Universal fluorescent platform capable of realizing minute-level DNA companion logic operation and preparation method and application thereof

Abstract

The application relates to a universal fluorescence platform capable of realizing minute-level DNA companion logic operation and a preparation method and application thereof, and belongs to the technical field of fluorescence platform preparation. The universal fluorescence platform capable of realizing minute-level DNA companion logic operation is a fast, low-cost and universal platform constructed by taking a poly-T chain as a template of copper nanoclusters and double-stranded nucleic acid intercalating dye SYBR Green I as two universal output signals, and is used for various DNA companion logic operations. Benefited from the advantages of label-free and no complex TMSD reaction, the operation of all logic devices can be completed within 10 minutes, and the operation time and cost are 1 / 12 and 1 / 4 of previous work respectively. In addition, the in-vitro intelligent analysis of a disease marker poly-A polymerase is realized by utilizing the characteristics of positive and negative cross verification of opposite logic on the detection result.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of fluorescent platform preparation, and particularly relates to a universal fluorescent platform capable of realizing minute-level DNA companion logic operation and a preparation method and application thereof. BACKGROUND

[0002] DNA is a biomolecule that can construct a logic model on a nanoscale. The strong complementary pairing function between the four bases of DNA enables DNA to exhibit amazing information storage function. Through DNA hybridization or DNA strand displacement reaction, large-scale and complex logic calculation can be quickly realized. At the same time, based on the special structure of DNA and the interaction between DNA and nanomaterials, a logic operation system with multiple functions can be constructed.

[0003] Fan et al. constructed a universal two-color platform based on the peroxidase-like activity of G-quadruplex DNAzyme and the quenching ability of oxidized TMB on upconversion particles (UCP) luminescence (Fan, D.; Wang, J.; Wang, E.; Dong, S. Chem. Sci. 2019, 10 (30), 7290-7298.). However, the upconversion nanomaterials involved in this technology require long synthesis and purification steps, and the time is in hours. Xiurong Yang's group constructed a series of DNA opposite logic pairs based on the ECL-RET system and TMSD reaction, which took as long as 20 hours (Zhu, L.; Yu, L.; Meng, T.; Peng, Y.; Yang, X. Small 2021, 17 (46), e2102881.). Xiurong Yang's group established a dual-output electrochemical molecular logic system based on the different diffusion abilities of electroactive dyes ferrocene (Fc) and methylene blue (MB) on ITO electrodes under different DNA hybridization reactions, and assisted exonuclease III (Exo III). DNA tool enzymes were used, and the time was in hours (Zhu, L.; Yu, L.; Yang, X. ACS Appl. Mater. Interfaces 2021, 13 (35), 42250-42257.).

[0004] In summary, the main defects of the existing logic operation systems with multiple functions constructed based on DNA are as follows:

[0005] 1. Previous work still frequently uses upconversion nanomaterials, silver nanoclusters and C3N4 nanosheets, which require long synthesis and purification steps, expensive DNA tool enzymes and TMSD reactions with specific sequence design, all of which result in long operation time, high cost and low operation efficiency.

[0006] 2. Previous systems only implemented logic gates with opposite functions, which limited the flexibility of computation.

[0007] 3. There are few reports on biosensing applications based on opposite logic pairs in existing technologies. Summary of the Invention

[0008] This invention addresses the technical problems in existing technologies by providing a universal fluorescence platform capable of minute-level DNA-associated logic operations, along with its preparation method and applications. This invention is the first to integrate poly-T CuNCs and SGI into a universal dual-output signal channel for platform construction, enabling intelligent analysis and detection of disease biomarkers based on opposite logic. Compared to previous work, this universal fluorescence platform offers advantages such as simplicity, speed, and low cost.

[0009] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:

[0010] The present invention provides a universal fluorescence platform for achieving minute-level DNA-associated logic operations. This platform is constructed using copper nanoclusters (CuNCs) with poly-T DNA strands as templates and double-stranded nucleic acid intercalation dye SYBR Green I (SG I) as two universal output signals.

[0011] In the above technical solution, the poly-T DNA chain is T30.

