Populus deltoides lncRNA segmented genome and its segmentation method and application

Abstract

The present invention discloses a segmented genome of Populus deltoides lncRNA and a segmentation method and application thereof, and belongs to the technical field of plant genetic engineering. The present invention segments Populus deltoides lncRNA-MSL, including MSL-1 sequence, MSL-2 sequence and MSL-3 sequence, and their nucleotide sequences correspond to SEQ ID NO.1-3 respectively. Compared with the wild-type tetradactyl stamens, the transgenic plants of MSL-1 have 7-8 multi-branched stamens or stamens with multiple anthers; the transgenic plants of MSL-2 and MSL-3 are similar to the phenotype of abnormal stamens in MSL-1. Therefore, transgenic studies have shown that MSL-1, MSL-2 and MSL-3 segmented sequences can promote the development of stamens. The relative expression levels of MSL sequences in transgenic plants are: MSL-3>MSL-2>MSL-1.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically, relates to a Populus deltoides lncRNA segmented genome, a segmentation method and an application thereof. Background Art

[0002] lncRNA (long non-coding RNA) is a type of RNA that is longer than 200 nucleotides but does not encode proteins. lncRNA sequences are less conservative and have obvious spatiotemporal expression specificity. lncRNA can regulate plant growth and development, such as increasing biomass, promoting root development, affecting plant response to auxin, flowering time, pollen development, etc. In addition, lncRNA plays a vital role in controlling various abiotic stresses in plants, including drought, heat, cold effects, and heavy metal toxicity; similarly, in animals, lncRNA functions have been reported in a series of processes related to yeast and animal reproduction, including sex determination, cell meiosis, spermatogenesis, etc.

[0003] MSL is a specific gene present on the Y chromosome of Populus deltoides and is the sex-determining gene of Populus deltoides. MSL is only expressed in male flower buds, not in female flower buds, and the expression level is extremely low. RNA-seq sequencing results show that MSL does not encode protein genes, but in the sequencing results of lncRNA-seq, MSL is expressed in transcripts. Therefore, MSL mainly plays a role by producing lncRNA. The transgenic results of Arabidopsis thaliana show that MSL can promote stamen development without affecting pistil development. lncRNAs have effects at multiple regulatory levels and can interact directly or indirectly with DNA, RNA and proteins. To a certain extent, the regulatory mechanism of lncRNA based on functional analysis is a hot spot and difficulty in lncRNA research. Therefore, studying the functional domains of MSL-lncRNAs will help to further understand the role of MSL in sex determination and lay the foundation for the study of its molecular mechanism. Summary of the invention

[0004] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a Populus deltoides lncRNA segmented genome for constructing transgenic plants; another technical problem to be solved by the present invention is to provide a segmentation method of the Populus deltoides lncRNA segmented genome for constructing the Populus deltoides lncRNA segmented gene; the technical problem to be solved by the present invention is to provide an application of the Populus deltoides lncRNA segmented genome for obtaining new germplasm with stamen development.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0006] The MSL-lncRNAs segmented genome of Populus deltoides includes MSL-1 sequence, MSL-2 sequence and MSL-3 sequence, and their nucleotide sequences correspond to SEQ ID NO.1-3, respectively.

[0007] The segmentation method of the MSL-lncRNA segmented genome of Populus deltoides was used to compare the MSL sequence on the Populus deltoides genome using SeqHunter software, and the E value was set to 10 -5 The results were output in txt format; the comparison results were visualized using RStudio software, and were divided into three segments according to the abundance of homologous sequences, namely MSL-1 sequence, MSL-2 sequence, and MSL-3 sequence.

[0008] Application of lncRNA segmented genome in Populus deltoides to promote plant stamen development to form multi-branched stamens or multi-anthered stamens.

[0009] The plant is Arabidopsis thaliana.

[0010] The specific steps include:

[0011] 1) construct vectors of lncRNA segmented genomes of Populus deltoides respectively;

[0012] 2) Transforming the constructed vectors of the segmented genome of Populus deltoides lncRNA into Arabidopsis thaliana inflorescences respectively;

[0013] 3) Cultivate and screen Arabidopsis plants with significantly developed stamens.

[0014] The vector is a plant expression vector.

