Universal cells expressing pvr and methods of making the same

Abstract

The application discloses universal PVR-expressing cells and a preparation method and application thereof. After major histocompatibility complex (MHC) class I and II genes are inactivated in cells and PVR protein is overexpressed, human pluripotent stem cells or human cell lines or human induced pluripotent stem cells obtained can further escape from killing of NK cells on the basis of escaping from T cell attack. Meanwhile, the pluripotent stem cells with low immunogenicity retain stemness and differentiation ability.

Description

[0001] Cross-references to related applications

[0002] This application claims priority and benefits to Chinese Patent Application No. 202210813508.8, filed on July 11, 2022, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention belongs to the interdisciplinary field of genetic engineering and stem cell technology, and specifically relates to a universal cell expressing PVR and its preparation method. Background Technology

[0004] Through in vitro cell culture or induced differentiation of stem cells, large quantities of healthy functional cells can be regenerated in vitro, enabling the treatment of diseases through allogeneic functional cell transplantation. However, immunoincompatibility and immune rejection of transplanted cells remain key obstacles to their clinical application. Stem cells are a type of "seed" cell possessing self-renewal capacity and the ability to differentiate into specific functional somatic cells. Based on the degree of difference in stem cell characteristics, stem cells are mainly divided into: totipotent stem cells (Totipotent stem cells), pluripotent stem cells (PSCs), and adult stem cells. Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) have the potential for unlimited proliferation, self-renewal, and differentiation into various cell types, showing significant application prospects in the treatment of cancer, neurological diseases, and cardiovascular diseases.

[0005] Autologous cell transplantation can avoid the problem of immune rejection, but producing autologous cells from patients is costly and time-consuming (Khera et al., 2013), and the quality and efficacy of cell products derived from individuals are uncertain. Data suggests that cells in patients differ from those in healthy individuals, potentially affecting treatment efficacy.

[0006] Immunogenicity can be reduced by immunosuppressive drugs, HLA matching, and gene editing, or to reduce the rejection of allogeneic transplanted cells by the host immune system. Immunosuppressive drugs have significant side effects, causing myelosuppression, hepatotoxicity, alopecia, and gastrointestinal adverse reactions. Now the United States, Japan, and China are building HLA-matched iPSC banks, but the cost of building and maintaining the bank is high because the HLA antigen gene is the most polymorphic gene observed in the human genome. The iPSC banks in various places cannot provide matching for the majority of people in their respective countries, and can only cover specific populations (Solomon et al., 2015; Turner et al., 2013). Allogeneic cell therapy for a large patient population can have a very obvious advantage over matching banks in terms of economy and construction and operation costs, but allogeneic cell therapy will be subject to strong immune rejection. Therefore, it is urgent to construct universal PSCs that are immunocompatible with allogeneic cells.

[0007] The major histocompatibility complex (MHC) of humans, i.e., human leukocyte antigen (HLA), is the main cause of immune incompatibility. The HLA complex is composed of a series of genes, which can be divided into class I, class II, and class III. MHC-I genes are expressed in almost all tissue cell types, and transplanted cells expressing “non-self” MHC class I molecules will stimulate the activation of CD8+ T cells and be eliminated. CD4+ helper T cells recognize the MHC-II genes of “non-self” cells, thereby causing immune rejection, and III class molecules are not involved in immune activity. Using gene editing methods to change immunogenic elements to produce low immunogenic cells makes it possible to mass-produce “off-the-shelf” cell therapy products with immune privilege.

[0008] In recent years, there have been pioneer reports that by knocking out B2M, CIITA, etc., MHC-I and MHC-II cell surface or itself gene expression is deleted, thereby making cells immune tolerant or escaping T / B cell-specific immune response, and producing immunocompatible universal PSCs, which lays an important foundation for more extensive universal PSCs source cells, tissues, and organs. However, HLA molecules are the main inhibitory ligands of natural killer cells (NK cells), and MHC-I class negative cells are susceptible to natural killer (NK) cell lysis. In vivo and in vitro data show that host NK cells can eliminate implanted B2M - / - Donor cells (Flahou et al., 2021). Therefore, it is necessary to improve previous methods to produce universal donor cells that can avoid immune response.

[0009] The human immune system can recognize and attack non-self antigens, thereby resisting infection. Therefore, in the process of allogeneic organ transplantation, the immune system will attack the transplanted organ, leading to immune rejection and transplantation failure. Although the embryo and placenta are semi-allogeneic transplants, similar to transplanted organs, they can induce maternal tolerance and do not produce a strong immune response. The high expression of HLA-G in the placenta regulates maternal-fetal tolerance by interacting with decidual natural killer cells, while high expression of CD47 is also detected in the placenta (Liu et al., 2021; Than et al., 2019). On the other hand, it is well known that tumor cells can escape immune surveillance by reducing the expression of HLA, reducing antigen presentation, thereby preventing them from being recognized by immune cells; and increasing the expression of immunosuppressive components such as HLA-G, PD-L1, and CTLA-4, etc. (de Charette and Houot, 2018).

