Application of rice bacterial blight resistance related miRNA
By regulating the expression of miR2871a-3p in rice, overexpression and interference vectors were used to improve rice resistance to bacterial blight, solving the problem of insufficient resistance to rice bacterial blight and achieving significant breeding results.
Patent Information
- Application Number
- CN202311592420.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-27
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2043-11-27
AI Technical Summary
The reduced attention paid to bacterial blight in existing technologies has led to a resurgence of the disease, and there is a lack of effective disease-resistant breeding strategies.
By regulating the expression level of miR2871a-3p in rice, the resistance of rice to bacterial blight was improved using overexpression and interference vectors. Overexpression and interference vectors of miR2871a-3p were constructed and transferred into rice receptor materials to improve or reduce their resistance to bacterial blight.
Significantly improving or reducing rice resistance to bacterial blight provides a new method for breeding improvement and lays the foundation for disease-resistant rice breeding.
Smart Images

Figure CN117363618B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop disease-resistant variety breeding technology, and in particular to the application of a miRNA related to resistance to bacterial blight in rice. Background Technology
[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, with about half of the global population relying on it as a staple food. Safe rice production is a crucial factor affecting food security. Bacterial leaf blight is one of the three traditional diseases of rice, affecting both yield and quality. In the past 20 years, breeders have gradually reduced their focus on bacterial leaf blight, creating a potential for its resurgence. Therefore, it is necessary to strengthen the focus on breeding rice varieties with resistance to bacterial leaf blight. Long-term production practice has proven that identifying and utilizing broad-spectrum resistance genes in rice disease-resistant breeding has become an effective and economical strategy for disease control.
[0003] MicroRNAs are a class of non-coding RNAs approximately 19-22 nucleotides in length, and are key regulators in plant growth and development. Studies have shown that microRNAs participate in regulating various aspects of plant growth and development, as well as biological processes such as responses to abiotic stress, and are closely related to plant disease resistance. Alterations in the expression of microRNAs and their target genes in plants can affect a variety of genetic traits. Therefore, functional research on rice microRNAs can provide new theoretical basis and research methods for improving rice disease resistance through breeding. Summary of the Invention
[0004] The purpose of this invention is to provide an application of miRNA related to resistance to bacterial blight in rice, in order to solve the problems existing in the prior art. This invention significantly improves the resistance level of rice to bacterial blight pathogen by reducing the expression level of miR2871a-3p, and has good application prospects in the prevention and control of rice diseases, laying an important foundation for the breeding and improvement of rice disease resistance.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of miR2871a-3p, which is associated with resistance to bacterial blight in rice, in regulating resistance to bacterial blight in rice. The nucleotide sequence of miR2871a-3p is shown in SEQ ID NO:1.
[0007] Furthermore, by downregulating the expression level of miR2871a-3p, resistance to bacterial blight in rice was improved.
[0008] Furthermore, the interference vector of miR2871a-3p was obtained using the short tandem target simulation method, and the interference vector was transferred into rice receptor material to improve rice bacterial blight resistance.
[0009] Furthermore, by upregulating the expression level of miR2871a-3p, resistance to bacterial blight in rice was reduced.
[0010] Furthermore, an overexpression vector of miR2871a-3p was obtained using the artificial microRNA method, and the overexpression vector was transferred into rice recipient material to reduce rice bacterial blight resistance.
[0011] This invention also provides the application of miR2871a-3p interfering agent in improving resistance to bacterial blight in rice.
[0012] Furthermore, the interfering agent comprises an interfering vector of miR2871a-3p; the interfering vector comprises the STTM sequence shown in SEQ ID NO:6.
[0013] The present invention also provides the application of miR2871a-3p, which is associated with resistance to bacterial blight of rice, in the breeding of rice bacterial blight resistance, wherein the nucleotide sequence of miR2871a-3p is shown in SEQ ID NO:1.