[0015] The plant expression vectors are p2301-35S-MSL-1, p2301-35S-MSL-2 and p2301-35S-MSL-3.

[0016] Application of the lncRNA segmented gene MSL-1 sequence of Populus deltoides in promoting the development of plant stamens to form multi-branched stamens or multi-anthered stamens.

[0017] Application of the Populus deltoides lncRNA segmented gene MSL-2 in promoting the development of plant stamens to form multi-branched stamens or multi-anthered stamens.

[0018] Application of the Populus deltoides lncRNA segmented gene MSL-3 in promoting the development of plant stamens to form multi-branched stamens or multi-anthered stamens.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention uses SeqHunter software to compare and analyze the MSL sequence on the Populus deltoides genome, and the E value is set to 10 -5 , the results were output in txt format; the alignment results were visualized using RStudio software, and the homologous sequences were divided into three segments, namely MSL-1 sequence, MSL-2 sequence, and MSL-3 sequence, according to their abundance. On this basis, vectors p2301-35S-MSL-1, p2301-35S-MSL-2, and p2301-35S-MSL-3 were constructed and transferred into Arabidopsis to obtain resistant transgenic plants. Compared with the four strong stamens of the wild type, the transgenic plants of MSL-1 had 7-8 multi-branched stamens or stamens with multiple anthers; the transgenic plants of MSL-2 and MSL-3 were similar to the phenotype of abnormal stamens in MSL-1. Therefore, transgenic studies have shown that MSL-1, MSL-2, and MSL-3 segmented sequences can promote the development of stamens. The relative expression levels of MSL sequences in transgenic plants were: MSL-3>MSL-2>MSL-1. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result diagram of MSL gene segmentation;

[0022] Figure 2 This is the lncRNA-seq expression result diagram of MSL in male and female flower buds of Populus deltoides at different stages;

[0023] Figure 3 It is the sequence characteristics of MSL gene;

[0024] Figure 4 It is the secondary structure diagram of the MSL segment gene MSL-1, MSL-2, and MSL-3 sequences;

[0025] Figure 5 It is the detection of plants positive for MSL segment genes MSL-1, MSL-2, and MSL-3;

[0026] Figure 6 The phenotypic observation results of transgenic and wild-type plants of MSL segmented genes MSL-1, MSL-2, and MSL-3;

[0027] Figure 7 These are the results of real-time fluorescence quantitative analysis of transgenic strains of MSL segment genes MSL-1, MSL-2, and MSL-3. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0029] The Arabidopsis ecotype Columbia-0 (Col-1) used in the present invention is a Columbia wild type, and the seeds are stored in the Molecular Laboratory of Nanjing Forestry University.

[0030] The male and female flower bud materials of Populus deltoides at five different stages used in the present invention are all stored in the molecular laboratory of Nanjing Forestry University.

[0031] Plant DNA extraction kit, RNA extraction kit and reverse transcription kit were purchased from Tiangen Biochemical Technology Co., Ltd.; Escherichia coli competent cells DH5α were purchased from Nanjing Sibomu Biotechnology Co., Ltd., Agrobacterium competent cells GV3101 were purchased from Shanghai Weidi Biotechnology Co., Ltd.; surfactant Silwet L-77 was purchased from Yisheng Biotechnology Co., Ltd. Primer synthesis and sequencing were completed by Sangon Biotechnology Co., Ltd.

[0032] Example 1

[0033] 1. Sequence alignment analysis was performed using SeqHunter software, with the E value set to 10 -5 , the MSL gene (SEQ ID NO.4) was BLAST-aligned on the Populus deltoides genome (https: / / www.nature.com / articles / s41467-020-19559-2), and the results were exported in txt format. The alignment results were visualized using RStudio software, and divided into three segments according to the abundance of homologous sequences, recorded as MSL-1 (containing 438 bp), MSL-2 (spanning 881 bp in the middle) and MSL-3 (containing 1549 bp) ( Figure 1 ).

[0034] 2. Collect male and female flower buds of Populus deltoides at 5 different time points (June 18, July 3, July 18, August 3, and December 1) for lncRNA-seq. Three biological replicates were set for each period of flower buds, and each replicate was sequenced separately. The lncRNA-Seq reads were mapped to the reference genome using the software STAR v2.5.3, and the results were visualized using IGV v2.4.14.

