Indel Molecular Marker Primers for Identifying the Yellow-Green Leaf Phenotype of Wucai and Their Application

Abstract

The present invention provides an Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai and its application, which relates to the technical field of molecular markers. The Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai includes an upstream primer Indel2 - F and a downstream primer Indel2 - R. The nucleotide sequence of Indel2 - F is shown as SEQ ID NO.1, and the nucleotide sequence of Indel2 - R is shown as SEQ ID NO.2. By obtaining the DNA of wucai, using the aforementioned Indel molecular marker primer to perform PCR amplification on the DNA of wucai, and detecting the amplification result by gel electrophoresis, the leaf color phenotype of wucai is judged according to the detection result. This application can quickly judge the leaf color phenotype of wucai, and the operation is simple, which helps to improve the breeding efficiency, reduce the breeding cost and cycle.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly relates to an Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai and its application. Background Art

[0002] Wucai, also known as Tacai, Heicai, Takokcai, Tadisong, etc., is a variant of the Chinese cabbage subspecies in the genus Brassica of the Brassicaceae family. It is also known as the "vitamin vegetable" because it is rich in vitamins and is a major leafy vegetable in the Jianghuai region of China in autumn and winter. With the development of natural mutations and artificial domestication, different leaf - colored wucai varieties such as yellow and purple have been cultivated for consumers to choose, and the diversity of leaf colors caters to the needs of consumers to varying degrees.

[0003] Green wucai is the most common in life. However, for wucai with different leaf colors, consumers tend to choose the yellow - green variety. Its color is beautiful and the taste is more delicious. To meet the market demand, it is very important to cultivate yellow - green wucai varieties with higher ornamental and edible values. Obtaining molecular markers related to the yellow - green leaf trait of wucai can accelerate the breeding process, quickly and accurately identify yellow - green wucai varieties at the seedling stage, and save costs.

[0004] Therefore, developing molecular markers related to wucai leaf color genes has certain significance for studying wucai yellow - green genes and yellow - green traits. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the present invention provides an Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai and its application, so as to solve the problem in the prior art that there is a lack of molecular markers that can quickly judge the leaf color phenotype of wucai.

[0006] To achieve the above - mentioned purposes, the present invention is realized through the following technical solutions:

[0007] In the first aspect of the present invention, an Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai is provided. The Indel molecular marker primer includes an upstream primer Indel2 - F and a downstream primer Indel2 - R. The nucleotide sequence of Indel2 - F is as shown in SEQ ID NO.1, and the nucleotide sequence of Indel2 - R is as shown in SEQ ID NO.2.

[0008] In the second aspect of the present invention, an application of the above - mentioned Indel molecular marker primer for identifying the yellow - green leaf phenotype of wucai in identifying or assisting in identifying the yellow - green leaf phenotype of wucai is also provided.

[0009] In the third aspect of the present invention, a method for identifying the yellow - green leaf phenotype of wucai is also provided. The method includes:

[0010] Obtain the DNA of wucai;

[0011] Perform PCR amplification on the obtained wucai DNA with the above Indel molecular marker primers;

[0012] When the amplification result is only a single characteristic band of 168 bp, the corresponding leaf color phenotype of wucai is yellowish green;

[0013] When the amplification result contains a characteristic band of 146 bp, the corresponding leaf color phenotype of wucai is green.

[0014] Furthermore, when the amplification result is only a single characteristic band of 146 bp, the corresponding leaf color phenotype of wucai is green, and the genotype of this wucai is a homozygous genotype;

[0015] When the amplification result is two characteristic bands with lengths of 168 bp and 146 bp respectively, the corresponding leaf color phenotype of wucai is green, and the genotype of this wucai is a heterozygous genotype.

[0016] Furthermore, the system for PCR amplification is: 5 μL of Taq enzyme, 3.4 μL of dd H 2 O, 1 μL of wucai DNA, and 0.3 μL each of the upstream and downstream primers constituting the Indel molecular marker primer pair.

[0017] In the fourth aspect of the present invention, there is also provided a kit for identifying or assisting in identifying the leaf color phenotype of wucai, and the kit includes the above Indel molecular marker primers.

[0018] Furthermore, it also includes the reagents required for PCR reaction and / or electrophoresis.

[0019] In the fifth aspect of the present invention, there is also provided an application of the above kit in identifying or assisting in identifying the leaf color phenotype of wucai.