[0010] Some studies have explored the relationship between maternal-fetal immune tolerance, tumor immune escape, and organ transplantation. It has been reported that simulating the mechanisms of maternal-fetal tolerance and tumor escape, such as expressing HLAG and other non-classical HLA-I class molecules based on the destruction of MHC-I and MHC-II class gene expression, or expressing immune checkpoint proteins such as PD-L1, CTLA4-Ig, CD47, CD24, etc., exhibit certain immune tolerance protection to NK cells (Zhao, W. et al., 2020; Ye, Q. et al., 2020).

[0011] However, these schemes exist only based on the direct application of field-known star molecules, and immune escape and tolerance are mostly dependent on the binding of immunosuppressive receptors and ligands, and have specific microenvironments in the tumor state or maternal-fetal interface. There is uncertainty in the direct application of low-immune factors across fields to allogeneic transplantation, whether the paired receptors or ligands exist on the transplanted cells and immune cells, and whether the transplanted environment meets the escape conditions? What is the state in the pregnant maternal-fetal interface, which may be different from the state at the time of organ transplantation. Therefore, the prior art has the technical problems of incomplete, unclear, or lack of durability of immune compatibility, narrow effective dose window, etc. And so far, the potential molecular mechanisms of maternal-fetal immune tolerance and tumor escape are still being explored, and new genes are continuously discovered, which can further develop low-immunogenic cells. This indicates the need to screen more new molecules to achieve more optimized modified stem cells to obtain a more optimal immune exemption scheme.

[0012] References:

[0013] De Charette, M., and Houot, R. (2018). Hide or defend, the two strategies of lymphoma immune evasion: potential implications for immunotherapy. Haematologica 103, 1256-1268.

[0014] Liu, Y., Gao, S., Zhao, Y., Wang, H., Pan, Q., and Shao, Q. (2021). Decidual Natural Killer Cells: A Good Nanny at the Maternal-Fetal Interface During Early Pregnancy. Front Immunol 12, 663660.

[0015] Than, N.G., Hahn, S., Rossi, S.W., and Szekeres-Bartho, J. (2019). Editorial: Fetal-Maternal Immune Interactions in Pregnancy. Front Immunol 10, 2729.

[0016] Zhao, W., Lei, A., Tian, L., Wang, X., Correia, C., Weiskittel, T., Li, H., Trounson, A., Fu, Q., Yao, K., et al. (2020). Strategies for Genetically Engineering Hypoimmunogenic Universal Pluripotent Stem Cells. iScience 23, 101162. SUMMARY

[0017] In view of the deficiencies of the prior art, the present application provides a new method for obtaining low immunogenicity by modifying cells, which first adopts the strategy of screening a large number of molecules related to maternal-fetal tolerance and tumor escape, and finally identifies the representative new gene PVR through multiple rounds of functional detection. The gene can significantly reduce or escape the recognition and attack of the immune system, especially the attack of natural killer cells, macrophages and the like. The present application proposes a feasible strategy for realizing the immunoprivilege of cells by transforming new genes in an unpredictable field.

[0018] The present application successfully constructs a B2M / CIITA double-allele knockout positive clone DKO cell by knocking out the beta-2-microglobulin (B2M) in the endoplasmic reticulum of human pluripotent stem cells and knocking out the positive regulator CIITA of MHC-II gene transcription; then overexpressing the new gene PVR identified by the present application in the DKO cell using a lentiviral vector, so that the human pluripotent stem cell obtained can further escape the killing of NK cells on the basis of escaping T cell attack. At the same time, these low immunogenic pluripotent stem cells retain the key biological functions of pluripotent stem cells such as stemness and differentiation ability.

[0019] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0020] In a first aspect, the present application provides a universal cell, which comprises, relative to a wild-type cell:

[0021] 1) reduced or no expression of MHC-I and / or MHC-II human leukocyte antigens;

[0022] 2) an expression sequence of PVR;

[0023] The cell can escape T cell attack and killing by NK cells.

[0024] In some aspects, the cell comprises reduced or no expression of MHC-I and MHC-II human leukocyte antigens.

[0025] In some aspects, the cell further comprises a modification to increase expression of one or more polypeptides selected from the group consisting of: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.

[0026] In some aspects, the reduced or no expression of MHC-I and MHC-II genes is achieved by targeting one or more genes encoding one or more transcriptional regulators of MHC-I and one or more genes encoding one or more transcriptional regulators of MHC-II in the cell using a gene editing tool such as a TALEN and / or a CRISPR system.

[0027] In some embodiments, to achieve the reduced or no expression of MHC-I and MHC-II genes, the transcriptional regulator of MHC-I can be preferably selected from one or more of: B2M, TAP1, TAP2, Tapasin, or NLRC5; and the transcriptional regulator of MHC-II can be preferably selected from one or more of: CIITA, RFXANK, RFX5, RFXAP.

[0028] The transcriptional regulator is preferably B2M and CIITA.

[0029] In certain embodiments, the cell further comprises a genetic modification targeting the CIITA gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene.

[0030] In certain embodiments, the cell further comprises a genetic modification targeting the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.

[0031] In certain embodiments, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.

[0032] In certain embodiments, wherein the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specific targeting of the CIITA gene or the B2M gene.

[0033] In specific embodiments, a CRISPR / CAS9 system is used to perform a double-end direct knockout on the B2M and CIITA exon segments, respectively, wherein the target sequences for the gRNAs against the B2M gene are SEQ ID NO: 2 and SEQ ID NO: 3, and the target sequences for the gRNAs against the CIITA gene are SEQ ID NO: 4 and SEQ ID NO: 5.