[0012] In the above technical solution, the general fluorescence platform is used to run associated opposite logic pairs (YES^NO T, OR^NOR), associated non-opposite logic pairs (OR^NAND, IDE^IMP), or cascaded loops ((OR-AND) / INH, (OR-INH) / MAJ).

[0013] In the above technical solution, the platform for the accompanying opposite logic pair (YES^NOT, OR^NOR) is:

[0014] 500 nM T30, 100 μM Cu 2+ 2 mM AA and 5 μL 20×SGI;

[0015] YES^NOT takes 500nM A30 as input, and OR^NOR takes 500nM A30 and 500nM A32 as input.

[0016] In the above technical solution, the platform for the accompanying non-opposite logic pair (OR^NAND, IDE^IMP) is:

[0017] 400 nM T30, 100 μM Cu2+ , 2 mM AA and 5 μL 20x SG I;

[0018] OR^NAND takes 300 nM A10-C and 300 nM A10-G as input, and 400 nM A30 and 400 nM T32 as input in IDE^IMP.

[0019] In the technical scheme, the platform of the cascade circuit ((OR-AND) / INH, (OR-INH) / MAJ) is:

[0020] 100 μM Cu 2+ , 2 mM AA and 5 μL 20x SG I;

[0021] (OR-AND) / INH takes 500 nM P, A30-P and T30-cP as input, and (OR-INH) / MAJ takes 500 nM T30-cP, 500 nM T30-P and 1 μM A30 as input.

[0022] The preparation method of the universal fluorescence platform capable of realizing minute-level DNA companion logic operation of the application comprises the following steps:

[0023] Step 1, preparing copper nanoclusters (CuNCs) taking poly-T DNA chain as a template;

[0024] Step 2, preparing a double-stranded nucleic acid intercalating dye SYBR Green I (SG I) solution.

[0025] In the technical scheme, one specific embodiment of step 1 is:

[0026] The DNA stock solution is diluted with 1x MOPS buffer to a final DNA concentration of 500 nM; then 500 nM T30 is kept at 88℃ for 3 minutes and then cooled to room temperature, on the basis of which 1x MOPS buffer is added, and then 2 mM AA and 100 μM CuSO4 are added to a final volume of 500 μL in sequence, and the mixture is shaken vigorously for 2 minutes, and finally the mixture is incubated in the dark for 5 minutes to obtain CuNCs.

[0027] In the technical scheme, the 1x MOPS buffer is specifically: 10 mM MOPS, 150 mM NaCl, pH 7.5.

[0028] The application of the universal fluorescence platform capable of realizing minute-level DNA companion logic operation of the application in in vitro intelligent analysis of disease marker poly-A polymerase.

[0029] The application has the following beneficial effects:

[0030] The universal fluorescence platform for realizing minute-level DNA companion logic operation of the application is a fast, low-cost, universal platform for various DNA companion logic operations, which is constructed by taking copper nanoclusters (CuNCs) with poly-T chain as a template and double-stranded nucleic acid intercalating dye SYBR Green I (SG I) as two universal output signals. Thanks to the advantages of label-free and no complex TMSD reaction, the operation of all logic devices can be completed within 10 minutes, and the operation time and cost are 1 / 12 and 1 / 4 of the previous work, respectively. In addition, the in vitro intelligent analysis of disease marker poly-A polymerase is realized by using the opposite logic to realize the positive and negative cross verification of the detection results. BRIEF DESCRIPTION OF DRAWINGS

[0031] The application will be described in further detail below in combination with the drawings and specific embodiments.

[0032] Figure 1 The overall principle and biological sensing application diagram of the universal fluorescence platform for realizing minute-level DNA companion logic operation.

[0033] Figure 2 The high-resolution transmission electron microscopy diagram of CuNCs with T30 as a template at a size of 20 nm.

[0034] Figure 3 The fluorescence spectrum diagram of the YES^NOT logic gate.

[0035] Figure 4 The fluorescence spectrum diagram of the OR^NAND logic gate.

[0036] Figure 5 The fluorescence spectrum diagram of the (OR-AND) / INH level circuit.

