Aeromonas dakar phoP or phoBR single mutant strain, double mutant strain or complemented strain thereof and construction method and application thereof

Abstract

The present invention discloses a single mutant strain, double mutant strain or complement strain of Aeromonas dakarensis phoP or phoBR, and a construction method and application thereof. The single mutant strain is a wild strain of Aeromonas dakarensis that lacks phoP or phoBR The double mutant is a strain that lacks both phoP as well as phoBR The complement strain is obtained by complementing the expression of a single mutant or a double mutant. phoP The results of immune protection experiments showed that compared with the PBS group, Δ pho The relative immune protection efficiency (RPS) of the P mutant strain increased by 40%, and the double mutant strain was significantly higher than that of the Δ pho P mutant and Δ pho The BR mutant strains were reduced by 10% and 17.5%, respectively, and the complement strains were Δ pho P mutant and Δ pho The BR mutant strains increased by 2.5% and 10% respectively. This provides a research basis and technical means for the development of subsequent attenuated vaccines.

Description

Technical Field

[0001] The present invention relates to a mutant strain of Aeromonas dakar, a construction method and an application thereof, and in particular to a phoP or phoBR single mutant strain, a double mutant strain or a complemented strain thereof of Aeromonas dakar, a construction method and an application thereof. The present invention belongs to the field of biotechnology. Background Art

[0002] In taxonomy, crocodiles belong to the order Crocodiliformes, class Reptiles. There are 3 families and 23 species in the world, mainly distributed in tropical and subtropical areas. Crocodiles are ancient animals that lived at the same time as dinosaurs and are rare animals that need to be protected. Crocodiles are valuable from head to toe. Their meat is not only of high nutritional value but also a good medicine for treating asthma and other diseases. Their skins can be used to make bags and are expensive and are loved by people. Therefore, crocodile breeding has extremely high economic value and has also promoted the development of industries such as food, medical care, and leather manufacturing.

[0003] Bacterial infection is the main cause of disease and death in artificial breeding of crocodiles. For example, Providencia rettgeri, Citrobacter braakii, Aeromonas, etc. can cause crocodile sepsis (Zeng Chenyu et al., 2019), causing huge economic losses. Located in the tropics, Hainan has unique climatic and natural conditions, attracting many domestic and foreign companies to set up farms in Hainan, promoting the rapid development of Hainan's crocodile farming industry.

[0004] Aeromonas dhakensis is a highly pathogenic Aeromonas that is easily misdiagnosed in clinical practice. Our previous work found that this bacterium poses a serious threat to the breeding and conservation of Hainan crocodiles (Pu et al., 2019). Therefore, it is necessary to strengthen the research on the pathogenic mechanism and immune prevention of this bacterium. Summary of the invention

[0005] The object of the present invention is to provide a phoP or phoBR single mutant strain, a double mutant strain or a complemented strain thereof of Aeromonas dakar, and a construction method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical means:

[0007] The present invention discloses a phoP or phoBR single mutant strain, double mutant strain or complemented strain thereof of Aeromonas dhakensis, wherein the single mutant strain is obtained by deleting the phoP or phoBR gene on the basis of the wild strain of Aeromonas dhakensis; the double mutant strain is obtained by deleting both the phoP and phoBR genes on the basis of the wild strain of Aeromonas dhakensis; and the complemented strain is obtained by complementing and expressing the phoP gene on the basis of the single mutant strain or the double mutant strain.

[0008] Among them, preferably, the complemented strain constitutively expresses phoP.

[0009] Among them, preferably, the wild strain of Aeromonas dhakensis is A. dhakensis C160501.

[0010] Furthermore, the present invention also proposes a method for constructing the Aeromonas dakar phoBR single mutant strain, comprising the following steps:

[0011] (1) Design the following relevant primer sequences:

[0012] F0:ACCAGGCCATCACCTTCTTTA

[0013] R0:AGTTGCTGCATGGACAGGCC

[0014] F1: ACGAATTCGACCCCGACTTTGCCACCAAC

[0015] R1: CCATTGCTTGAAAGCATCCCTTCTTCCTCCTCTGTG

[0016] F2:GCTTTTCAAGCAATGGGTTAGCAAT

[0017] R2:ACAAGCTTACAGTTGCAGATCCTTGCCGGA

[0018] F3: ATGAACATCAAAAAGTTTGCA

[0019] R3:TTATTTGTTAACTGTTAATTGTCC

[0020] (2) Construction of phoBR knockout plasmid

[0021] 1) PCR amplification of upstream and downstream fragments of the phoBR gene

[0022] Using the genome of wild strain of Aeromonas dakar as template, primers F1 and R1 were used to amplify the upstream homologous fragment of phoBR gene by PCR, and primers F2 and R2 were used to amplify the downstream homologous fragment, which were then purified and recovered respectively.

[0023] 2) Bridging PCR of upstream and downstream fragments of phoBR gene

[0024] The upstream and downstream homologous fragments of the phoBR gene were connected into a fusion fragment by bridge PCR, and then the primers F1 and R2 were added to amplify the fusion fragment in large quantities, and finally the fusion fragment was purified and recovered;

[0025] 3) Double restriction enzyme digestion fusion fragment and pK18mobsacB plasmid

[0026] The purified fusion fragment and pK18mobsacB plasmid were double-digested with restriction endonucleases FastDigest EcoR I and FastDigestHind III, and the target product was finally recovered by gel purification.

[0027] 4) Ligation reaction

[0028] The pK18mobsacB plasmid and the upstream and downstream fusion fragments were connected by T4 DNA ligase after double restriction digestion and purification.

[0029] 5) Transformation of Ligation Fluid

[0030] The ligation solution was transformed into the prepared competent E. coli by heat shock method, and positive clones were screened by culturing overnight to obtain E. coli containing the recombinant plasmid ppK18mobsacB-ΔphoBR;

[0031] (3) Construction of ΔphoBR mutant

[0032] 1) Joint transfer

[0033] The obtained Escherichia coli containing the recombinant plasmid pK18mobsacB-ΔphoBR was co-cultured with the wild strain of Aeromonas dakar, and the conjugation transfer occurred during this period, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar cells; PCR amplification was performed with primers F3 and R3 to identify positive colonies;

[0034] 2) Screening and identification of ΔphoBR mutant strains

[0035] Colony PCR was performed using the designed F0 and R0 primers to verify whether the double exchange was successful, and the PCR products were sequenced to obtain the phoBR single mutant strain of Aeromonas dakar.