[0020] An Indel molecular marker primer for identifying the yellowish green phenotype of wucai leaves and its application provided by the present invention, compared with the prior art, has the following beneficial effects:

[0021] The Indel molecular marker primers involved in the present application can be used to quickly judge the phenotype of the corresponding wucai leaf color, which is helpful for carrying out relevant genetic breeding work; it avoids the defects such as long time-consuming in genetic breeding in the prior art, and has important significance for the genetic breeding of wucai. Description of the Drawings

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0023] Figure 1 It is a comparison chart of the colors of the adult plants of the black mustard varieties W7-1 and W7-2 in the embodiment;

[0024] Figure 2 It is a comparison chart of the color difference values of the black mustard varieties W7-1 and W7-2 in the embodiment; in the figure, the leftmost one is the comparison of red and green color values, the second from the left is the comparison of yellow and blue color values, and the third from the left is the comparison of lightness values;

[0025] Figure 3 It is the gel electrophoresis pattern obtained in Example 1;

[0026] Figure 4 It is the gel electrophoresis pattern obtained in Example 2. Detailed implementation manners

[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of them. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0028] To solve the problem in the prior art that there is a lack of molecular markers for quickly judging the yellow-green phenotype of the black mustard leaves, the main idea of this application is as follows:

[0029] Provide an Indel molecular marker primer for identifying the yellow-green phenotype of black mustard leaves, which is used to detect or assist in detecting the phenotype of the black mustard leaf color, and provide a corresponding identification method.

[0030] With the above-mentioned Indel molecular marker primer for identifying the yellow-green phenotype of black mustard leaves, it can be used to quickly judge the phenotype of the black mustard leaf color, which helps to improve the judgment efficiency of the black mustard leaf color phenotype. At the same time, this Indel molecular marker is of great significance to the genetic breeding of black mustard.

[0031] To understand the technical solutions of this application more clearly, the following will introduce the technical solutions of this application in detail in combination with specific embodiments and the drawings in the specification.

[0032] Example 1

[0033] This example aims to introduce the development process of Indel molecular marker primers for identifying the yellow-green leaf phenotype of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee, and the specific process includes:

[0034] Step 1: Select the inbred line W7-1 with normal green leaf color of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee as the male parent, and the yellow-green Brassica campestris L. ssp. chinensis var. communis Tsen et Lee W7-2 as the female parent to construct a segregating population, and investigate the segregation pattern of leaf color and finely map the yellow-green leaf color; The comparison chart of the colors of W7-1 and W7-2 at the adult stage is as Figure 1 .

[0035] Through the above operations, it was determined that the candidate gene for the leaf color mutation trait is located within the 1.05 Mb interval between the Indel1 and Indel3 markers on chromosome 10, and its physical position on the chromosome is between 12616085 - 13669963 bp.

[0036] Specifically, it includes:

[0037] (1) Use W7-1 and W7-2 as parents to construct a genetic population to obtain the F 1 generation. Backcross the F 1 generation plants with both parents respectively to obtain the BC 1 and BC 2 generations. At the same time, self-cross the F 1 generation to obtain the F 2 generation. When 45 days have passed after transplantation, that is, at the adult stage, observe the phenotypes of the F 1 generation, BC 1 generation, BC 2 generation, and F 2 generation plants, and measure the color difference value.

[0038] Among them, the comparison chart of the color difference values of W7-1 and W7-2 at the adult stage is as Figure 2 . In the figure, A* represents red-green, and the numerical change from positive to negative indicates that the color changes from red (positive) to green (negative), and the smaller the value, the greener the color. B* represents yellow-blue, and the numerical change from positive to negative indicates that the color changes from yellow (positive) to blue (negative), and the larger the value, the yellower the color. L* represents lightness, with a range from 0 to 100, indicating that the color changes from dark (black) to light (white), and the larger the value, the more transparent the color. The results show that there are significant differences in the A, B, and L values between W7-1 and W7-2. Compared with W7-1, the A*, L*, and B* of W7-2 are significantly higher than those of W7-1.

[0039] For those with A, B, and L values of the color difference data measured in the F 1 generation, BC 1 generation, BC 2 generation, and F 2 generation populations that are similar to W7-1, they are determined to be green, and those with results similar to W7-2 are determined to be yellow-green, and the segregation of yellow-green leaf plants and green leaf plants is statistically analyzed. Using the chi-square (χ2 )The test examines the segregation ratio.

[0040] The results showed that the F 1 population consisted of all green-leaf single plants; the BC 1 population had a total of 92 single plants, without any yellowish-green leaf single plants, and all 92 were green-leaf single plants; the BC 2 population had 95 single plants surveyed, among which 43 were green-leaf plants and 52 were yellowish-green leaf single plants, and the segregation ratio was 1:1.21; the F 2 population had a total of 2096 single plants, among which 1622 were green single plants and 474 were yellowish-green single plants, and the segregation ratio of green single plants to yellowish-green single plants was 3.42:1, conforming to Mendel's genetic law (Table 1).