[0035] The results are as follows Figure 2 As shown, Y-specific MSL produces transcripts at different developmental stages of flower buds. MSL is not transcribed in female flower buds, but is transcribed in male flower buds ( Figure 2 ae, the upper row is for female flower buds, the lower row is for male flower buds, and there are three biological replicates for each); in addition, both the sense and antisense strands of MSL are transcribed ( Figure 2 fj, the upper row is the sense strand, the lower row is the antisense strand, and there are three biological replicates for each).

[0036] 3. Use REPuter to analyze the repetitive sequences in MSL online, and use PPT to mark the type and position of the repetitive sequences on the MSL sequence. Use the minimum free energy (MFE) method in RNAfold to predict the secondary structure of the MSL sequence; and based on the dot bracket method of RNAfold, calculate the component ratios of each stem region, convex loop, internal loop, hairpin loop and multi-branch loop in the secondary structure.

[0037] The results are as follows Figure 3 As shown, sequence analysis showed that the gene was rich in repetitive sequences, mainly including forward matches, reverse matches, complement matches and palindrome matches.

[0038] The results are as follows Figure 4 As shown in Table 1 , the secondary structure of the MSL segmented sequence predicted a high frequency of stem region, bulge loop, internal loop, hairpin loop and multi-branched loop, and the content of these structural features indicated that MSL is a typical sequence for producing lncRNA.

[0039] Table 1 Secondary structural characteristics of MSL segment sequences

[0040]

[0041] 4. Each segmented sequence was amplified from the plasmid by PCR, and then each segmented sequence was connected to the backbone vector by enzyme ligation to construct vectors p2301-35S-MSL-1, p2301-35S-MSL-2, and p2301-35S-MSL-3. After sequencing to obtain the correct Escherichia coli culture solution, the plasmid was extracted for Agrobacterium transformation, and the culture solution with a volume ratio of 1:1 was mixed with 50% glycerol and stored at -80°C for use. The specific process of heterologous transformation of Arabidopsis thaliana is as follows:

[0042] (1) Cultivation of wild-type Arabidopsis

[0043] The seeds of Arabidopsis thaliana Col-0 were sterilized in 70% ethanol for 30 seconds, washed 3 times with sterile water, then soaked in 5% sodium hypochlorite for 10 minutes, and then washed 6 times with sterile water. After that, the seeds were evenly distributed on 1 / 2 Murashige-Skoog (MS) medium (3% sucrose, 0.6% agar), stored in a refrigerator at 4°C for 2 days to break dormancy, and then transferred to a plant culture room with a temperature of 19-23°C, a humidity of 65-70%, and a light cycle of 16h light / 8h dark. After 10 days, it was moved into nutrient soil (peat: perlite: vermiculite = 3:1:1) until transformation.

[0044] (2) Arabidopsis infection

[0045] The bacterial solution of each segmented sequence was prepared into infection solution (1 / 2MS+50g / L sucrose+0.02% Silwet-77), 100mL of bacterial solution was centrifuged at 5000rpm for 10min, the bacteria were dissolved in the infection solution, Arabidopsis was genetically transformed by floral dipping method, and the seeds were harvested after they matured.

[0046] (3) Screening of transgenic seedlings

[0047] The T0 generation seeds were disinfected using the method of step (1) and screened on 1 / 2MS medium containing 50 mg / mL kanamycin. The obtained plants were further verified by PCR ( Figure 5 ), M represents DL2000 marker, 1 represents wild-type Arabidopsis, and the numbers behind are resistant plant numbers. About 50 transgenic lines were obtained for each vector, and the plants with positive test results were observed. GUS staining and kanamycin PCR amplification were used to further verify the resistant seedlings, and transgenic positive Arabidopsis seedlings were obtained.

[0048] (4) Phenotypic observation

[0049] Wild-type and transgenic Arabidopsis seedlings were grown in a growth chamber for 30 days, and then flowers at different developmental stages were sampled and observed under an Olympus SZX10 stereo microscope.