[0036] A method for constructing the Aeromonas dakar phoP single mutant strain and the phoP and phoBR double mutant strain comprises the following steps:

[0037] (1) Design the following relevant primer sequences:

[0038] UP-F: TCACCCGGGAGTTTATCGGCATCACGGGCC

[0039] UP-R: GCAGACGAAAGCCCATAAGGTGCCGATCATGGGGAT

[0040] Down-F: ATGGGCTTTCGTCTGCCGCGCCCCAT

[0041] Down-R: GCTCTAGATGCGCCGTCATCTGGATCAGCGCCA

[0042] RH-F:TCAACCCGGGAGTTTATC

[0043] RH-R:GCTCTAGATGCGCCGT

[0044] RH identification-F: GACAACATGGATCTCGCCAT

[0045] RH identification-R:GAAGTAGCTCTCGCCATTCT

[0046] phoP identification-F: GGCATCGAAACCATCAAGAC

[0047] phoP identification-R: CGTAGCTGTGCACGATTTC

[0048] phoP-F:ATGAAAATTTTGTTGGTCGAAGACG

[0049] phoP-R:TCAGCTGCACGACAGATTGAAGATG

[0050] phoP bridge-F:ACACAGGAAACAGCTATGAAAATTTTGTTGGTCGAA

[0051] phoP bridge-R:ACAAAATATTAACGCTCAGCTGCACGACAG

[0052] ScaB-F:CAAACTATCACGGCTACCAC

[0053] ScaB-R:TGTTTGTCTGCGTAGAATCC

[0054] (2) Construction of phoP knockout plasmid

[0055] 1) PCR amplification of upstream and downstream fragments of the phoP gene

[0056] Using the genome of wild-type Aeromonas dakar strain as a template, the upstream and downstream homologous fragments of the phoP gene were amplified by PCR using primers UP-F / R and Down-F / R, respectively, and then purified and recovered using a PCR product purification kit;

[0057] 2) Bridging PCR of upstream and downstream fragments of phoP gene

[0058] Use primer phoP bridge-F / R to bridge the upstream and downstream homologous fragments of the phoP gene to form a fusion fragment by PCR, then add primer RH-F / R for large-scale amplification, cut out the gel that meets the size of the fusion fragment, and purify and recover it using a PCR product purification kit;

[0059] 3) Double enzyme digestion

[0060] The purified and recovered fusion fragment and pRE112 plasmid were double-digested with restriction endonucleases FastDigestXmaI and FastDigestXbaI, and the target fragment was purified and recovered using a PCR product purification kit.

[0061] 4) Ligation reaction

[0062] The upstream and downstream fusion fragments after double digestion were connected with plasmid pRE112 by T4 ligase and heated in a constant temperature water bath at 25°C for 30 min;

[0063] 5) Transformation of Ligation Fluid

[0064] The ligation solution was transformed into the prepared competent E. coli by heat shock method, and positive clones were screened by culturing overnight;

[0065] 6) Colony identification of knockout plasmid

[0066] Pick a single colony from the transformed plate, add ddH2O and mix well, take 2 μl, add primer RH identification-F / R to perform colony PCR, and identify by 1% agarose gel electrophoresis to obtain E. coli containing the recombinant plasmid pRE112-ΔphoP;

[0067] (3) Construction of ΔphoP and ΔphoPΔphoBR mutants

[0068] 1)Join

[0069] The obtained Escherichia coli containing the recombinant plasmid pRE112-ΔphoP is co-cultured with the wild-type strain of Aeromonas dakar or the ΔphoBR mutant strain, and the conjugation transfer that occurs during this period transfers the recombinant plasmid from the Escherichia coli cells to the wild-type strain of Aeromonas dakar C160501 or the ΔphoBR mutant strain;

[0070] 2) Single exchange

[0071] Pick a single colony and add primer RH identification-F / R to perform colony PCR, and identify it by 1% agarose gel electrophoresis;

[0072] 3) Dual exchange

[0073] Pick the colony with a single and bright target fragment in the previous electrophoresis step, inoculate it to 5ml LB liquid and culture it overnight at 37℃ for double exchange; pick a single colony and add primers phoP identification-F / R for colony PCR. After electrophoresis, select the colony with a single and bright target fragment, inoculate it to 5ml LB liquid and culture it overnight at 37℃, take 1ml to extract the DNA of the phoP knockout bacteria, and add primers phoP identification-F / R, ScaB-F / R and phoP-F / RPCR respectively for triple verification. The electrophoresis results show that the strains with primer phoP identification-F / R amplifying the target band and primers ScaB-F / R and phoP-F / R amplifying no bands are the final ΔphoP and ΔphoPΔphoBR mutants, and the bacteria are stored in glycerol tubes.

[0074] A method for constructing the complementing strain comprises the following steps:

[0075] (1) Construction of phoP complementing plasmid

[0076] 1) PCR amplification of phoP and pBBR1 MCS-2Δ(lacZα) sequences

[0077] The phoP gene was amplified by PCR using the genome of the wild strain of Aeromonas dakar as a template, and the primers phoP-F / R were added. The target fragment gel was cut out after 1% agarose gel electrophoresis and the gel was purified and recovered using a PCR product purification kit; the purified phoP gene was then used as a template, and the primers phoP bridge-F / R were added for PCR amplification, and the PCR product was directly purified and recovered; the pBBR1 MCS-2 plasmid was extracted, and the single enzyme digestion was performed with ScaI, and the purified and recovered plasmid was used as a template, and the primers pBBR1 MCS-2Δ(lacZα)-F / R were added for amplification, and the pBBR1 MCS-2Δ(lacZα)-F / R were added for gel excision after electrophoresis to recover the pBBR1 MCS-2Δ(lacZα);

[0078] phoP-F:ATGAAAATTTTGTTGGTCGAAGACG

[0079] phoP-R:TCAGCTGCACGACAGATTGAAGATG

[0080] phoP bridge-F:ACACAGGAAACAGCTATGAAAATTTTGTTGGTCGAA

[0081] phoP bridge-R:ACAAAATATTAACGCTCAGCTGCACGACAG

[0082] pBBR1 MCS-2Δ(lacZα)-F:AGCTGTTTCCTGTGTGAAATTG

[0083] pBBR1 MCS-2Δ(lacZα)-R:GCGTTAATATTTTGTTAAAATTCGCG

[0084] pBBR1MCS-2 identification-F:TATTTAACGACCCTGCCCTG

[0085] pBBR1MCS-2 identification-R: ATCTCATGCTGGAGTTCTTCG

[0086] 2) Seamless cloning

[0087] The whole process was carried out on ice at 4℃. The samples and dosages were added in sequence and mixed, then centrifuged immediately. The mixture was reacted at 50℃ for 10min and immediately placed on ice.