[0034] In certain aspects, the reduction or absence of expression of MHC-I and / or MHC-II genes in the cell is achieved by introducing a gene expression modification molecule against one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modification molecule comprises one selected from the group consisting of an siRNA, an shRNA, a microRNA, an antisense RNA and another RNA-mediated inhibitory molecule.

[0035] In certain aspects, the amino acid sequence of the PVR has more than 70% homology to the sequence as set forth in SEQ ID NO: 1, for example more than 80% homology, for example more than 90%, more than 95%, more than 98% homology;

[0036] Further preferably, the amino acid sequence of the PVR is as set forth in SEQ ID NO: 1.

[0037] In certain aspects, the cell is an embryonic stem cell.

[0038] In certain aspects, the cell is a pluripotent stem cell.

[0039] In certain aspects, the cell is an induced pluripotent stem cell.

[0040] In certain embodiments, the cell is a hypoimmunogenic stem cell.

[0041] In certain embodiments, the cell is a human stem cell or a human somatic cell.

[0042] In certain specific embodiments, the cell is a human induced pluripotent stem cell or a human pluripotent stem cell.

[0043] In a second aspect, the present application provides a method for preparing the universal cell of the first aspect, comprising the following steps:

[0044] 1) knocking out one or more genes of one or more transcriptional regulators of MHC-I of the cell; and / or,

[0045] 2) knocking out one or more genes of one or more transcriptional regulators of MHC-II of the cell;

[0046] 3) introducing a nucleic acid sequence encoding a PVR protein into the cell.

[0047] In certain aspects, the transcriptional regulator of MHC-I can be preferably selected from one or more of B2M, TAP1, TAP2, Tapasin or NLRC5; the transcriptional regulator of MHC-II can be preferably selected from one or more of CIITA, RFXANK, RFX5, RFXAP.

[0048] In certain embodiments, the transcriptional regulator is selected from B2M and CIITA.

[0049] In certain aspects, the knocking out of steps 1) and 2) is a genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene or the B2M gene.

[0050] Preferably, the rare-cutting endonuclease is selected from a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.

[0051] Further preferably, wherein the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene.

[0052] In certain embodiments, steps 1) and 2) use the CRISPR system to perform two-end direct knockout on B2M and CIITA exon segments, respectively, wherein the target sequence of gRNA for B2M gene is SEQ ID NO: 2, 3, and the target sequence of gRNA for CIITA gene is SEQ ID NO: 4, 5.

[0053] In certain aspects, the knockout of step 1) or 2) is achieved by introducing a gene expression modification molecule for one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modification molecule comprises one selected from the group consisting of siRNA, shRNA, microRNA, antisense RNA, and another RNA-mediated inhibition molecule.

[0054] In certain aspects, step 3) employs an expression vector to introduce the nucleic acid sequence encoding the PVR protein into the cell.

[0055] Preferably, the expression vector employed in step 3) is a viral vector.

[0056] In certain embodiments, the viral vector employed in step 3) is a lentivirus.

[0057] In certain aspects, step 3) introduces the nucleic acid sequence encoding the PVR protein into a selected site of the cell; preferably, the selected site of the cell is a safe harbor gene site.

[0058] In certain aspects, the amino acid sequence of the PVR has more than 70% homology to the sequence as shown in SEQ ID NO: 1, for example, more than 80% homology, for another example, more than 90%, more than 95%, more than 98% homology;

[0059] Further preferably, the amino acid sequence of the PVR is as shown in SEQ ID NO: 1.

[0060] In certain aspects, the universal cell further comprises a second expression vector comprising a polynucleotide sequence encoding one selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.

[0061] In certain embodiments, the second expression vector is an inducible expression vector; preferably, the second expression vector is a viral vector.

[0062] In a third aspect, the present application provides a method of preparing a differentiated universal cell, comprising culturing a universal cell prepared according to the method of the second aspect under differentiation conditions, thereby preparing a differentiated hypoimmunogenic cell.

[0063] In certain aspects, the differentiation conditions are suitable for differentiating the cell into a cell type selected from the group consisting of a cardiomyocyte, a neural cell, a glial cell, an endothelial cell, a T cell, an NK cell, an NKT cell, a macrophage, a hematopoietic progenitor cell, a mesenchymal cell, an islet cell, a chondrocyte, a retinal pigment epithelial cell, a kidney cell, a hepatocyte, a thyroid cell, a skin cell, a blood cell, and an epithelial cell.

[0064] In a fourth aspect, the present application provides a method of treating a patient in need of cell therapy, comprising administering a population of differentiated hypoimmunogenic cells prepared according to the method of the third aspect.

[0065] In a fifth aspect, the present application provides a composition comprising the universal cell of the first aspect.

[0066] In certain aspects, the composition comprises the universal cell of the first aspect and one or more therapeutic agents, including a peptide, a cytokine, a small molecule compound, a macromolecule, an ADC, an antibody, a nanoparticle, a biosimilar, an mRNA, a traditional Chinese medicine, a protein, a vaccine, a checkpoint inhibitor, a mitogen, a growth factor, a small RNA, a double stranded RNA (dsRNA), a mononuclear blood cell, a feeder cell, a feeder cell component or a replacement factor thereof, a vector comprising one or more polynucleic acids of interest, an antibody, and the like.