[0037] Figure 6 The fluorescence spectrum diagram of CuNCs in the poly-A polymerase detection.

[0038] Figure 7 The fluorescence spectrum diagram of SG I in the poly-A polymerase detection. DETAILED DESCRIPTION

[0039] The application provides a universal fluorescence platform for realizing minute-level DNA companion logic operation, which is a universal fluorescence platform constructed by taking copper nanoclusters (CuNCs) with poly-T DNA chain as a template and double-stranded nucleic acid intercalating dye SYBR Green I (SG I) as two universal output signals. The molecular formula of the double-stranded nucleic acid intercalating dye SYBR Green I is C 32 H 37N4S. The poly-T DNA strand is preferably T30 (T30 is a DNA strand with a sequence of 30 T bases).

[0040] The universal fluorescent platform of the present application is used to run a pair of companion opposite logic (YES^NOT, OR^NOR), a pair of companion non-opposite logic (OR^NAND, IDE^IMP) or a cascade circuit ((OR-AND) / INH, (OR-INH) / MAJ). The platform of the pair of companion opposite logic (YES^NOT, OR^NOR) is: 500 nM T30, 100 μM Cu 2+ 2 mM AA and 5 μL 20x SG I; YES^NOT takes 500 nM A30 as input, and OR^NOR takes 500 nM A30 and 500 nM A32 as input. The platform of the pair of companion non-opposite logic (OR^NAND, IDE^IMP) is: 400 nM T30, 100 μM Cu 2+ 2 mM AA and 5 μL 20x SG I; OR^NAND takes 300 nM A10-C and 300 nM A10-G as input, and IDE^IMP takes 400 nM A30 and 400 nM T32 as input. The platform of the cascade circuit ((OR-AND) / INH, (OR-INH) / MAJ) is: 100 μM Cu 2+ 2 mM AA and 5 μL 20x SG I; (OR-AND) / INH takes 500 nM P, A30-P and T30-cP as input, and (OR-INH) / MAJ takes 500 nM T30-cP, 500 nM T30-P and 1 μM A30 as input.

[0041] The mechanism of the universal fluorescent platform of the present application that can realize DNA companion logic operation at the minute level is: 1. poly-T DNA strand is used as a template, and copper ions will form copper nanoclusters (CuNCs) under the reduction of ascorbic acid (AA), which presents a high fluorescence signal at 625 nm; 2. SG I is a double-stranded nucleic acid intercalating dye, which produces a high fluorescence signal at 520 nm after interacting with double-stranded DNA, so the fluorescence emission of the two does not interfere. Copper nanoclusters and SG I are used as two signal probes to construct a universal platform for running different companion logic devices, including a pair of companion opposite logic (YES^NOT, OR^NOR), a pair of companion non-opposite logic (OR^NAND, IDE^IMP) and a cascade circuit ((OR-AND) / INH, (OR-INH) / MAJ). On this basis, in vitro intelligent analysis of disease marker poly-A polymerase is also realized (see the schematic diagram in Figure 1 ).

[0042] The application further provides a preparation method of the universal fluorescence platform capable of realizing minute-level DNA companion logic operation, comprising the following steps:

[0043] Step 1, preparing copper nanoclusters (CuNCs) with poly-T DNA chain as a template;

[0044] The DNA stock solution is diluted with 1xMOPS buffer (10mM MOPS, 150mM NaCl, pH 7.5), and the final concentration of the required DNA is 500nM. 500nM T30 is kept at 88℃ for 3 minutes and then slowly cooled to room temperature, and then 1xMOPS buffer is added. Then 2mM AA and 100μM CuSO4 are added to a final volume of 500μL, and shaken vigorously for 2 minutes. The final mixture is incubated in the dark for 5 minutes to obtain CuNCs, and then a Hitachi fluorescence instrument is used to record two output fluorescence signals. The excitation wavelength / emission wavelength / slit width are: CuNCs (340nm / 625nm / 10, 10), SG I (495nm / 525nm / 5, 5).

[0045] Step 2, preparing a double-stranded nucleic acid intercalating dye SYBR Green I (SG I) solution.

