Application of betulinic acid in resistance to turnip mosaic virus

Abstract

The present invention discloses the use of betulinic acid in the preparation of an anti-Tubulic Mosaic Virus preparation, relating to the technical field of agricultural plant protection. The present invention used 10 mg / L of betulinic acid to continuously root-irrigate Nicotiana benthamiana plants for 5 days, and found that betulinic acid treatment significantly inhibited TuMV infection and reduced viral accumulation levels compared to the control group. Betulinic acid, as a plant-derived substance, has its own degradation pathway and has the advantages of being safe, economical, and pollution-free, meeting the requirements of sustainable agricultural development and green environmental protection. The present invention makes it possible to use betulinic acid for the prevention and treatment of plant viruses, providing a new approach for the prevention and treatment of plant viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural science and plant protection, and more particularly to the application of betulinic acid in resistance to turnip mosaic virus. Background Art

[0002] Plant viral diseases are among the most threatening pests in agricultural production, often referred to as "plant cancer." Turnip mosaic virus (TuMV) is a monopartite, positive-sense, single-stranded RNA virus of the genus Potyvirus and family Potyviradae. In recent years, TuMV has spread widely around the world, causing significant damage to vegetables and Brassica crops, posing a pressing challenge to the healthy development of the vegetable industry.

[0003] Currently, plant viral diseases are typically controlled through the promotion of resistant varieties and chemical pesticides. However, the development of resistant varieties is slow, requiring a long time, leading to degradation of resistance and failure to meet market demand. The extensive use of chemical pesticides is not only harmful to the environment but also poses potential risks to humans and animals. Botanicals, often safe, economical, and environmentally friendly, have become a research focus in recent years for disease control.

[0004] Therefore, providing more plant-derived substances that can have a better inhibitory effect on plant virus infection is an urgent problem that needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the use of betulinic acid in resistance to turnip mosaic virus. Betulinic acid (BA), also known as betulinic acid, is a triterpenoid compound with a pentacyclic lupine type. In nature, it is widely present in plants of the genus Betulin. Betulinic acid can not only be extracted from birch bark, but also betulin as a raw material, through oxidation synthesis and microbial transformation synthesis. Studies have found that betulinic acid has a variety of biological and pharmacological effects, including anti-tumor and anti-inflammatory activities, but the effect of betulinic acid on turnip mosaic virus has not been reported.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] Application of betulinic acid in the preparation of anti-turnip mosaic virus preparations.

[0008] Another object of the present invention is to provide the use of betulinic acid in the preparation of a preparation for treating plant diseases caused by turnip mosaic virus.

[0009] As a preferred technical solution, the effective concentration of betulinic acid is 10 mg / L.

[0010] Another object of the present invention is to provide a preparation for resisting turnip mosaic virus, characterized in that it comprises betulinic acid.

[0011] As a preferred technical solution, the anti-Turnip Mosaic Virus preparation further comprises a pharmaceutically acceptable adjuvant.

[0012] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses the use of betulinic acid in resistance to turnip mosaic virus. The present invention used 10 mg / L of betulinic acid to continuously root-irrigate Nicotiana benthamiana plants for 5 days and found that betulinic acid treatment significantly inhibited TuMV infection and reduced viral accumulation compared to the control group. Betulinic acid, as a plant-derived substance, has its own degradation pathway and has the advantages of being safe, economical, and pollution-free, meeting the needs of sustainable agricultural development and environmental protection. The present invention makes it possible to use betulinic acid for the prevention and treatment of plant viruses, providing new ideas for the prevention and treatment of plant viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0014] Figure 1 Nicotiana benthamiana was treated with 10 mg / L BA and then inoculated with TuMV-GFP for symptom observation.

[0015] Figure 2 RT-qPCR detection of virus accumulation in Nicotiana benthamiana plants after BA treatment, ** represents p < 0.01.

[0016] Figure 3 Western blot was used to detect the accumulation of viruses in Nicotiana benthamiana plants after BA treatment. DETAILED DESCRIPTION

[0017] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0018] Example 1

[0019] 1. BA treatment of Nicotiana benthamiana plants

[0020] Betulinic acid powder was dissolved in DMSO to prepare a 10 mg / mL stock solution, which was then diluted with sterile distilled water to a working concentration of 10 mg / L. Select Nicotiana benthamiana plants at the 4-6 leaf stage and treat them with 5 ml of the 10 mg / L BA solution by root irrigation. 0.1% DMSO was used as a control for 5 consecutive days.