[0088]

[0089] 3) Transformation of recombinant fluid

[0090] Using the heat shock method, the ligation solution of step 2) was transformed into the prepared competent E. coli, and the positive clones were screened by culturing overnight;

[0091] 4) Colony identification of complemented plasmid

[0092] Pick a single colony and add primers pBBR1MCS-2 identification-F / R for colony PCR. After electrophoresis identification, pick the colony with the correct band and inoculate it into 5ml LB liquid for overnight culture at 37℃. Take 1ml to extract the plasmid and add primers pBBR1MCS-2 identification-F / R for PCR. After electrophoresis, send the amplified product for sequencing to ensure that there is no mutation in the phoP gene sequence. The remaining bacterial liquid is stored in a glycerol tube. The obtained plasmid is named pBBR1MCS-2Δ(lacZα)-phoP.

[0093] (2) Construction of ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complementation strains

[0094] 1)Join

[0095] The obtained Escherichia coli containing the recombinant plasmid pBBR1MCS-2Δ(lacZα)-phoP was co-cultured with the single mutant strain ΔphoP or double mutant strain ΔphoPΔphoBR of Aeromonas dakar, and the conjugation transfer occurred during this period, transferring the recombinant plasmid from the Escherichia coli cells to the single mutant strain ΔphoP or double mutant strain ΔphoPΔphoBR of Aeromonas dakar;

[0096] 2) Screening of complementary strains

[0097] Scrape off the colony after conjugation, wash twice with 1ml LB liquid, dilute 10000 times, and spread 50μl on a double-antibody LB plate containing 50μg / ml Kana and Amp, and culture at 37℃ overnight. Pick a single colony and add primers pBBR1MCS-2 identification-F / R and phoP identification-F / R for colony PCR. Primer phoP identification-F / R ensures that the strain is still a knockout strain. The complement strain is the knockout strain carrying pBBR1MCS-2Δ(lacZα)-phoP. Pick the colony with the correct bands of the two primer amplification products by electrophoresis, and inoculate it to 5ml LB liquid for overnight culture at 37℃. 1ml bacterial liquid is used to extract the plasmid and add primers pBBR1MCS-2 identification-F / R for amplification. After electrophoresis, the amplified product is sent for sequencing to ensure that the phoP gene sequence has no mutation. The remaining bacterial liquid is stored in a glycerol tube to obtain the complement strains of the single mutant strain ΔphoP and the double mutant strain ΔphoPΔphoBR.

[0098] Furthermore, the present invention also proposes the use of the Aeromonas dakar phoP or phoBR single mutant, double mutant or complemented strain thereof in the preparation of a drug for treating or preventing diseases caused by Aeromonas dakar infection.

[0099] Among them, preferably, the drug is a vaccine.

[0100] Compared with the prior art, the present invention has the following beneficial effects:

[0101] The present invention adopts a scarless knockout approach, and successfully constructs ΔphoP and ΔphoPΔphoBR mutant strains according to the principle of homologous recombination by double enzyme digestion of suicide plasmid pRE112. At the same time, the lacZα gene in the pBBR1MCS-2 plasmid is replaced with the phoP gene by seamless cloning, and successfully constructs ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complemented strains constitutively expressing phoP. The present invention uses phoP mutants and complemented strains as antigens to generate immune protection, and then analyzes the feasibility of attenuated vaccines. Compared with the PBS group, the relative immune protection efficiency (RPS) of the ΔphoP mutant strain is increased by 40%, and the ΔphoP+CphoP complemented strain shows the highest RPS (67.5%). The RPS of the ΔphoPΔphoBR mutant strain is 10% and 17.5% lower than that of the ΔphoP mutant strain and the ΔphoBR mutant strain, respectively, and of course it is still 30% higher than that of the PBS group; but the RPS of the ΔphoPΔphoBR+CphoP complemented strain is 2.5% and 10% higher than that of the ΔphoP mutant strain and the ΔphoBR mutant strain, respectively. This shows that zebrafish immunized with phoP mutants can improve resistance to wild-type Aeromonas dakar, and zebrafish immunized with strains constitutively expressing phoP have stronger resistance, which provides a research basis and technical means for the subsequent development of attenuated vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 for the homologous fragment and the ΔphoBR fusion fragment;

[0103] Among them, (a) 1: upstream fragment; 2: downstream fragment; M: DL2000 Marker;

[0104] (b) 1: fusion fragment; M: DL 5000Marker;

[0105] Figure 2 To verify the double enzyme digestion;

[0106] Among them, 1: complete plasmid; 2: pK18mobsacB plasmid after double restriction digestion; 3: fusion fragment after double restriction digestion; 4: fusion fragment; M: DL 5000Marker

[0107] Figure 3 PCR verification for knockout plasmid;

[0108] Among them, 1-9: PCR products; M: DL 5000Marker;

[0109] Figure 4 Double enzyme digestion identification for knockout plasmid

[0110] Among them, 1: pK18mobsacB-ΔphoBR plasmid double restriction fragment; 2: pK18mobsacB-ΔphoBR recombinant plasmid; 3: pK18mobsacB plasmid; M: DL 5000Marker

[0111] Figure 5 To verify the knockout strain by PCR;

[0112] Among them, 1: knockout strain; 2: wild-type strain; M: DL5000 bp;

[0113] Figure 6 Schematic diagram for the construction of the complementing plasmid pBBR1MCS-2Δ(lacZα)-phoP;

[0114] Figure 7 These are the upstream and downstream homologous fragments and fusion fragments of phoP;

[0115] Among them, up: upstream fragment, 759bp; down: downstream fragment, 838bp; RH: fusion fragment 1632bp; M: DL2000Plus Marker;

[0116] Figure 8 The samples were purified after double enzyme digestion;