[0046] The application further provides an application of the universal fluorescence platform capable of realizing minute-level DNA companion logic operation in in vitro intelligent analysis of disease marker poly-A polymerase.

[0047] The technical solutions of the application are described below through examples, but it should be understood that the following examples do not limit the protection scope of the application.

[0048] The reagents used in the following examples are all commercially available.

[0049] Example 1 experimental steps

[0050] 1. Synthesis of poly-T DNA CuNCs:

[0051] DNA stock solution (T30) was diluted with lx MOPS buffer (10 mM MOPS, 150 mM NaCl, pH 7.5) to a final DNA concentration of 500 nM. 500 nM T30 was kept at 88 °C for 3 min and then slowly cooled to room temperature, on which 1 x MOPS buffer was added. Then 2 mM AA and 100 μΜ CuSO4 were added to a final volume of 500 μΐ, with vigorous shaking for 2 min. The final mixture was incubated for 5 min in the dark to obtain CuNCs, and then the two output fluorescence signals were recorded using a Hitachi fluorescence spectrometer. The excitation / emission / slit width were: CuNCs (340 nm / 625 nm / 10, 10), SG I (495 nm / 525 nm / 5, 5).

[0052] Figure 2 The high-resolution transmission electron microscopy image of T30-templated CuNCs at 20 nm scale was prepared for this example. From the image, it can be seen that the average diameter of T30-templated CuNCs is about 2.5 nm, which proves the successful synthesis of CuNCs.

[0053] 2. Operation of the logic device:

[0054] The logic device is a pair of complementary opposite logic (YES^NOT, OR^NOR), a pair of complementary non-opposite logic (OR^NAND, IDE^IMP), or a cascade circuit ((OR-AND) / INH, (OR-INH) / MAJ).

[0055] The platform for a pair of complementary opposite logic is 500 nM T30, 100 μΜ Cu 2+ , 2 mM AA and 5 μΐ, 20 x SG I, the platform for a pair of complementary non-opposite logic is 400 nM T30, 100 μΜ Cu 2+ , 2 mM AA and 5 μΐ, 20 x SG I, and the platform for a cascade circuit is 100 μΜ Cu 2+ , 2 mM AA and 5 μΐ, 20 x SG I. For YES^NOT, 500 nM A30 is used as input, for OR^NOR, 500 nM A30 and 500 nM A32 are used as input, for OR^NAND, 300 nM A10-C and 300 nM A10-G are used as input, for IDE^IMP, 400 nM A30 and 400 nM T32 are used as input, for (OR-AND) / INH, 500 nM P, A30-P and T30-cP are used as input, and for (OR-INH) / MAJ, 500 nM T30-cP, 500 nM T30-P and 1 μΜ A30 are used as input. The above inputs are added to the platform and incubated for 10 min, and then the fluorescence signal is recorded using a fluorescence spectrometer. The instrument parameters are the same as above.

[0056] The above mentioned T30, A30, A32, A10-C, A10-G, T32, P, A30-P, T30-cP, T30-P are all DNA strands, and their DNA sequences are as follows, respectively:

[0057] T30: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT;

[0058] A30: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0059] A32: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0060] A10-C: AAAAAAAAAAAC;

[0061] A10-G: AAAAAAAAAAAG;

[0062] T32: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT;

[0063] P: CCTACCCTGACAGAGACTTGA;

[0064] A30-P: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTACCCTGAC AGAGACTTGA;

[0065] T30-cP: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAGTCTCTGTCAG GGTAGG;

[0066] T30-P: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTACCCTGACAGAGA CTTGA;

[0067] All the above mentioned DNA and double-stranded nucleic acid intercalating dye SYBR Green I (SG I) are purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0068] 3. Detection of disease marker poly-A polymerase: First, different concentrations of poly-A polymerase were added into the mixture containing 100 nM miRNA-21, 1 mM ATP and 1x poly-A polymerase reaction solution to a final volume of 100 μL. The mixture was incubated at 37°C for 2 hours, then inactivated at high temperature 80°C for 20 minutes and cooled to room temperature. Then 500 nM T30, 100 μM Cu 2+, 2mM AA and 5μL 20×SG I were introduced into the above system to a final volume of 500μL, and the fluorescence signal was recorded after 10 minutes of final incubation, with the same instrument parameters as above.