[0021] 2. Agrobacterium infiltration and inoculation of TuMV virus

[0022] The TuMV-GFP Agrobacterium culture liquid (based on the infectious clone of pCambia2300-TuMV, the GFP tag was inserted into the multiple cloning site upstream of the CP gene near the 5' end, and the recombinant plasmid was then transferred into Agrobacterium GV3101) stored in a -80°C ultra-low temperature freezer was streaked onto an LB solid plate containing 100 μg / ml kanamycin sulfate and 20 μg / ml rifampicin, and cultured in a 28°C incubator for 48 h; the colonies grown on the plate were then inoculated into LB liquid medium containing 100 μg / ml kanamycin sulfate and 20 μg / ml rifampicin, and cultured at 28°C at 200 rpm for 12 h. Subsequently, the cells were collected by centrifugation at 5000 rpm for 10 min, the supernatant was discarded, the cells were fully resuspended with the inoculation resuspension solution, and the OD was adjusted using a spectrophotometer. 600 The value was adjusted to 1.0 and the mixture was allowed to stand at room temperature for 2-3 hours. Inoculate Nicotiana benthamiana using a sterile syringe.

[0023] 3. Detection of TuMV virus accumulation in Nicotiana benthamiana plants treated with BA

[0024] After continuous treatment of 10 mg / L BA and 0.1% DMSO for 5 days, N. benthamiana plants were inoculated with TuMV-GFP. Five days after inoculation, fluorescence observation was performed using an ultraviolet lamp (see Appendix). Figure 1 ).

[0025] At the same time, new leaves were collected, total RNA was extracted, and reverse transcribed into cDNA; TuMV CP gene-specific quantitative detection primers (CP-F: TGGCTGATTACGAACTGACG; CP-R: CTGCCTAAATGTGGGTTTGG) were designed, and RT-qPCR was used to detect the expression of the virus in N. benthamiana plants treated with 10 mg / L BA and 0.1% DMSO (see Appendix). Figure 2The RT-qPCR reaction system was as follows: 10 μL of 2× NovoStart SYBR qPCR SuperMix Plus, 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL of cDNA template, and ddH2O to 20 μL. The mixture was placed in a sterile 0.2 mL PCR tube and mixed thoroughly. The RT-qPCR reaction program was as follows: 95°C for 5 min; 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 20 s; 72°C for 5 min; and 16°C for 5 min.

[0026] Total protein was extracted from Nicotiana benthamiana leaves, and GFP antibody was used to detect viral expression in Nicotiana benthamiana plants treated with 10 mg / L BA and 0.1% DMSO by Western blot (see Appendix Figure 3 ), the specific steps of the Western blot experiment are as follows: (1) Prepare 12% SDS-PAGE separation gel and stacking gel, and perform SDS-PAGE to separate the total protein. The electrophoresis is at a constant voltage of 90V for about 3.5 hours, and the band reaches the bottom of the gel; (2) After the protein electrophoresis is completed, the target protein is transferred to a polyvinylidene fluoride (PVDF) membrane; (3) After the transfer is completed, take out the PVDF membrane and place it in 5% skim milk powder and block it at room temperature for 2 hours; (4) Place the PVDF membrane in the primary antibody diluted at a ratio of 1:5000 (diluted in 5% skim milk powder) and incubate it at 4°C overnight; (5) After adding TBST, shake and wash it on a shaker for 5 times, each time for 5 minutes; (6) Place the PVDF in the secondary antibody diluted at a ratio of 1:5000 (diluted in 5% skim milk powder) and incubate it at room temperature for 3 hours; (7) Add TBST and wash it again for 5 times; (8) Super ECL The plus color developing solution was evenly covered on the PVDF membrane, and after standing in the dark for 2 minutes, it was developed using a protein gel imager and photographed.

[0027] The above experimental results show that compared with the control plants, the fluorescence intensity of the new leaves of the BA-treated plants was significantly reduced. RT-qPCR results showed that BA treatment reduced viral accumulation by approximately 50%, a result also confirmed by Western blot. In summary, BA can significantly inhibit TuMV infection and reduce viral accumulation.

[0028] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0029] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Betulinic acid in the preparation of anti-turnip mosaic virus ( turnip mosaic virus ) preparation, characterized in that, The effective concentration of the betulinic acid is 10 mg / L.

2. Use of betulinic acid in the preparation of a preparation for plant diseases caused by turnip mosaic virus, characterized in that: The effective concentration of the betulinic acid is 10 mg / L.

Images