[0117] Among them, RH': fusion fragment after double restriction digestion; pRE': pRE112 plasmid after double restriction digestion; M1: DL5000Marker; M2: DL 15000Marker;

[0118] Fig. 9 Verification of phoP knockout plasmid;

[0119] Among them, left picture: Id: colony identification of fusion fragment; right picture: PCR identification of plasmid DNA, up: upstream fragment (759bp); down: downstream fragment (838bp); Id: fusion fragment identification (1132bp); RH: fusion fragment (1632bp); M: DL2000 Plus Marker;

[0120] Fig.10 for the knockout plasmid map;

[0121] Fig.11 For the validation of ΔphoP and ΔphoPΔphoBR mutant strains;

[0122] Among them, Figure A: Id: Colony identification of ΔphoPΔphoBR mutant in single exchange state (1132bp); Figure B: Colony identification of ΔphoP mutant in single exchange state (1132bp); Figure C: Colony identification of mutant after double exchange (1132bp), 1-6 are ΔphoP mutants, 7-12 are ΔphoPΔphoBR mutants; Figure D: DNA PCR with primers designed at the exogenous part of the fusion fragment on the genome. The size of the target fragment after knocking out phoP is 2588bp, and the number is the same as C Figure 1 To; M: DL2000 Plus Marker; M2: DL 15000Marker;

[0123] Fig.12 for phoP and pBBR1MCS-2Δ(lacZα) gene fragments;

[0124] Among them, 1: bridge phoP, 705 bp; 2: pBBR1MCS-2Δ (lacZα), 4781 bp; M: DL 2000PlusMarker; M1: DL 5000Marker;

[0125] Fig.13 Verification of the pBBR1MCS-2Δ(lacZα)-phoP recombinant plasmid;

[0126] Among them, Figure A: 1-6 is the colony identification of the recombinant plasmid (1277bp); Figure B: 1-6 is the PCR identification of plasmid DNA (1277bp), 1'-6' is the recombinant plasmid (5456bp); M: DL2000 Plus Marker; M1: DL 5000Marker;

[0127] Fig.14 Verification of the ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complemented strains;

[0128] Figure A: 1-6 are the colony identification of the ΔphoP+CphoP complemented strain, 7-12 are the colony identification of the ΔphoPΔphoBR+CphoP complemented strain, 1277bp; Figure B: phoP is missing from the genome, 2588bp; Figure C: Using plasmid DNA as a template, the numbering is the same as AB Figure 1 To; M: DL 2000Plus Marker; M2: DL 15000Marker;

[0129] Fig.15 for the validation of the ΔphoP+pBBR1MCS-2 and ΔphoPΔphoBR+pBBR1MCS-2 strains;

[0130] Among them, A: 1 and 2 are partial plasmids of ΔphoP+pBBR1MCS-2, 3 and 4 are partial plasmids of ΔphoPΔphoBR+pBBR1MCS-2, 1277bp; B: 1' and 2' are phoP deleted on the genome of ΔphoP+pBBR1MCS-2, 3' and 4' are phoP deleted on the genome of ΔphoPΔphoBR+pBBR1MCS-2, 2588bp; C: 1", 2" are phoBR on the genome of ΔphoP+pBBR1MCS-2, 3270bp, 3", 4" are phoBR deleted on the genome of ΔphoPΔphoBR+pBBR1MCS-2, 1315bp; M: DL2000Plus Marker; M1: DL 5000Marker; M2: DL 15000Marker;

[0131] Fig.16 is the genetic stability of ΔphoP and ΔphoPΔphoBR mutants;

[0132] Among them, 1-5 are phoP deletions in the genome of the ΔphoP mutant; 6-10 are phoP deletions in the genome of the ΔphoPΔphoBR mutant, 2588 bp; M1: DL 5000 Marker;

[0133] Fig.17 The effect of phoP mutation on the survival of Aeromonas dakar under different concentrations of polymyxin B;

[0134] Fig.18 is the survival rate of bacteria under different concentrations of antimicrobial peptide COT1. DETAILED DESCRIPTION

[0135] The present invention is further described below by way of examples, the purpose of which is only to provide a better understanding of the research content of the present invention rather than to limit the protection scope of the present invention.

[0136] Example 1 Construction of ΔphoBR Aeromonas dakar single mutant strain

[0137] 1 Materials and Methods

[0138] 1.1 Experimental Materials

[0139] 1.1.1 Strains

[0140] The wild strain of A.Dhakensis C160501 was isolated from farmed Siamese crocodiles in Hainan Province, recorded in the literature (Pu, W., G.Guo, N.Yang, Q.Li, F.Yin, P.Wang, J.Zheng, and J.Zeng. "Three Species ofAeromonas(A.Dhakensis,A.Hydrophila and A.Jandaei)Isolated from Freshwater Crocodiles(Crocodylus Siamensis)with Pneumonia and Septicemia." Lett Appl Microbiol 68, no.3(2019):212-18.), and was isolated and preserved in this laboratory.

[0141] 1.1.2 Experimental primers

[0142] The relevant primer sequences designed by Primer Premier 6.0 are shown in Table 1 and were sent to a sequencing company for synthesis.

[0143] Table 1 Primers of this example

[0144]

[0145] 1.2 Experimental methods

[0146] 1.2.1 Extraction of bacterial genome and total RNA

[0147] (1) Extraction of bacterial genomic DNA

[0148] Aeromonas dakar C160501 was activated and expanded, and then the bacterial genome was extracted according to the instructions of the bacterial genomic DNA extraction kit of Vazyme Company in the appendix.

[0149] (2) Extraction of bacterial total RNA

[0150] Aeromonas dakar C160501 was cultured under phosphorus-limited conditions, and the bacterial liquid was collected at 3 h, 4 h, 5 h, 6 h and 8 h, respectively. The bacteria were collected by centrifugation at 10,000 rpm for 1 min, and total RNA was extracted according to the instructions of the bacterial RNA extraction kit of Vazyme. The specific steps are shown in the appendix.

[0151] 1.2.2 Extraction of bacterial plasmids

[0152] First, the strain containing the plasmid is activated and expanded under certain conditions, and then the plasmid is extracted according to the instructions of the plasmid extraction kit of Vazyme Company in the appendix.