[0014] The present invention discloses the following technical effects:
[0015] This invention constructs overexpression and interference vectors for rice miR2871a-3p, and then transfers these overexpression and interference vector plasmids into rice recipient material via Agrobacterium-mediated transformation. Positive plants are detected using quantitative real-time PCR. Disease resistance analysis of the obtained positive transgenic plants shows that reducing miR2871a-3p expression significantly improves rice resistance to bacterial blight. Therefore, rice miR2871a-3p can be applied to genetic engineering breeding of crops to cultivate disease-resistant rice varieties. This invention demonstrates promising application prospects in the control of rice diseases and lays an important foundation for improving rice disease resistance through breeding. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1This is the result of real-time quantitative PCR analysis of the expression pattern of miR2871a-3p in wild-type ZH11 after infection with rice bacterial blight. H2O treatment was used as the control for inoculation with rice bacterial blight and recorded as 0h. * indicates a significant difference compared with the control (*, P<0.05, **, P<0.001). The statistical method used was the T-test.
[0018] Figure 2 A schematic diagram of a PCR product fragment for constructing a stem-loop structure of miRNA using the pNW55 vector;
[0019] Figure 3 Spectral information for the pXU1301 vector;
[0020] Figure 4 To detect the expression level of miR2871a-3p in transgenic rice with overexpression and interference by real-time quantitative PCR; “ZH11” represents wild type, * indicates significant difference compared with wild type (*, P<0.05, **, P<0.001), and the statistical method used is T-test.
[0021] Figure 5 To detect the expression levels of defense response genes in miR2871a-3p overexpression and interference transgenic rice using real-time quantitative PCR; A: PR1a; B: PR10; * indicates significant difference compared with wild type (*, P<0.05, **, P<0.001), the statistical method used was T-test;
[0022] Figure 6 To detect the disease resistance of transgenic rice with miR2871a-3p overexpression and interference; A: Phenotypic photograph of transgenic rice inoculated with African AXO1947 strain; B: Statistical graph of lesion length in transgenic rice inoculated with African AXO1947 strain; C: Phenotypic photograph of transgenic rice inoculated with Guangxi local type IX strain; D: Statistical graph of lesion length in transgenic rice inoculated with Guangxi local type IX strain;
[0023] Figure 7 To detect the expression level of miR2871a-3p in resistant and susceptible rice materials using real-time quantitative PCR. Detailed Implementation
[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0029] This invention provides a miRNA associated with resistance to bacterial blight in rice, which is obtained from rice small RNA sequencing, and the mature sequence is 5'-uauuuuaguuucuauggucac-3' (SEQ ID NO:1).
[0030] This invention first utilizes transcriptome sequencing analysis to screen rice small RNA miR2871a-3p from wild-type rice ZH11 that responds to the African bacterial blight pathogen AXO1947, indicating that miR2871a-3p may be involved in regulating rice resistance to bacterial blight. To verify this hypothesis, this invention uses real-time quantitative PCR to detect the expression of miR2871a-3p in wild-type ZH11 after inoculation with the African bacterial blight pathogen AXO1947. The results showed that miR2871a-3p expression was upregulated 24 h and 48 h after bacterial blight infection, indicating that bacterial blight can induce miR2871a-3p expression.
[0031] This invention also provides the application of the above-mentioned miRNA in the breeding of rice resistant to bacterial blight. By inhibiting the expression of miR2871a-3p in rice, the resistance of rice to bacterial blight is improved, and a new rice variety with high resistance to bacterial blight is bred.
[0032] To facilitate understanding of the present invention, a more comprehensive description will be given below with reference to embodiments. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0033] Example 1: Real-time quantitative PCR analysis of the response of miR2871a-3p to rice bacterial blight pathogen.