[0067] In a sixth aspect, the present application provides a cell expressing PVR protein and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0068] In a seventh aspect, the present application provides a cell not expressing CIITA, expressing PVR protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0069] In an eighth aspect, the present application provides a cell not expressing B2M, expressing PVR protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0070] In a ninth aspect, the present application provides a cell not expressing CIITA and B2M, expressing PVR protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0071] In a tenth aspect, the present application provides a cell expressing a PVR protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0072] In an eleventh aspect, the present application provides a cell not expressing CIITA, expressing a PVR protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0073] In a twelfth aspect, the present application provides a cell not expressing B2M, expressing a PVR protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0074] In a thirteenth aspect, the present application provides a cell not expressing CIITA and B2M, expressing a PVR protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.

[0075] In a fourteenth aspect, the present application provides the cell of any one of the sixth to thirteenth aspects, wherein the cell is selected from the group consisting of a stem cell, a differentiated cell, a pluripotent stem cell, an induced pluripotent stem cell, an adult stem cell, a progenitor cell, a somatic cell, a primary T cell and a chimeric antigen receptor T cell.

[0076] In a fifteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in the manufacture of a product for cell therapy.

[0077] In a sixteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in the manufacture of a product for organ transplantation.

[0078] In a seventeenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in constructing a universal PSC cell bank.

[0079] In an eighteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect as a gene drug carrier.

[0080] Advantages of the present application:

[0081] After inactivating the major histocompatibility complex MHC-I and class II genes in stem cells, the human pluripotent stem cells obtained by overexpressing PVR can further escape the killing of NK cells on the basis of escaping T cell attack, and the effect is similar to that of the positive control WT and DKO+CD47. The effect of the human induced pluripotent stem cells obtained by escaping the killing of NK cells is significantly better than that of the positive control iPSC WT, and can significantly escape the killing of PBMC. At the same time, these pluripotent stem cells with low immunogenicity retain their stemness and differentiation ability. BRIEF DESCRIPTION OF DRAWINGS

[0082] Figure 1 . B2M gene knockout strategy and result graph in human embryonic stem cell line H1;

[0083] Figure 2 . CIITA gene knockout strategy and result graph in human embryonic stem cell line H1;

[0084] Figure 3 . Graph of detecting the expression of B2M and CIITA at RNA level in DKO cells using RT-qPCR in Example 1;

[0085] Figure 4 . Graph of detecting the expression of B2M protein level using Western-blot in Example 1;

[0086] Figure 5 . Graph of detecting the expression of HLA-I / II in various cells by flow cytometry after stimulating wild type H1 (WT) and DKO with INF-gamma in Example 1;

[0087] Wherein, the T cells are positive controls for detecting HLA-I / II class molecules;

[0088] Figure 6 . Karyotype graph of B2M / CIITA double allele knockout positive clone (DKO) obtained in Example 1;

[0089] Figure 7 . Graph of detecting the expression of stemness genes POU5F1 / NANOG / SOX2 at RNA and protein levels in WT and DKO cells using immunofluorescence and RT-qPCR in Example 2;

[0090] Wherein MSC is negative control;

[0091] Figure 8 Figure of expression of SSEA-4 and Tra1-81 in WT and DKO cells by immunofluorescence in Example 2.

[0092] Figure 9 Figure of teratoma with three germ layers of inner, middle and outer layers formed by DKO cells using immunohistochemistry in Example 2;

[0093] Figure 10 Figure of verification of immune function of DKO cells by RTCA in Example 2;

[0094] Figure 11 Figure of pGC-EF1a plasmid structure;

[0095] Figure 12 Figure of expression of CD47 in DKO+CD47 cell line constructed in Example 3 by flow cytometry;

[0096] Figure 13 Figure of killing of DKO+CD47 cell line overexpressing CD47, WT and DKO cells by NK cells by RTCA in Example 3;

[0097] Figure 14 Figure of killing of cell line overexpressing candidate protein, H1 WT (positive control) and H1 DKO cells (negative control) by NK cells by RTCA in Example 4.

[0098] Figure 15 Figure of overexpression of mRNA of DKO+PVR cell line constructed in Example 5 compared with DKO by qPCR.

[0099] Figure 16 Figure of expression of stemness genes in DKO+PVR cell line constructed in Example 5 by immunofluorescence (A) and flow cytometry (B).

[0100] Figure 17 Figure of killing of DKO+PVR cell line overexpressing PVR protein, WT and DKO cells by NK cells by RTCA in Example 5.

[0101] Note: WT, DKO and DKO+PVR in the following Figure 18 , Figure 19 correspond to hiPSC-WT, hiPSC-DKO and hiPSC-DKO+PVR respectively.

[0102] Figure 18Figure of killing results of NK cells on hiPSC-DKO+PVR cell strain overexpressing PVR protein, WT, DKO cells detected by RTCA in Example 6;

[0103] Figure 19 Figure of killing results of PBMC and MAC cells on hiPSC-DKO+PVR cell strain overexpressing PVR protein, WT and DKO cells detected by RTCA in Example 6; DETAILED DESCRIPTION

[0104] The technical solutions of the present application will be further described in detail below in combination with specific examples. It should be understood that the following examples are only illustratively described and explained the present application, and should not be interpreted as limiting the scope of protection of the present application. Any technology realized based on the above content of the present application is covered within the scope of the present application intended to be protected.