[0041] Based on the analysis of the above data statistics results, the yellowish-green leaf trait of W7-2 is a qualitative trait regulated by a single recessive gene.

[0042] Table 1

[0043]

[0044] (2) BSA-seq analysis

[0045] 2.1.1 Construction of BSA mixed pools

[0046] F 2 In the population, 54 yellowish-green leaf single plants and 100 green single plants were respectively selected to construct two extreme pools of mutants and wild types. Whole-genome sequencing was performed on the two parents and the two mixed pools respectively. The results showed that 95398144, 82661938, 95377472, and 88701376 Raw reads were obtained from the samples of the two parents (P1-GW and P1-YW) and the two extreme pools (Y pool and G pool) respectively. Then, the base quality of the sequencing of each sample was investigated. The results showed that the proportion of bases with a quality value greater than Q20 in Clean_Base reached more than 99%, and the proportion of bases with a quality value greater than Q30 in Clean_Base reached more than 90%. This indicates that the sequencing results are reliable and the confidence level is relatively high.

[0047] 2.1.2 Linkage mapping analysis

[0048] During the construction of the segregating population, the offspring are selected according to their phenotypes, and the mutant offspring pool and wild-type offspring pool are screened out. According to the law of genetic linkage and exchange, the genotypes of the offspring pool will co-segregate with the phenotypes. At the physical map level, the chromosomal segments linked to the phenotypes will show stable SNP-index differences from the unlinked chromosomal regions. Finally, the yellow-green leaf gene of Brassica campestris ssp. chinensis var. rosularis was initially mapped within the 9.15 Mb interval of chromosome 10, and the mapped linkage region was HiC_scaffold_10:8020083-17177305.

[0049] 2.2 Using KASP technology and InDel molecular markers to narrow the mapped interval

[0050] Primers were designed for the candidate loci obtained by BSA-seq analysis, and the number of recombinant individuals was counted to shorten the interval. To further shorten the interval, specific primers were designed and verified for the identified SNP loci, and KASP markers were developed. The genomic DNA of the two parents, F1, and F2 populations was extracted using the improved CTAB method, and PCR reactions were set up using KASP Master mix. The fluorescence data were read and analyzed, and the mapped interval was narrowed based on the linkage analysis between the traits and genotypes.

[0051] Based on the above operations, new InDel markers were developed, and finally the interval was shortened to within the 1.05 Mb interval between InDel1 and InDel3 markers, with a physical position on the chromosome between 12616085-13669963 bp.

[0052] Through sequence analysis of the two parents, it was found that there was an Indel2 of 22 bp (SEQ ID NO.3: TTTACAGATTAAAAAAAAAAGA) at position 12721825 bp on chromosome 10 of the DNA genome of Brassica campestris ssp. chinensis var. rosularis.

[0053] Step 2. Development and verification of InDel2 molecular markers

[0054] Using SnapGene software, primers for the Indel2 molecular marker were designed for the above 22 bp Indel2. Among the designed primers for the Indel2 molecular marker:

[0055] The upstream primer is Indel2-F (SEQ ID NO.1):

[0056] 5’-ATCTCCAAGGCAGAAGATTGATACA-3’;

[0057] The downstream primer is Indel2-R (SEQ ID NO.2):

[0058] 5’-TGGTATCAGTCGGTCCATACTCAT-3’.

[0059] Using the InDel2 molecular marker primers, the two parents W7-1 and W7-2, as well as 22 F 2 single plants were amplified. That is, the DNA of the corresponding plants was used as a template (obtained from the leaves of seedlings), and the above-mentioned Indel2 molecular marker primers were used for amplification (the primers were synthesized by General Biosystems). The samples were loaded according to the system in Table 2 (the extension time for each cycle was 15 sec, the annealing temperature was 59 °C, and 34 cycles were performed), and the PCR products were synthesized. The obtained products were identified by 2.5% agarose gel electrophoresis ( Figure 3 ), with a voltage of 120 V, a current of 400 mA, and a time of 55 min.