[0153] 1.2.3 PCR amplification and purification of target fragments

[0154] Amplify the corresponding target fragment according to the PCR amplification system in Table 2-3 and the reaction conditions in Table 2-4, then perform agarose gel electrophoresis to identify the target band, cut out the correct fragment, and purify and recover it according to the instructions of Vazyme's gel recovery kit. For specific steps, see the appendix.

[0155] 1.2.4 Construction of phoBR knockout plasmid

[0156] (1) PCR amplification of upstream and downstream fragments of the phoBR gene

[0157] Using the genome of Aeromonas dakar C160501 as a template, primers F1 and R1 were used to amplify the upstream homologous fragment of the phoBR gene by PCR, and primers F2 and R2 were used to amplify the downstream homologous fragment, which were then purified and recovered respectively.

[0158] (2) Bridging PCR of upstream and downstream fragments of phoBR gene

[0159] The upstream and downstream homologous fragments of the phoBR gene were connected into a fusion fragment by bridge PCR, and then primers F1 and R2 were added to amplify the fusion fragment in large quantities, and finally the fusion fragment was purified and recovered.

[0160] (3) Double restriction enzyme digestion fusion fragment and pK18mobsacB plasmid

[0161] The purified and recovered fusion fragment and pK18mobsacB plasmid were double-digested with restriction endonucleases FastDigest EcoR I and FastDigestHind III, and the target product was finally recovered by gel purification.

[0162] (4) Ligation reaction

[0163] The pK18mobsacB plasmid and the upstream and downstream fusion fragments purified and recovered after double restriction digestion were connected with T4 DNA ligase, and the connection solution was mixed and quickly centrifuged, and then kept in a constant temperature water bath at 22°C for 1.5h.

[0164] (5) Transformation of Ligation Fluid

[0165] Using the heat shock method, the above ligation solution was heat-shocked for 45 seconds into the prepared E. coli X6097 competent cells, 900 μL LB liquid culture medium (50 μg / mL DAP) was added, and cultured at 37°C for 1 hour, then centrifuged and the supernatant was discarded. The remaining transformation product was spread on an LB plate (50 μg / mL Kan and 50 μg / mL DAP), and cultured overnight to screen positive clones.

[0166] (6) Screening of positive clones

[0167] Pick a single colony from the transformed resistance plate and mix it with 8μL ddH2O. Store 5μL of the bacterial solution at 4℃. Heat the remaining 3μL of the bacterial solution for 2 minutes to lyse the cells. Use F1 and R2 primers for PCR amplification. Refer to Tables 2-3 and 2-4 for the system. Then take 3μL of the product to run 1% agarose gel electrophoresis and determine whether the fragment size is correct based on MarkerDL 5000.

[0168] (7) Double enzyme digestion identification of knockout plasmid

[0169] After expanding the culture of the temporary bacterial liquid that was positive for PCR verification, the knockout plasmid was extracted and then double enzyme digestion verification was performed with reference to Table 2-7; at the same time, pK18mobsacB plasmid and positive plasmid were used as controls, 3 μL of the enzyme-digested sample was taken and run on 1% agarose gel electrophoresis, and the phoBR knockout plasmid was judged whether it was successfully constructed based on the fragment size.

[0170] 1.2.5 Construction of ΔphoBR mutant

[0171] (1) Joint transfer

[0172] ① Use 5 mL LB liquid medium (50 μg / mL Amp) and 5 mL LB liquid medium (50 μg / mL Kan and 50 μg / mL DAP) to activate and culture Aeromonas dakar C160501 and X6097 containing the knockout plasmid at 37°C for about 12 hours, then take the bacterial liquid and streak it on the LB plate for culture, and then pick out single colonies and add them to the LB liquid medium, and culture them at 37°C overnight.

[0173] ②Inoculate the bacterial solution into fresh corresponding LB liquid culture medium at a volume ratio of 1:50 and culture at 37℃ until OD 600 The value is between 0.4 and 0.6.

[0174] ③ Take out 2 mL of bacterial solution and centrifuge, take out the bacterial cells, add fresh LB liquid medium to resuspend, and wash again.

[0175] ④ Mix X6097 E. coli containing the knockout plasmid and C160501 strain in a ratio of 1:1, 1:3, and 3:1, respectively, spot them separately on an antibiotic-free LB plate, and culture for one day.

[0176] ⑤ Use 2 mL of fresh LB medium to scrape the bacterial lawn at three points, dilute to an appropriate concentration, take 50 μL and spread it on an LB plate (50 μg / mL Kan), and culture overnight.

[0177] ⑥Use primers F3 and R3 for PCR amplification to identify positive colonies.

[0178] (2) Screening and identification of ΔphoBR mutant strains

[0179] ① Expand the culture of Aeromonas daka containing the knockout plasmid in LB liquid medium containing 50 μg / mL kanamycin and culture at 37°C for about 12 hours.

[0180] ② Use different dilutions of bacterial solution, aspirate 30 μL and spread it on LB plates (containing 20% ​​sucrose and 50 μg / mL Amp) and culture overnight.

[0181] ③ Use specially designed F0 and R0 primers to perform colony PCR to verify whether the double exchange is successful.

[0182] ④Inoculate the knockout strain with accurate verification into 5mL LB liquid medium (50μg / mL Amp) and expand the culture for 12h. Take a part of the bacterial solution, add 30% glycerol, and store the strain at -80℃. The other part is used to extract the genome, use primers F0 and R0 for genome PCR, and send the PCR product to Guangzhou Tianyi Huiyuan Co., Ltd. for sequencing.

[0183] 2 Results and analysis

[0184] 2.1 Construction of the ΔphoBR Aeromonas dakar mutant

[0185] 2.1.1 Amplification and fusion of upstream and downstream homologous fragments of phoBR

[0186] like Figure 1 As shown, the homologous fragments on both sides of the phoBR gene were amplified by PCR using the C160501 genome. The fragment 1 in Figure (a) is about 1027bp and is the upstream homologous fragment; the fragment 2 is the downstream homologous fragment, which is 923bp in size. Figure (b) is a 1930bp ΔphoBR fusion fragment formed by connecting the upstream and downstream homologous fragments through bridge PCR. The size of the target fragment is the same as expected.