[0105] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. The experimental methods in the following examples without specific conditions are generally carried out according to the conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0106] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0107] Example 1. Construction of B2M and CIITA double knockout cell line (DKO)

[0108] 1. Cell culture reagents:

[0109] Table 1

[0110]

[0111] 2. Methods and results:

[0112] The present application selects human pluripotent stem cell line H1 (Wicell, WA01) or H9 (Wicell, WA09), and uses CRISPR / CAS9 to knock out β-2-microglobulin (B2M) in the endoplasmic reticulum, so that the cell surface MHC-I cannot form functional molecules, thereby escaping the killing of allogeneic CD8 + T cells; the escape from the killing of CD4+T cells is by knocking out the positive regulator CIITA of MHC-II gene transcription, and reducing the expression of MHC-II class molecules.

[0113] CRISPR / CAS9 gene knockout strategy of B2M is shown in Figure 1 B2M-gRNA1 and B2M-gRNA2 were used to knockout both ends of B2M exon segment, and then B2M-F1 / R1 and B2M-F2 / R2 were used to verify the knockout of genome sequence, respectively.

[0114] gRNA sequence:

[0115] B2M-gRNA1: CGTGAGTAAACCTGAATCTT

[0116] B2M-gRNA2: AGTCACATGGTTCACACGGC

[0117] Identification primer

[0118] B2M-F1: TGGGGCCAAATCATGTAGACTC

[0119] B2M-R1: TCAGTGGGGGTGAATTCAGTGT

[0120] B2M-F2+B2M-R2 = 608bp

[0121] After knockout: no band

[0122] B2M-F2: CAGAAGTCCTTGAGAGCCTCC

[0123] B2M-R2: TGTGCATCAGTATCTCAGCAGG

[0124] B2M-F2+B2M-R2 = 812bp

[0125] After knockout: 569bp.

[0126] In addition, the CRISPR / CAS9 gene knockout strategy of CIITA is shown in Figure 2 CIITA-gRNA1 and CIITA-gRNA2 were used to knockout both ends of CIITA exon segment, and then CIITA-F1 / R1 and CIITA-F2 / R2 were used to verify the knockout of genome sequence, respectively.

[0127] gRNA sequence:

[0128] CIITA-gRNA1: GATATTGGCATAAGCCTCCC

[0129] CIITA-gRNA2: CATCGCTGTTAAGAAGCTCC

[0130] Identified primers:

[0131] CIITA-F1: CTGTGCCTCTACCACTTCTATG

[0132] CIITA-R1: CCTTCCATGTCACACAACAGCC

[0133] CIITA-F1 + CIITA-R1 = 368bp

[0134] After knockout: no band

[0135] CIITA-F2: TGGAATCCACACTTTCCAGTTC

[0136] CIITA-R2: TGGAGTCTCCGTTCCTCCAG

[0137] CIITA-F2 + CIITA-R2 = 889bp

[0138] After knockout: 459bp

[0139] The specific operation is as follows:

[0140] 1) Culture human pluripotent stem cells to 80% density on Matrigel-coated 6-well plates using mTeSR1 normally. After digestion with TRYPLE, neutralize in DMEM / F12, count. Take 2x10 6 Cells in EP tubes, centrifuged, discard the supernatant.

[0141] 2) According to the 100 μL electroporation system of Neon transfection system, add 15 μg TrueCut TM Cas9 Protein + 3 μg gRNA (B2M gRNA1 + B2M gRNA2 + CIITA gRNA1 + CIITA gRNA2) to form an RNP system, mix and stand at room temperature for 20 min.

[0142] 3) Resuspend the cells in 100 μL RNP electroporation system, and perform electroporation with the Neon transfection system. The electroporation parameters are 1200V, 30ms, 1 pause. After electroporation, quickly add preheated culture medium to the cells, and evenly inoculate in 1 hole of Matrigel-coated 6-well plate.

[0143] 4) Replace fresh mTeSR1 culture medium every day. When the single cells grow up, pick single clones in 48-well plates. After the clones are expanded, collect genomic samples to detect gene editing, and the PCR results are as follows: Figure 1 and 2Positive PCR clones were sent to the company for Sanger sequencing for further validation.

[0144] 5) Positive B2M / CIITA bi-allelic knockout clones DKO were identified and expanded for culture and cryopreservation.

[0145] qPCR was used to detect the expression of B2M and CIITA at RNA level in B2M / CIITA bi-allelic knockout clones DKO, as shown in Figure 3

[0146] B2M-F: AAGATGAGTATGCCTGCCGT

[0147] B2M-R: ATGCGGCATCTTCAAACCTC

[0148] CIITA-F: CCTGGAGCTTCTTAACAGCGA

[0149] CIITA-R: TGTGTCGGGTTCTGAGTAGAG

[0150] Western-Blot was used to detect the expression of B2M protein level in B2M / CIITA bi-allelic knockout clones DKO, as shown in Figure 4

[0151] INF-gamma was used to stimulate WT and DKO: cells were plated, and the next day when the medium was changed, the medium containing INF-gamma was added to the cells. After 48h, the cells were digested and flow cytometry was used to detect the expression of HLA-I / II. The results are shown in Figure 5 Figure 6, which shows that B2M / CIITA bi-allelic knockout stem cell positive clones (DKO) cannot express HLA-I / II class molecules in response to INF-gamma stimulation. T cells are positive controls for detecting HLA-I / II class molecules.