[0034] 1. Primer design for RNA reverse transcription and real-time quantitative PCR
[0035] Stem-loop primers were designed based on the mature sequence predicted from the miRNA sequence as follows:
[0036] (1) RT primer sequence (SEQ ID NO:2):
[0037] 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGACCA-3';
[0038] (2) miR2871a-3p quantitative PCR forward primer sequence (SEQ ID NO:3):
[0039] 5'-GCGCGCGTATTTTAGTTTCTAT-3';
[0040] (3) miR2871a-3p quantitative PCR reverse primer sequence (SEQ ID NO:4):
[0041] 5'-GTGCAGGGTCCGAGGTATTC-3';
[0042] 2. Material cultivation and infection by rice bacterial blight pathogen
[0043] (1) The experimental rice material was wild-type rice ZH11, which is susceptible to bacterial blight. ZH11 material was planted in the field until the tillering stage.
[0044] (2) The tested bacterial blight strain was African strain AXO1947. Bacterium AXO1947 (preserved in the laboratory of Guangxi University) was cultured on PSA solid medium at 28℃, and then adjusted to OD using sterile water. 600The concentration of bacterial blight pathogen was increased to 0.5 μL. The pathogen was injected into the leaves of ZH11 rice plants at the tillering stage. Leaves were collected at 0 h, 24 h, and 48 h post-inoculation, flash-frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted from the rice using Trizol reagent and reverse transcribed to obtain cDNA for real-time quantitative PCR detection. Results are as follows: Figure 1 As shown, the expression of miR2871a-3p in ZH11 was significantly upregulated after infection with bacterial blight, indicating that it plays an important role in the resistance to bacterial blight in rice.
[0045] Example 2: Construction of transgenic rice with miR2871a-3p overexpression and interference
[0046] 1. An overexpression vector for miR2871a-3p was constructed using the pCAMBIA1301 vector, and the expression of miR2871a-3p was driven by the 35S promoter, as detailed below:
[0047] (1) Artificial microRNA (AmiRNA) was constructed using the pNW55 vector. The mature sequence of miR2871a-3p was found at http: / / www.mirbase.org. Its mature molecular sequence is 5'-uauuuuaguuucuauggucac-3' (SEQ ID NO:1). This sequence was input into the microRNA design application website http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi?page=Home;project=stdwmd to automatically synthesize four primers. The primer sequences are shown below:
[0048] miR2871a-3p-I miR-s: agTATTTTAGTTTCTATGGTCACcaggagattcagtttga;
[0049] miR2871a-3p-II miR-a: tgGTGACCATAGAAACTAAAATActgctgctgctacagcc;
[0050] miR2871a-3p-III miR*s: ctGTGACGATACAAACTAAAATAttcctgctgctaggctg;
[0051] miR2871a-3p-IV miR*a: aaTATTTTAGTTTGTATCGTCACagagaggcaaaagtgaa.
[0052] In addition, two universal primers, G-4368 and G-4369, need to be designed. The primer sequences are shown below:
[0053] G-4368: tgaccatggtagatctctGCAAGGCGATTAAGTTGGGTAAC;
[0054] G-4369: aattcgagctggtgaccGCGGATAACAATTTCACACAGGAAACAG.
[0055] (2) According to Figure 2 The diagram shown illustrates the construction of the PCR product fragment expressing the miR2871a-3p stem-loop structure. The vector construction is complete, and the specific steps are as follows:
[0056] a) Using vector pNW55 as a template, the first round of PCR amplification was completed according to the reaction procedure described in Table 1. The miR528 and its miRNA* sequences on pNW55 were replaced by the above-mentioned Ami sequences (red), the sequences on pNW55 that paired with the primers were marked in yellow, and the multiple cloning sites were marked in blue.
[0057] b) Using the three products (G-4368+II, I+IV, III+G-4369) generated in the first round of PCR in a) as a template, and using G-4368+G-4369 as primers, fusion PCR was performed to obtain the PCR product fragment expressing the miR2871a-3p stem-loop structure.
