group was the circNOP14 overexpression control group, and the 125I+circNOP14 group was the 125I continuous irradiation combined with circNOP14 overexpression treatment group.
[0090] Tumor sizes in each group 28 days after 125I irradiation are as follows Figure 13 As shown, compared with the blank control group, both circNOP14 and implanted 125I particles can inhibit tumor growth, and the group with overexpression of circNOP14 combined with 125I has the most significant inhibitory effect.
[0091] The in vivo experimental results above indicate that circNOP14 can enhance the radiobiological effects by synergistically acting on the DNA damage pathway by radioactive 125I particles, which is consistent with the in vitro experimental results.
[0092] Based on the above research, we obtained the relevant principles of circNOP14 co-emission of 125I particles, such as... Figure 14 As shown.
[0093] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.
[0094] sequence list
[0095] Seq ID NO.1
[0096] GCTGAGAGACTTCGAAGAATGCTTGGAAAGGATGAGGATGAAAATGTTAAGAAA
[0097] CCAAAACATATGTCAGCAGATGATCTGAATGATGGCTTCGTGCTAGATAAAGATGACA
[0098] GGCGTTTGCTTTCCTACAAAGATGGAAAGATGAATGTCGAGGAAGATGTCCAGGAAG
[0099] AGCAAAGCAAGGAAGCCAGTGACCCTGAGAGCAACGAGGAAGAAGGTGACAGTTC
[0100] AGGCGGGGAGGACACAGAGGAGAGCGACAGCCCAGATAGCCACTTGGACCTGGAAT
[0101] CCAACGTGGAGAGTGAGGAAGAAAACGAGAAGCCAGCAAAAGAGCAGAGGCAGAC
[0102] TCCTGGGAAAGGGTTGATAAGCGGCAAGGAAAGAGCTGGAAAAGCTACCAGAGACG
[0103] AGCTGCCCTACACGTTCGCAG
[0104] Seq ID NO.2
[0105] CGGAATTCTGAAATATGCTATCTTACAGGCTGAGAGACTTCGAAGAATGC
[0106] Seq ID NO.3
[0107] CGGGATCCTCAAGAAAAAATATATTCACCTGCGAACGTGTAGGGCAGCTC
Claims
1. The use of a circRNA in the preparation of a drug for treating liver cancer, characterized in that, The circRNA is has_circ_0006737, and its nucleic acid sequence is shown in Seq ID NO.
1.
2. The use of a plasmid overexpressing has_circ_0006737 in the preparation of a drug for treating liver cancer, characterized in that, The nucleic acid sequence of has_circ_0006737 is shown in Seq ID NO.
1.
3. The use of a circRNA in the preparation of a drug that enhances the inhibitory effect of radioactive 125I particles on the growth of liver cancer cells, characterized in that, The circRNA is has_circ_0006737, and its nucleic acid sequence is shown in Seq ID NO.
1.
4. The use as described in claim 3, characterized in that, The circRNA is used to prepare a sensitizer for 125I particle radiotherapy, and the sensitizer includes the has_circ_0006737 overexpression plasmid.