[0152] Karyotype analysis was performed on the obtained B2M / CIITA bi-allelic knockout positive clones (DKO): the chromosome samples fixed on the glass slides were treated with trypsin, and then stained with Giemsa staining solution. The metaphase chromosomes were analyzed for chromosome number and morphological structure to determine whether their karyotype was consistent with the normal karyotype. The results are shown in Figure 6 Figure 7, which shows that the karyotype of DKO is normal.

[0153] Example 2. Verification of the stemness and immune function of the DKO cell line in Example 1

[0154] 1. Expression of stemness genes in WT and DKO cells

[0155] ​​Immunofluorescence detection showed that WT and DKO cells expressed the stemness genes POU5F1 and NANOG at the protein level: Cells were plated in 12-well plates, and after the cells grew to 60-80% density, the culture medium was removed and 4% paraformaldehyde was added for fixation. After the cell membrane was broken, the primary antibodies of POU5F1 and NANOG were incubated at 4°C overnight, and after the primary antibodies were washed, the secondary antibodies with fluorescent labels were incubated at room temperature, and then a fluorescence microscope was used for photography. The results are shown in Figure 7 RT-qPCR detection showed that WT and DKO cells expressed the stemness genes POU5F1, NANOG and SOX2 at the RNA level: The results are shown in Figure 7 B. (MSCs are negative controls for stemness gene expression)

[0156] Flow cytometry results showed that WT and DKO cells highly expressed stemness genes SSEA-4 and Tra1-81 on the cell surface, accounting for 100%, 99.98% and 96.75%, 99.13%, respectively. The results are shown in Figure 8 .

[0157] 2. Differentiation ability of the obtained B2M / CIITA double allele knockout positive clone (DKO)

[0158] The immunodeficient mice (SCID Beige) were subcutaneously injected with 100 μL of a suspension containing 5E+5 DKO cells, and after the teratoma volume was greater than 1.5 cm 3 , it was removed and sectioned and stained.

[0159] The obtained B2M / CIITA double allele knockout positive clone (DKO) can form teratomas in vivo and differentiate into cells of the three germ layers. The results are shown in Figure 9 .

[0160] 3. Verification of the immune function of DKO cells

[0161] The killing experiments of T cells and NK cells used xCELLigence RTCA Instrument. The same number of WT and DKO cell lines were resuspended using Essential 8 medium containing IL-2 and inoculated in 96-well E-plates coated with Matrigel, and activated T cells or NK cells were added for killing detection. The RTCA detection data were analyzed using xCELLigence software to calculate the killing rate and escape function.

[0162] Table 2

[0163] Name Cat No. Size Manufacturer PE anti-human CD4 980804 500ul / tube Biolegend APC anti-human CD8 980904 500ul / tube Biolegend FITC anti-human CD3 300440 500tests Biolegend APC anti-human CD16 301012 100tests Biolegend PE anti-human CD56(NCAM) 318306 100tests Biolegend human IL-2 202-1L-050 / CF 50ug R&D Y-27632 2HCl S1049 5mg Selleck Matrigel 354277 5ml Gibco Essential 8 TM culture medium A1517001 500ml Gibco E-Plate VIEW 96PET 300601030 6wells / box Agilent

[0164] As Figure 10RTCA data showed that WT cells escaped from NK cell killing due to the expression of HLA-I, but were killed by T cells. DKO cells could escape from T cell killing, and were more sensitive to NK cell killing.

[0165] Example 3. Construction of DKO+CD47 cell line and verification of immune function

[0166] The DKO cells obtained in Example 1 were used to overexpress CD47 (NM_198793) using a lentiviral vector, and the amino acid sequence of CD47 is shown as SEQ ID NO. 18. The cDNA (SEQ ID NO. 19) of the overexpression sequence was constructed in a lentiviral plasmid (pGC-EF1a) with an EF1a promoter and a puromycin selection marker. The structure of the pGC-EF1a plasmid is shown as Figure 11 The plasmid was digested with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and perform virus packaging. The DKO human pluripotent stem cells constructed in Example 2 were transfected, and the medium was changed 24h later. After 48h, the medium containing puromycin was used for selection. The results of the constructed stable DKO+CD47 cell line are shown as Figure 12 After confirming the correct expression, the cells were expanded and subjected to subsequent functional detection.

[0167] Referring to Example 2, the overexpressed DKO+CD47 cell line was detected using RTCA to determine whether it could escape from T cell killing while successfully escaping from NK cell killing, as shown in Figure 13 The NK cells can effectively kill the DKO cells, and the WT and DKO+CD47 overexpressed cells can escape from NK killing.

[0168] Example 4. Screening of universal cells expressing molecules containing fetal-maternal tolerance and tumor immune escape proteins

[0169] Construction strategy and screening of each molecule protein of the present application:

[0170] A total of 22 candidate targets were screened, and their amino acid and cDNA sequences are shown in Table 3. The candidate targets are related to fetal-maternal tolerance or tumor immune escape, among which:

[0171] Molecules related to fetal-maternal tolerance: HLA-E, HLA-G, CTLA4-Ig.