[0187] 2.1.2 Double restriction enzyme digestion of homologous fusion fragments and pK18mobsacB plasmid

[0188] FastDigest EcoR I and FastDigestHindIII were used to perform double restriction digestion on the pK18mobsacB plasmid and the upstream and downstream fusion fragments, and the digestion products were recovered. Figure 2As shown, band 1 represents the complete pK18mobsacB plasmid with a size of 5721 bp, band 2 represents the recovered product of the pK18mobsacB plasmid after double enzyme digestion with a size of 5670 bp, band 4 represents the fusion fragment of the upstream and downstream homologous arms of the phoBR gene with a size of 1934 bp, and band 3 represents the recovered product of the fusion fragment of the upstream and downstream homologous arms of the phoBR gene with a size of 1928 bp after double enzyme digestion, which is consistent with expectations.

[0189] 2.1.3 Identification of knockout plasmids

[0190] (1) Pick a monoclonal colony of appropriate size and shape on the LB plate as a template, use F1 and R2 primers to perform colony PCR, and then perform 1% agarose gel electrophoresis to verify the PCR product. Figure 3 As shown, the PCR product fragment sizes in lanes 4, 7, 8, and 9 were all 1928 bp, which was in line with expectations.

[0191] (2) Select the positive plasmids verified by colony PCR and perform rapid double restriction digestion on the plasmids using FastDigest EcoR I and FastDigestHindIII. Figure 4 As shown, the sizes of the bands obtained by double enzyme digestion in lane 1 are 1928 bp and 5670 bp, and lanes 2 and 3 are pK18mobsacB-ΔphoBR recombinant plasmid and pK18mobsacB plasmid, respectively.

[0192] 2.1.4 Identification of ΔphoBR mutants

[0193] Using specially designed specific primers F0 and R0, colony PCR was performed to identify the ΔphoBR mutant strain, such as Figure 5 As shown, band 1 is the PCR fragment corresponding to the ΔphoBR mutant strain, with a size of 1315 bp; band 2 is the PCR fragment corresponding to the wild strain, with a size of 3270 bp. It can be concluded that the fragment becomes shorter due to the deletion of the phoBR gene, as expected, so the ΔphoBR mutant strain of Aeromonas dakar was successfully constructed.

[0194] Example 2 Construction of Aeromonas dakar single mutant ΔphoP, double mutant ΔphoPΔphoBR mutants and complemented strains

[0195] 1 Materials and Methods

[0196] 1.1 Experimental Materials

[0197] 1.1.1 Model Animals

[0198] Healthy gray zebrafish (Danio rerio) of similar size and age of 10 months were purchased from an aquarium in Haikou, Hainan Province. The fish were raised according to the method provided by the aquarium: the fish density was less than 5 / L of water; the water temperature was maintained at about 28°C; the pH value was maintained between 6.5-7.5; the water was changed every 5-7 days, and one-third of the total water volume was changed each time; coarse salt was added to 0.25 parts per thousand.

[0199] 1.1.2 Preparation of basal culture medium and related solutions

[0200] (1) Preparation of culture medium

[0201] ①LB solid medium / 1000mL ddH2O: 5g yeast extract, 10g peptone, 10g sodium chloride, 18g agar.

[0202] ②100mg / ml diaminopimelic acid (DAP): 1g DAP powder, add 5ml ddH2O, mix well, then add 1M NaOH dropwise and mix continuously until clear, then add ddH2O to make up to 10ml, filter using a 0.22μm filter membrane, and store at -20℃ after aliquoting.

[0203] ③ Protease detection medium / 1000ml water: 2% skim milk powder (20g) is diluted to 200ml ddH2O, TSA medium 34g is diluted to 800ml ddH2O, autoclave at 121℃ for 15min, and mix the two after cooling until they are not hot to the touch.

[0204] ④1M H2O2 solution: Mix 1ml of 30% H2O2 solution with 9ml ddH2O and filter through a 0.22μm filter membrane.

[0205] ⑤ Magnesium ion limited MOPS basal medium: 40mM MOPS, 4mM tricine, 50mM NaCl, 9.52mM NH4Cl, 0.4% glucose, 0.523mM MgCl2·7H2O (magnesium ions were adjusted to 0.05mM and 2.5mM), 0.276mM K2SO4, 0.01mM FeSO4, 5×10 -4 mM CaCl2.

[0206] ⑥0.5% TSA medium: 15g TSB medium, 2.5g agar, dilute to 500ml with ddH2O, and sterilize at 121℃ for 20min.

[0207] 1.2 Experimental methods

[0208] 1.2.1 Primers used in the experiment

[0209] The relevant primer sequences designed on the NCBI website are shown in Table 2 , which have been specifically tested and synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0210] Table 2 Primers of this example

[0211]

[0212]

[0213] 1.2.2 Activation and purification of strains

[0214] Take 10 μl of each of the C160501 and ΔphoBR Aeromonas dakar glycerol tubes in the -80℃ refrigerator and inoculate them into 5 ml LB liquid medium, and activate them overnight at 37℃ and 180rpm in a shaking incubator. Then use an inoculation loop to streak the bacterial solution on the LB plate, culture it overnight, pick a single colony and use primers F0 / R0 for colony PCR identification, pick a colony with a single and bright electrophoresis band and inoculate it into 5 ml LB liquid medium, culture it overnight at 37℃ and save a part of it in a glycerol tube.

[0215] 1.2.3 Construction of phoP knockout plasmid

[0216] (1) PCR amplification of upstream and downstream fragments of the phoP gene

[0217] Using the genome of Aeromonas dakar C160501 as a template, the upstream and downstream homologous fragments of the phoP gene were PCR amplified by primers UP-F / R and Down-F / R, respectively. 6 μl of PCR product was taken for 1% agarose gel electrophoresis identification, and the remaining amplified fragment was purified and recovered using the Novozymes PCR product purification kit.

[0218] (2) Bridging PCR of upstream and downstream fragments of phoP gene

[0219] Primers phoP bridge-F / R were used to bridge the upstream and downstream homologous fragments of the phoP gene through PCR to connect them into a fusion fragment, and then primers RH-F / R were added for large-scale amplification. After 1% agarose gel electrophoresis, the gel that matched the size of the fusion fragment was cut out and purified and recovered using the Novozymes PCR product purification kit.