[0060] Table 2

[0061]

[0062] Combined Figure 3 It can be obtained that 1 is W7-1, with a homozygous genotype (green, and the corresponding amplification result is a specific band with a length of 146 bp, and its nucleotide sequence is SEQ ID NO.4); 2 is W7-2, with a homozygous genotype (yellowish-green, and the corresponding amplification result is a specific band with a length of 168 bp, and its nucleotide sequence is SEQ ID NO.5, and the 22 bp Indel2 is located at positions 49 to 70 bp in this sequence); F1 has a heterozygous genotype (green, and the corresponding amplification result is two specific bands with lengths of 146 bp and 168 bp respectively); the yellowish-green single plants in the F2 population, such as Y1, Y2, Y3, Y4, Y6, Y7, Y8, Y9, and Y10, all have homozygous genotypes; the green single plants G5, G11, and G12 have heterozygous genotypes.

[0063] Example 2

[0064] Functional verification of the Indel2 molecular marker primers

[0065] Twenty-four wucai materials were identified. Using the DNA of each wucai material as a template, PCR amplification was performed with the aforementioned Indel molecular marker primers (the amplification system was as in Table 2 above), and the electrophoresis detection results are as Figure 2 shown.

[0066] Figure 2 as follows:

[0067] 1 is W7-1, and for the remaining 13 materials (No. 3 (W16-6-4-1-1), 4 (W19-21-1), 5 (W18-1-2-4), 6 (NH-8-2), 7 (NH-111-3), 8 (W15-8-26-1), 9 (WS-7-5-1), 10 (NH-120-2), 11 (WS19-10-3), 12 (NH58-1), 21 (NH228-5), 23 (NH2-119), 24 (NH69-5)), there are only PCR products with a length of 146 bp, which conform to the characteristics of green wucai;

[0068] 2 is W7-2, and for the remaining 9 materials (No. 13 (12-1-2-3-2), 14 (WS-5-4-2-1-1), 15 (W16-1-4-5), 16 (W16-15-1-1), 17 (W20-22), 18 (W16-15-1-1), 19 (WS-15-21-2), 20 (HWH-3), 22 (HW4-2-9-5)), there are only PCR products with a length of 168 bp, which conform to the characteristics of yellow-green wucai.

[0069] Comparing the above molecular marker identification results with the leaf colors of the actual plants, the results show that 13 materials (No. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 21, 23, 24) are green wucai materials, and the agarose gel electrophoresis results are consistent with the green phenotype; 9 materials (No. 13, 14, 15, 16, 17, 18, 19, 20, 22) are yellow-green wucai materials, and the agarose gel electrophoresis results are consistent with the yellow-green phenotype.

[0070] Therefore, it can be seen that the Indel2 molecular marker primer can be used as a marker to distinguish whether the leaf color of wucai materials is green or yellow-green, with high accuracy.

[0071] In summary, an Indel molecular marker primer for identifying the yellow-green phenotype of wucai leaves provided by this application and its application have the following beneficial effects compared with the prior art:

[0072] 1. It can be used for quickly identifying the yellow-green phenotype of wucai leaves, improving the identification efficiency;

[0073] 2. It is of great significance for cultivating new wucai varieties and is convenient for genetic breeding.

[0074] It should be noted that, in this document, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements, but also includes other elements not explicitly listed, or further includes elements inherent to such process, method, article or device. Without further limitation, an element defined by the statement "including one..." does not exclude the existence of additional identical elements in the process, method, article or device including the said element.

[0075] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for identifying the yellow - green leaf phenotype of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee, characterized in that, the method comprises: obtaining the DNA of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee; performing PCR amplification on the obtained DNA of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee with Indel molecular marker primers, wherein: when the obtained amplification result is only a single characteristic band of 146 bp, the corresponding leaf color phenotype of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee is green, and the genotype of this Brassica campestris L. ssp. chinensis var. communis Tsen et Lee is a homozygous genotype; when the obtained amplification result is two characteristic bands with lengths of 168 bp and 146 bp respectively, the corresponding leaf color phenotype of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee is green, and the genotype of this Brassica campestris L. ssp. chinensis var. communis Tsen et Lee is a heterozygous genotype; when the obtained amplification result is only a single characteristic band of 168 bp, the corresponding leaf color phenotype of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee is yellow - green; the Indel molecular marker primers include the upstream primer Indel2 - F and the downstream primer Indel2 - R. The nucleotide sequence of Indel2 - F is shown in SEQ ID NO.1, and the nucleotide sequence of Indel2 - R is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that, the system for PCR amplification is: 5 μL Taq enzyme, 3.4 μL ddH2O, 1 μL DNA of Brassica campestris L. ssp. chinensis var. communis Tsen et Lee, and 0.3 μL each of the upstream and downstream primers constituting the Indel molecular marker primer pair.

Images