[0058] (3) The PCR product fragment obtained in step (2) is recovered and ligated into the pCAMBIA1301 vector by homologous recombination to obtain the overexpression vector of miR2871a-3p (miR2871a-3p-ox).
[0059] Table 1. PCR primers and procedures, and the sizes of the obtained PCR products.
[0060]
[0061] 2. The miR2871a-3p interfering vector obtained using short tandem target mimic (STTM) technology was used to silence miR2871a-3p expression, as detailed below:
[0062] (1) An STTM sequence with a complementary sequence to the mature miR2871a-3p was artificially synthesized, and three CTA bases were added to the 10th and 11th positions at the 3' and 5' ends. Primers were designed to introduce BamHI and HindIII restriction sites. The primer sequences are shown below:
[0063] STTM-miR2871a-3p-F:CCAAGCTTGTGACCATAGcatAAACTAAAATAGTTGTTGTTGTTATGGTCTAG;
[0064] STTM-miR2871a-3p-R:CGGGATCCTATTTTAGTTTtagCTATGGTCACATTCTTCTTCTTTAGACCATATTCTTCT.
[0065] (2) The STTM sequence of miR2871a-3p was amplified using the artificially synthesized STTM sequence (GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGA AAAAGAATATGGTCTAAAGAAGAAGAAT (SEQ ID NO:5)) as a template in the PCR reaction system shown in Table 2.
[0066] Table 2 PCR reaction system
[0067]
[0068] The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 3 min.
[0069] (3) The target fragment (STTM sequence: GTGACCATAGCTAAAACTAAAATA (SEQ ID NO: 6)) obtained in step (2) was recovered and simultaneously digested with HindIII and BamHI along with the pXU1301 vector stored in our laboratory (vector map is shown in the figure). Figure 3 The target fragment was ligated into the pXU1301 vector using T4 ligase to obtain the miR2871a-3p interference vector (STTMmiR2871a-3p).
[0070] Example 3: Obtaining transgenic rice with miR2871a-3p overexpression and interference, and identifying positive plants.
[0071] The overexpression and interference vector plasmids of miR2871a-3p obtained in Example 2 were transformed into Agrobacterium EHA105. Using the Agrobacterium EHA105-mediated genetic transformation method, the overexpression and interference vectors were transformed into the wild-type ZH11 variety to obtain transgenic plants. PCR detection of the hygromycin gene (Hpt) and real-time quantitative PCR detection of miR2871a-3p expression yielded transgenic positive plants with miR2871a-3p overexpression (miR2871a-3p-ox) or transgenic positive plants with reduced expression (STTM2871a-3p) (see...). Figure 4 ).
[0072] Example 4: miR2871a-3p regulates the expression of disease resistance-related defense response genes
[0073] Plant disease resistance is accompanied by the expression of a series of defense response genes. To verify the role of miR2871a-3p in plant disease resistance, real-time quantitative PCR was used to detect the transcriptional levels of the defense response genes PR1a (RAP-DB accession number: Os07g0129200) and PR10 (RAP-DB accession number: Os12g0555000). The primers and sequences for real-time quantitative PCR are shown below:
[0074] PR1a-qF:CGTGTCGGCGTGGGTGT;
[0075] PR1a-qR:GGCGAGTAGTTGCAGGTGATG.
[0076] PR10-qF:GCCATGCCCAAGGTTTGT;
[0077] PR10-qR:CATCATCCACAGCAGGGTT.
[0078] The results are as follows Figure 5 As shown, overexpression of miR2871a-3p in rice significantly downregulated the expression levels of defense response genes such as PR1a and PR10, while downexpression of miR2871a-3p significantly upregulated the expression levels of defense response genes such as PR1a and PR10. This indicates that miR2871a-3p negatively regulates disease resistance in rice.