[0172] Inhibitory immune receptors (immune checkpoints) expressed by tumors: MICA, MICB, ULBP1, ULBP2, ULBP3, CTLA4-Ig, C1-Inhibitor, PVR, CD46, CD55, CD59, CD20, HER2.

[0173] Regulators involved in the tumor microenvironment: TDO, IDO1, IDO2, IL-10, IL37, IL-12A, IL-35B.

[0174] Table 3

[0175]

[0176]

[0177] Reprogram pluripotent stem cells with natural immune suppression mechanisms to confer low immunogenicity, but these types of methods rely on immune inhibitory receptor-ligand pairs or specific microenvironments, and whether they exist on transplanted cells and immune cells, so introducing these genes alone may not necessarily result in complete low immunogenicity, which requires functional confirmation through actual detection (Zhao et al., 2020).

[0178] DKO cells obtained in Example 1 were overexpressed with lentiviral vectors, respectively, 22 candidate targets screened this time, the amino acid sequences of which are shown in Table 3, and the cDNA of the overexpression sequence (sequences are shown in Table 3) was constructed in a lentiviral plasmid (pGC-EF1a) driven by EF1a promoter and with puromycin selection marker. The structure of the pGC-EF1a plasmid is shown in Figure 11 The plasmid was cut with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and perform virus packaging. The DKO human pluripotent stem cells constructed in Example 2 were transfected, the medium was changed at 24 h, and the medium containing puromycin was changed at 48 h for screening. The stably transfected strains of the 22 candidate targets were subjected to multiple NK in vitro killing experiments (n≥5), and the candidate new target with the best escape ability to NK cells was screened. The relative killing ratio was normalized to the negative control H1 DKO cells, and was summarized at high (high: E:T = 2:1) and low (low: E:T = 1:1 or 0.5:1) NK ratios (E:T). The killing ratio is less than 1, indicating that it has escape ability relative to DKO, and the lower the ratio, the stronger the escape ability. The positive control is H1 WT and H1 DKO+CD47 constructed in Example 3. The results are shown in Figure 14 The results are shown in

[0179] Example 5. Construction of DKO+PVR cell line and verification of immune function

[0180] 1. Construction of DKO+PVR cells and detection of overexpression

[0181] The nucleic acid sequence encoding PVR (the amino acid sequence of PVR is shown in NP_006496.4) (NM_006505.5) was directly synthesized and constructed in a lentiviral plasmid (pGC-EF1a) with an EF1a promoter and a puromycin selection marker. The structure of the pGC-EF1a plasmid is shown in Figure 11 . The plasmid was digested with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and to perform virus packaging. After transfection of the DKO human pluripotent stem cells obtained in Example 2, the medium was replaced with a medium containing puromycin for selection. The DKO+PVR cells constructed were detected for mRNA overexpression levels using qPCR, with DKO cells as a negative control. The results are shown in Figure 15 .

[0182] PVR F1: GTTTGGACTCCGAATAGCTGG

[0183] PVR R1: GTTGCGCGTAGAGGATGAAG

[0184] 2. Expression of stemness genes in DKO+PVR cells

[0185] Referring to Example 2, immunofluorescence detection showed that the DKO+PVR cells expressed stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 at the protein level. The results are shown in Figure 16 A. Flow cytometry results showed that the DKO+PVR cells highly expressed stemness genes SSEA-4, OCT4, TRA-1-60, and Tra1-81 on the cell surface, accounting for 99.20%, 97.92%, 99.69%, and 97.93%, respectively. The results are shown in Figure 16 B.

[0186] 3. Detection of immune function of DKO+PVR cells

[0187] After confirming the construction of DKO+PVR cells and the correct expression of stemness, the cells were expanded and subjected to subsequent functional detection. Referring to Example 2, in the NK cell killing experiment detected by RTCA, the DKO cells constructed in Example 2 were completely killed by NK cells, and H1WT and DKO+PVR successfully escaped. The results are shown in Figure 17 .

[0188] Example 6. In vitro detection of escape of hiPS DKO+PVR from killing by the immune system

[0189] In this embodiment, hiPSC-DKO and hiPSC-DKO+PVR were prepared from human induced pluripotent stem cells (hiPSC cells, i.e. Figure 18-19 WT cells) according to the methods described in Examples 1 and 5. TM CytoTune TM -iPS 2.1 Sendai virus reprogramming kit (Thermo Fisher Scientific Inc Cat No: A34546) to prepare). hiPSC-DKO (i.e. Figure 18-19 DKO cells) and hiPSC-DKO+PVR (i.e. Figure 18-19 DKO+PVR cells) were obtained.

[0190] 1. Verification of escape from NK cell killing function

[0191] NK cell killing assay was performed on XCelligence platform (ACEA BioSciences). Each type of hiPSC cells was resuspended in 100 μl cell-specific medium and plated on 96-well E-plates (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, NK cells were added at an E:T ratio of 1:1. The data were standardized and analyzed using RTCA software (ACEA). As shown in Figure 18 , hiPSC-DKO+PVR cells can significantly escape from NK killing, and the escape effect is better than that of WT cells.