[0069] Test results of Example 2

[0070] 1. YES-NOT logic gate verification experiment: The platform is described in Example 1, 500nM T30 is sample 1, corresponding to input "0"; 500nM T30+500nM A30 is sample 2, corresponding to input "1". After 10 minutes of incubation at room temperature, the fluorescence intensity of the two output signals was recorded by Hitachi fluorescence instrument. The fluorescence intensity value of CuNCs decreased from 1531 to 167.3, and the fluorescence intensity value of SG I increased from 128 to 3714. The fluorescence spectrum of the detection is shown in Figure 3 .

[0071] 2. OR-NAND logic gate verification experiment: The platform is described in Example 1, 500nM T30 is sample 1, corresponding to input "00"; 300nM A10-G+500nM T30 is sample 2, corresponding to input "01"; 300nM A10-C+500nM T30 is sample 3, corresponding to input "10"; 300nM A10-G+300nM A10-C+500nM T30 is sample 4, corresponding to input "11". After 10 minutes of incubation at room temperature, the fluorescence intensity of the two output signals was recorded by Hitachi fluorescence instrument. The fluorescence intensity values of CuNCs of samples 1-4 were 1458, 1113, 1166, and 354.9, respectively, and the fluorescence intensity values of SG I were 91.7, 3932, 3881, and 3962, respectively. The fluorescence spectrum of the detection is shown in Figure 4 .

[0072] 3. (OR-AND) / INH level circuit verification experiment: The platform is described in Example 1, 100μM Cu 2+, 2 mM AA and 5 μL 20x SG I (no input, only platform present) for sample 1, corresponding input "000"; 500 nM T30-cP for sample 2, corresponding input "001"; 500 nM P for sample 3, corresponding input "100"; 500 nM A30-P for sample 4, corresponding input "010"; 500 nM P + 500 nM T30-cP for sample 5, corresponding input "101"; 500 nM A30-P + 500 nM T30-cP for sample 6, corresponding input "011"; 500 nM P + 500 nM A30-P for sample 7, corresponding input "110"; 500 nM P + 500 nM A30-P + 500 nM T30-cP for sample 8, corresponding input "111". After incubation at room temperature for 10 minutes, the fluorescence intensity of two output signals was recorded by Hitachi fluorescence instrument. The fluorescence intensity values of CuNCs for samples 1-8 were: 29.8, 2491, 46.57, 96.91, 2710, 666.6, 109.7, 720.7, respectively, and the fluorescence intensity values of SG I were: 2.296, 821.5, 693.5, 835.1, 2397, 2563, 761.9, 2567, respectively. The detection fluorescence spectrum is shown in Figure 2. Figure 5 .

[0073] 4. poly-A polymerase detection: 0.1 U / μL poly-A polymerase was added to a mixture containing 100 nM miRNA-21, 1 mM ATP and 1x poly-A polymerase reaction solution to a final volume of 100 μL. The mixture was incubated at 37 °C for 2 hours, then inactivated at high temperature 80 °C for 20 minutes and cooled to room temperature. Then 500 nM T30, 100 μM Cu 2+ , 2 mM AA and 5 μL 20x SG I were introduced into the above system to a final volume of 500 μL, and the fluorescence intensity was recorded after final incubation for 10 minutes. The fluorescence intensity value of CuNCs decreased from 2266 to 264.6, and the fluorescence intensity value of SG I increased from 132.1 to 2453. The detection fluorescence spectrum is shown in Figure 4. Figure 6 and Figure 7 .

[0074] In summary, the universal fluorescence platform of the present application can realize minute-level DNA companion logic operation, for the first time, by integrating poly-T CuNCs and SG I into a universal double-output signal channel, a fast and low-cost platform is constructed for the operation of companion DNA logic nanodevices. Using label-free DNA and without DNA strand displacement reaction, all logic devices can be completed within 10 minutes, greatly reducing the running time and cost. With the assistance of a portable ultraviolet lamp, the double output signals of all logic devices can be easily visualized and identified by the eyes, proving the practicability and universality of the system. The in vitro intelligent analysis of disease marker poly-A polymerase is realized, providing a new idea for early diagnosis of cancer.