[0220] (3) Double enzyme digestion

[0221] The purified and recovered fusion fragment and pRE112 plasmid were double-digested with restriction endonucleases FastDigest XmaI and FastDigest XbaI, incubated in a 37°C water bath for 2 h, and subjected to 1% agarose gel electrophoresis and then cut, and the target fragment was purified and recovered using the Novozyme PCR product purification kit.

[0222] (4) Ligation reaction

[0223] The upstream and downstream fusion fragments after double restriction digestion were connected to plasmid PRE112 using T4 ligase and incubated in a constant temperature water bath at 25°C for 30 min.

[0224] (5) Preparation of competent cells

[0225] DAPAuxotrophic E. coli WM3064 at OD 600 When the value is 0.4-0.6, take 2ml of bacterial solution and place it in an EP tube, ice bath for 30min, and precool the centrifuge at the same time; centrifuge at 4000rpm at 4℃ for 10min to collect the bacteria and discard the supernatant, add 1ml of precooled 0.1M calcium chloride solution, gently pipette and mix to resuspend the bacteria, ice bath for 30min again, centrifuge at 4℃ at 4000rpm for 10min to collect the bacteria and discard the supernatant; add 100μl of precooled 0.1M calcium chloride solution, pipette and resuspend the bacteria. Store at 4℃ and use within half an hour.

[0226] (6) Transformation of Ligation Fluid

[0227] Take 5 μl of the ligation solution and add it to 100 μl of competent cells of Escherichia coli WM3064, tap the tube wall to mix, place it on ice for 25-30 min, heat shock it in a 42°C water bath for 90 s, immediately take it out of the ice bath without shaking for 2 min, add 900 μl of LB liquid culture medium (50 μg / ml DAP), shake it at 37°C and 150 rpm for 1.5 h, take 100 μl to spread it, centrifuge the remaining 900 μl at 4000 rpm for 5 min, discard 800 μl of the supernatant, resuspend the remaining 100 μl, mix it, spread it on an LB plate containing 50 μg / ml CmR and 50 μg / ml DAP, and culture it at 37°C overnight.

[0228] (7) Colony identification of knockout plasmid

[0229] Pick a single colony from the transformed plate, add ddH2O and mix well, take 2 μl, add primer RH identification-F / R to perform colony PCR, and identify by 1% agarose gel electrophoresis.

[0230] (8) Identification using plasmid DNA as template

[0231] Pick the colony with a single and bright electrophoresis band in the colony PCR and inoculate it into LB liquid medium containing 50μg / ml CmR and 50μg / ml DAP, and culture it in a shaking incubator at 37℃ and 180rpm overnight. Take 1ml to extract the plasmid, PCR the upstream and downstream homology arms, identify the fusion fragment, and perform 1% agarose gel electrophoresis on the fusion fragment.

[0232] 1.2.4 Construction of ΔphoP and ΔphoPΔphoBR mutants

[0233] (1)Join

[0234] ① The wild-type strain C160501, the ΔphoBR mutant, and E. coli WM3064 containing the knockout plasmid were cultured to OD 600 When the value is 0.4-0.6, take 2 ml of bacterial solution and centrifuge at 4000 rpm for 10 min, discard the supernatant, add 1 ml of fresh LB liquid medium to resuspend, centrifuge again and discard the supernatant, repeat this washing step twice, and finally resuspend in 100 μl of LB liquid containing DAP.

[0235] ② Mix thoroughly at a ratio of 1:1 and 1:3 for donor bacteria and recipient bacteria, spot on the middle of the LB plate containing DAP, and culture at 37°C for 24 hours.

[0236] (2) Single exchange

[0237] Scrape off the colony after conjugation, wash twice with 1ml LB liquid, dilute 10 times, spread 50μl on LB plate containing 50μg / ml CmR, and culture overnight at 37℃. Pick a single colony and add primer RH identification-F / R for colony PCR. Identify by 1% agarose gel electrophoresis.

[0238] (3) Dual exchange

[0239] Pick the colony with a single and bright fragment in the previous electrophoresis, inoculate it to 5ml LB liquid and culture it overnight at 37℃ for double exchange. Dilute 1000 times and take 50μl to spread on LB plate containing 20% ​​sucrose (without sodium chloride) and culture it overnight at 30℃. Pick a single colony and add primer phoP identification-F / R for colony PCR. After electrophoresis, select the colony with a single and bright fragment, inoculate it to 5ml LB liquid and culture it overnight at 37℃. Take 1ml to extract the DNA of phoP knockout bacteria, add primers phoP identification-F / R, ScaB-F / R and phoP-F / RPCR for triple verification. The electrophoresis results show that the primer phoP identification-F / R amplifies the target band and the primers ScaB-F / R and phoP-F / R amplify no band. The strains are the final ΔphoP and ΔphoPΔphoBR mutants and the bacteria are stored in glycerol tubes.

[0240] 1.2.5 Construction of phoP complementing plasmid

[0241] The schematic diagram of the construction of phoP complementing plasmid is as follows Figure 6 shown.

[0242] (1) PCR amplification of phoP and pBBR1 MCS-2Δ(lacZα) sequences

[0243] Using the genome of wild strain C160501 as a template, add primers phoP-F / RPCR to amplify the phoP gene, cut the target fragment gel after 1% agarose gel electrophoresis and use the Novozyme PCR product purification kit to purify and recover the cut gel. Then use the purified phoP gene as a template, add primers phoP bridge-F / R for amplification PCR, and PCR products are directly purified and recovered. Extract the pBBR1 MCS-2 plasmid, use ScaI single enzyme digestion, purify and recover and store. Using the pBBR1 MCS-2 after single enzyme digestion as a template, add primers pBBR1 MCS-2Δ(lacZα)-F / R for amplification, and cut the gel after electrophoresis to recover pBBR1 MCS-2Δ(lacZα).

[0244] (2) Seamless cloning (recombination reaction)

[0245] Add samples on ice at 4℃ throughout the process. Add samples in sequence according to Table 3, mix well, and then centrifuge immediately. React at 50℃ for 10 min and place on ice immediately.

[0246] Table 3 Recombination reaction system

[0247]

[0248] (3) Transformation of recombinant fluid

[0249] The method is the same as the transformation of the above ligation solution. Spread on LB plate containing 50μg / ml Kana and 50μg / ml DAP.