[0079] Example 5: Disease Resistance Analysis of MiR2871a-3p Overexpression and Interference Transgenic Rice
[0080] The transgenic progeny positive plants obtained in Example 3 were subjected to disease resistance testing. The specific testing method is shown below:
[0081] (1) African strain AXO1947 and Guangxi native strain IX2026 of bacterial blight pathogen were cultured on PSA solid medium at 28℃ (both preserved in the laboratory of Guangxi University). Then, the bacterial blight pathogen was adjusted to OD using sterile water. 600 Up to 0.5;
[0082] (2) Dip scissors into the bacterial solution and cut the leaves 3-5 cm from the leaf tip of the wild-type ZH11, miR2871a-3p overexpressing and interference transgenic rice to complete the inoculation;
[0083] (3) Fourteen days after inoculation, the length of the lesions was measured to determine whether the rice was resistant or susceptible to bacterial blight. The longer the lesion, the more susceptible the rice was, and the shorter the lesion, the more resistant the rice was.
[0084] The results are as follows Figure 6 As shown, after inoculation with *Bacillus cereus*, the leaf lesion length of miR2871a-3p overexpressing transgenic rice was significantly longer than that of ZH11, indicating a significant decrease in disease resistance; while the leaf lesion length of miR2871a-3p interfering transgenic rice was significantly shorter than that of ZH11, indicating a significant increase in disease resistance. This confirms that the expression level of miR2871a-3p is negatively correlated with resistance to *Bacillus cereus* in rice.
[0085] Example 6: Expression level analysis of miR2871a-3p in resistant and susceptible rice varieties
[0086] The expression level of miR2871a-3p in resistant and susceptible rice varieties was analyzed using real-time quantitative PCR. The primer design for RNA reverse transcription and real-time quantitative PCR was the same as in Example 1.
[0087] The tested disease-resistant rice varieties were IRBB5, IRBB21, and CBB23, which showed strong resistance to both African strain AXO1947 of rice bacterial blight and the local Guangxi strain IX2026. The tested disease-resistant rice varieties were Nipponbare, Ivory Fragrance, and IR24, which showed high susceptibility to both African strain AXO1947 of rice bacterial blight and the local Guangxi strain IX2026.
[0088] Total RNA was extracted from rice leaves during the tillering stage of field-grown resistant rice varieties. The RNA was then reverse transcribed to obtain cDNA, which was used for real-time quantitative PCR detection. Results are as follows: Figure 7 As shown, the expression level of miR2871a-3p was higher in susceptible varieties than in resistant varieties. This indicates that miR2871a-3p plays an important role in the regulation of rice resistance to bacterial blight.
[0089] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Application of rice bacterial leaf blight resistance related miR2871a-3p in regulating rice bacterial leaf blight resistance, characterized in that, The nucleotide sequence of miR2871a-3p is shown in SEQ ID NO:
1.
2. Use according to claim 1, characterized in that, Rice bacterial blight resistance was improved by downregulating the expression level of miR2871a-3p.
3. Use according to claim 2, characterized in that, The interference vector of miR2871a-3p was obtained using the short tandem target simulation method. The interference vector was then transferred into rice receptor material to improve rice bacterial blight resistance.
4. Use according to claim 1, characterized in that, By upregulating the expression level of miR2871a-3p, resistance to bacterial blight in rice was reduced.
5. Use according to claim 4, characterized in that, An overexpression vector of miR2871a-3p was obtained using the artificial microRNA method. The overexpression vector was then transferred into rice recipient material to reduce rice bacterial blight resistance.
6. The use of an interfering preparation of miR2871a-3p in improving the resistance of rice to bacterial blight, characterized in that, The nucleotide sequence of miR2871a-3p is shown in SEQ ID NO:
1.
7. Use according to claim 6, characterized in that, The interfering agent comprises an interfering vector of miR2871a-3p; the interfering vector comprises the STTM sequence as shown in SEQ ID NO:
6.
8. The use of a rice bacterial blight resistance related miR2871a-3p in breeding rice bacterial blight resistance, characterized in that, The nucleotide sequence of miR2871a-3p is shown in SEQ ID NO:1.