[0075] Obviously, the above embodiments are only examples for clearly illustrating, but not limitation to the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the embodiments need not and cannot be exhausted. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A universal fluorescence platform capable of implementing minute-level DNA companion logic operations, characterized in that, It is a universal fluorescence platform constructed by using copper nanoclusters with poly-T DNA strand as template and double-stranded nucleic acid intercalating dye SYBR Green I as two universal output signals; The preparation method of the copper nanoclusters is as follows: The DNA stock solution is diluted with 1×MOPS buffer to a final DNA concentration of 500 nM; then 500 nM T30 is kept at 88℃ for 3 minutes and then cooled to room temperature, on this basis, 1×MOPS buffer is added, then 2 mM ascorbic acid and 100 μM CuSO4 are added to a final volume of 500 μL in turn, and shaken for 2 minutes, finally the mixture is incubated in the dark for 5 minutes to obtain CuNCs; The 1×MOPS buffer is specifically 10 mM MOPS, 150 mM NaCl, pH 7.5; The universal fluorescence platform is used to run a pair of companion opposite logic, a pair of companion non-opposite logic and a cascade circuit; The pair of companion opposite logic is a YES^NOT logic pair or an OR^NOR logic pair; The pair of companion non-opposite logic is an OR^NAND logic pair or an IDE^IMP logic pair; The cascade circuit is a (OR-AND) / INH cascade circuit; The poly-T DNA strand is T30; The platform of the pair of companion opposite logic is: 500 nM T30, 100 µM Cu 2+ , 2 mM ascorbic acid and 5 µL 20× SYBR Green I; The YES^NOT logic pair takes 500 nM A30 as input, and the OR^NOR logic pair takes 500 nM A30 and 500 nM A32 as input; The platform of the pair of companion non-opposite logic is: 400 nM T30, 100 µM Cu 2+ , 2 mM ascorbic acid and 5 µL 20× SYBR Green I; The OR^NAND logic pair takes 300 nM A10-C and 300 nM A10-G as input, and the IDE^IMP logic pair takes 400 nM A30 and 400 nM T32 as input; The platform of the cascade circuit is: 100 μΜ Cu 2+ , 2 mM ascorbic acid and 5 μΐ. of 20x SYBR Green I; The (OR-AND) / INH cascade circuit takes 500 nM P, A30-P and T30-cP as input; The above-mentioned T30, A30, A32, A10-C, A10-G, T32, P, A30-P and T30-cP are all DNA strands, and their DNA sequences are respectively: T30: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT; A30: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; A32: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; A10-C: AAAAAAAAAAAC; A10-G: AAAAAAAAAAAG; T32: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT; P: CCTACCCTGACAGAGACTTGA; A30-P: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTACCCTGACAGAGACTTGA; T30-cP: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAGTCTCTGTCAGGGTAGG.

2. The method for preparing the universal fluorescence platform capable of realizing minute-level DNA companion logic operation according to claim 1, characterized in that, The method comprises the following steps: Step 1, preparation of copper nanoclusters with poly-T DNA strand as a template; Step 2, preparation of double-stranded nucleic acid intercalating dye SYBR Green I solution; Step 1 is specifically as follows: The DNA stock solution is diluted with 1xMOPS buffer to a final DNA concentration of 500 nM; then 500 nM T30 is kept at 88 DEG C for 3 min and then cooled to room temperature, on this basis, 1xMOPS buffer is added, then 2 mM ascorbic acid and 100 uM CuSO4 are added to a final volume of 500 uL in sequence, and shaken for 2 min; finally, the mixture is incubated in the dark for 5 min to obtain CuNCs; The 1xMOPS buffer is specifically as follows: 10 mM MOPS, 150 mM NaCl, pH 7.

5.

3. Application of the universal fluorescence platform capable of realizing minute-level DNA companion logic operation according to claim 1 in preparation of a disease marker poly-A polymerase in vitro analysis preparation.

Images