[0192] 2. Verification of escape from PBMC and macrophage (MAC) killing function

[0193] NK activating factors were added in advance in PBMC to improve the proportion of NK in PBMC and the killing performance of T cells. Activated mixed lymphocytes (PBMC) were used as effector cells for RTCA experiments to comprehensively evaluate the immune escape ability of hiPSC-DKO+PVR cells (for reference, PMID: 33309274). PBMC and MAC cell killing assay was performed on XCelligence platform (ACEA BioSciences). Each type of hiPSC cells was resuspended in 100 μl cell-specific medium and plated on 96-well E-plates (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, PBMC and MAC cells were added at an E:T ratio of 2:1 and 3:1. The data were standardized and analyzed using RTCA software (ACEA). As shown in Figure 19As shown, hiPSC-DKO+PVR cells can significantly escape killing by PBMCs.

[0194] The above describes the embodiments of the present application. However, the present application is not limited to the above-described embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. A universal cell, characterized in that, comprising: 1) reduced expression or no expression of MHC-I and MHC-II human leukocyte antigens; 2) overexpression of PVR; the amino acid sequence of the PVR is shown as SEQ ID NO: 1; the cell is human embryonic stem cell line H1 or human induced pluripotent stem cell; the cell has a genetic modification targeting a transcriptional regulator encoding MHC-I and a transcriptional regulator encoding MHC-II using a gene editing tool to achieve reduced expression or no expression of MHC-I and MHC-II genes; the transcriptional regulators are B2M and CIITA.

2. The universal cell of claim 1, wherein, the cell further comprises a genetic modification targeting the CIITA gene by a rare-cutting endonuclease selectively inactivating the CIITA gene, and the cell further comprises a genetic modification targeting the B2M gene by a rare-cutting endonuclease selectively inactivating the B2M gene.

3. The universal cell of claim 2, wherein, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.

4. The universal cell of claim 3, wherein, the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene.

5. The universal cell of claim 4, wherein, the CRISPR / CAS9 system is used to perform a two-end direct knockout on the B2M and CIITA exon segments, respectively, wherein the target sequences of the guide ribonucleic acid sequence gRNA for the B2M gene are SEQ ID NO: 2 and 3, and the target sequences of the guide ribonucleic acid sequence gRNA for the CIITA gene are SEQ ID NO: 4 and 5.

6. A method for preparing the universal cell according to any one of claims 1 to 5, characterized in that, comprising the following steps: 1) knocking out the transcriptional regulator B2M of MHC-I of the stem cell; 2) knocking out the transcriptional regulator CIITA of MHC-II of the stem cell; 3) introducing a nucleic acid sequence encoding a PVR protein into the cell.

7. The preparation method according to claim 6, characterized in that, the knocking out of step 1) or 2) is a genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease selectively inactivating the CIITA gene or the B2M gene, and the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.

8. The preparation method according to claim 7, characterized in that, the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene.

9. The production method according to claim 8, characterized by, the CRISPR system is used to perform a two-end direct knockout on the B2M and CIITA exon segments, respectively, wherein the target sequences of the gRNA for the B2M gene are SEQ ID NO: 2 and 3, and the target sequences of the gRNA for the CIITA gene are SEQ ID NO: 4 and 5.

10. The method of claim 6, wherein, the step 3) introduces the nucleic acid sequence encoding the PVR protein into the cell using an expression vector.

11. The method of claim 10, wherein, the expression vector used in the step 3) is a viral vector.

12. The method of claim 11, wherein, the viral vector is a lentivirus.

13. The preparation method according to claim 6, characterized in that, Step 3) introducing the nucleic acid sequence encoding the PVR protein into a selected site of the cell.

14. The method of claim 13, wherein, The selected site of the cell is a safe harbor gene site.

15. A method of preparing a differentiated universal cell, comprising culturing the universal cell of any one of claims 1-5 under differentiation conditions, thereby preparing a differentiated hypoimmunogenic cell.

16. The method of claim 15, wherein the differentiation conditions are suitable for differentiating the cell into a cell type selected from the group consisting of a cardiomyocyte, a neural cell, a glial cell, an endothelial cell, a T cell, an NK cell, an NKT cell, a macrophage, a hematopoietic progenitor cell, a mesenchymal cell, an islet cell, a chondrocyte, a retinal pigment epithelial cell, a kidney cell, a hepatocyte, a thyroid cell, a skin cell.

17. A composition characterized in that, The composition comprises the universal cell of any one of claims 1-5.

18. The composition of claim 17, wherein, The composition further comprises one or more therapeutic agents, comprising a cytokine, a checkpoint inhibitor, a mitogen, a growth factor, a small RNA, a double-stranded RNA, a mononuclear blood cell, a feeder cell or a replacement factor thereof, a vector comprising one or more polynucleic acids of interest, an antibody.

19. Use of the universal cell of any one of claims 1-5, the composition of claim 17 or 18 in the manufacture of a product for cell therapy.

20. Use of the universal cell of any one of claims 1-5, the composition of claim 17 or 18 in the manufacture of a product for organ transplantation.

21. Use of the universal cell of any one of claims 1-5, the composition of claim 17 or 18 in the construction of a universal PSC cell bank.

22. Use of the universal cell of any one of claims 1-5, the composition of claim 17 or 18 in the manufacture of a gene drug carrier.

Images