[0050] The results are as follows Figure 6 As shown, compared with the wild-type tetradactyl stamens, the transgenic plants of MSL-1 ( Figure 6 a) has 7-8 multi-branched stamens or stamens with multiple anthers; while in MSL-2 ( Figure 6 b) and MSL-3( Figure 6 In the transgenic plants of c), a phenotype similar to the abnormal stamens in MSL-1 was observed, but there was no obvious change in pistil development. Therefore, the transgenic studies showed that the MSL-1, MSL-2, and MSL-3 segmented sequences can promote stamen development.

[0051] (5) Calculation of relative expression

[0052] Real-time fluorescence quantitative PCR (qRT-PCR) technology was used to detect the expression of MSL sequences in transgenic plants, and ACTIN2 was selected as the internal reference gene of Arabidopsis. Rosette leaves of 25-day-old wild-type and transgenic plants were sampled, frozen in liquid nitrogen, and stored at -80°C until RNA extraction. Total RNA was extracted using the RNAEasy Fast Plant Tissue Kit, and cDNA was reverse transcribed using the lnRcute lncRNA First-Strand cDNA Kit. ACTIN2 was used as the internal reference gene of Arabidopsis. qRT-PCR detection was performed using the lnRcute lncRNA qPCR Kit. Specific primers for qRT-PCR were designed by PrimerPremier 5.0 (Table 2). qRT-PCR reactions were performed on a 7500 Fast Real-Time PCR System, and the PCR reaction program was: ①95°C, 3min; ②40 cycles: 95°C, 15sec, 60°C, 15sec, 72°C, 30sec; ③72°C, 7min. Finally, 2 -ΔΔct Methods The relative expression levels were calculated.

[0053] The results are as follows Figure 7 As shown, the relative expression levels of MSL sequences in transgenic plants are: MSL-3>MSL-2>MSL-1.

[0054] Table 2 Specific primers for qRT-PCR

[0055] Primer name Primer (5'-3') MSL-1-F TTCTCGCGTGCAAGTACAACAGG MSL-1-R CGTGCGACATTTCTCATGATACACAG MSL-2-F AGCACCTCAAATACGCCTTACCTAAG MSL-2-R TCTTGAACCATAGACGGACCAACAAC MSL-3-F AGGTGCTGTTGGTGGTGGAGAG MSL-3-R CAAACGAAGAAAGCAGCAGCAAGAC

Claims

1. Application of the lncRNA segmented genome of Populus deltoides to promote the development of Arabidopsis thaliana stamens to form multi-branched stamens or multi-anther stamens, characterized in that: The Populus deltoides lncRNA segmented genome includes MSL-1 sequence, MSL-2 sequence sum MSL- 3 Sequences, whose nucleotide sequences correspond to SEQ ID NO.1-3 respectively.

2. The use according to claim 1, characterized in that: The specific steps include: 1) construct vectors for the segmented genome of Populus deltoides lncRNA respectively; 2) The constructed vectors of the segmented genome of Populus deltoides lncRNA were transformed into Arabidopsis thaliana inflorescences respectively; 3) Cultivate and screen Arabidopsis plants with significantly developed stamens.

3. The use of the Populus deltoides lncRNA segmented genome in promoting the development of stamens according to claim 2, characterized in that: The vector is a plant expression vector.

4. The use of the Populus deltoides lncRNA segmented genome in promoting the development of stamens according to claim 3, characterized in that: The plant expression vector is p2301-35S- MSL-1 、p2301-35S- MSL-2 、p2301-35S- MSL-3 .

5. Populus deltoides lncRNA segmentation genes MSL-1 The use of the method for promoting the development of Arabidopsis thaliana stamens to form multi-branched stamens or multi-anthered stamens is characterized in that: The Populus deltoides lncRNA segmented gene MSL-1 The nucleotide sequence corresponds to SEQ ID NO.

1.

6. Populus deltoides lncRNA segmentation gene MSL-2 The use of the method for promoting the development of Arabidopsis thaliana stamens to form multi-branched stamens or multi-anthered stamens is characterized in that: The Populus deltoides lncRNA segmented gene MSL-2 The nucleotide sequence corresponds to SEQ ID NO.

2.

7. Populus deltoides lncRNA segmentation gene MSL-3 The use of the method for promoting the development of Arabidopsis thaliana stamens to form multi-branched stamens or multi-anthered stamens is characterized in that: The Populus deltoides lncRNA segmented gene MSL-3 The nucleotide sequence corresponds to SEQ ID NO.3.

Images