[0250] (4) Colony identification of complemented plasmid

[0251] Pick a single colony and add primers pBBR1MCS-2 identification-F / R for colony PCR. After electrophoresis identification, pick the colony with the correct band and inoculate it to 5ml LB liquid for overnight culture at 37℃. Take 1ml of extracted plasmid, add primers pBBR1MCS-2 identification-F / R (product size 1277bp) PCR, and send the amplified product for sequencing after electrophoresis to ensure that there is no mutation in the phoP gene sequence. The remaining bacterial liquid is stored in a glycerol tube, and the resulting plasmid is named pBBR1MCS-2Δ(lacZα)-phoP.

[0252] 1.2.6 Construction of ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complementation strains

[0253] (1)Join

[0254] The method is the same as that of the knockout strain construction mentioned above.

[0255] (2) Screening of complementary strains

[0256] Scrape off the colony after conjugation, wash twice with 1ml LB liquid, dilute 10000 times, and spread 50μl on a double-antibody LB plate containing 50μg / ml Kana and Amp, and culture at 37℃ overnight. Pick a single colony and add primers pBBR1MCS-2 identification-F / R (product size 1277bp) and phoP identification-F / R for colony PCR. Primer phoP identification-F / R ensures that the strain is still a knockout strain, and the complement strain is a knockout strain carrying pBBR1MCS-2Δ(lacZα)-phoP. Pick the colony with the correct bands of the two primer amplification products by electrophoresis, and inoculate it to 5ml LB liquid for overnight culture at 37℃. 1ml bacterial liquid extracts plasmids and adds primers pBBR1MCS-2 identification-F / R amplification. After electrophoresis, the amplified product is sent for sequencing to ensure that there is no mutation in the phoP gene sequence. The remaining bacterial liquid is stored in a glycerol tube.

[0257] 1.2.7 Construction of ΔphoP+pBBR1MCS-2 and ΔphoPΔphoBR+pBBR1MCS-2 strains

[0258] (1) Transformation of pBBR1MCS-2

[0259] The method is the same as the transformation of the above recombinant fluid.

[0260] (2)Join

[0261] The method is the same as that of the knockout strain construction mentioned above.

[0262] (3) Screening of ΔphoP+pBBR1MCS-2 and ΔphoPΔphoBR+pBBR1MCS-2 strains

[0263] The method was the same as above for screening complemented strains, but the primer pBBR1MCS-2 was used to identify -F / R (product size 969 bp).

[0264] 1.2.8 Phenotypic analysis

[0265] (1) Detection of genetic stability of mutant strains

[0266] Take 10 μl of ΔphoPA.dhakensis and ΔphoPΔphoBRA.dhakensis from the bacterial tubes and add them to 5 ml LB liquid and culture at 37℃ for 12 hours. Number them as ①. Take another 10 μl from ① and add it to 5 ml LB liquid and culture at 37℃ for 12 hours. Number them as ②. Repeat the above steps 50 times. Dilute the 50th passage bacterial liquid 100,000 times, which is about 1×10 3cfu / ml, 50 μl was spread on LB plate containing 50 μg / ml Amp. Five single colonies of ΔphoPA.dhakensis and ΔphoPΔphoBRA.dhakensis were selected, and primers phoP identification-F / R were added to perform colony PCR and electrophoresis.

[0267] (2) Drug sensitivity test

[0268] Eighteen antibiotics were determined by the Kirby-Bauer method. The bacterial solution was diluted to 0.5 McFarland turbidimetric value, 100 μl was spread on MH medium, and drug-sensitive paper was pasted on the appropriate position on the medium. The culture was cultured at 37°C for 18 h, and the diameter of the inhibition zone was measured.

[0269] (3) Detection of survival ability under different concentrations of polymyxin B

[0270] The strain was transferred to OD 600 The value is 0.4-0.6, and then diluted to 1×10 5 cfu / ml, add polymyxin B (final concentration 0μg / ml, 2.5μg / ml, 5μg / ml, 10μg / ml, 20μg / ml, 40μg / ml) and incubate in a 37℃ incubator for 1h, dilute 1000 times and apply 100μl on LB plate. After incubation at 37℃ for 12h, count the colonies. According to the formula:

[0271] The survival curve of the strain at different concentrations was plotted.

[0272] (4) Antimicrobial peptide sensitivity

[0273] Take OD 600 The bacterial solution with a value of 0.4-0.6 was diluted to 1×10 5 cfu / ml, dilute the antimicrobial peptide COT1 (crocodile source) into different concentrations (50μg / ml, 100μg / ml, 200μg / ml) with ddH2O. Take 100μl of each antimicrobial peptide and bacterial solution, mix well and add to 96-well plate, and do three replicates for each bacterium. Incubate at 30℃ for 1h. After diluting 1000 times with ddH2O, take 100μl and spread on LB plate. After incubation at 37℃ for 12h, count the colonies. Draw the change curve of bacterial survival rate.

[0274] (5) Toxicity test

[0275] Take OD 600 The bacterial solution with a value of 0.4-0.6 was washed twice with sterile PBS and then diluted to 1×10 8cfu / ml. There were 8 experimental groups and one control group, with 50 zebrafish in each group. The experimental group was injected with 10 μl of bacterial solution in the abdomen, and the control group was injected with 10 μl of PBS in the abdomen. After 24 hours, the zebrafish that died of abdominal bleeding were counted.

[0276] (6) Median lethal dose (LD 50 )

[0277] Take OD 600 The bacterial solution with a value of 0.4-0.6 was washed twice with sterile PBS and then diluted to 10 5 -10 9 cfu / ml. One bacteria and one concentration constituted one experimental group, with a total of 40 experimental groups, 10 zebrafish in each experimental group, and a PBS control group with the same 10 zebrafish. All were injected with 10μl in the abdomen. After 48h, the zebrafish that died of abdominal bleeding were counted. LD was calculated using the Bliss method using SPSS software 50 .

[0278] (7) Immune protection analysis

[0279] Take OD 600 The bacterial solution with a value of 0.4-0.6 was washed twice with sterile PBS and then diluted to 1×10 7 cfu / ml. There were 7 experimental groups and 1 control group, with 50 zebrafish in each group. The experimental group was injected with 10 μl of bacterial solution in the abdomen, and the control group was injected with 10 μl of PBS in the abdomen. Fifteen days after the injection, 40 zebrafish were randomly selected from each group and injected with 10 μl of 1×10 8 cfu / ml of wild strain C160501, the total number of deaths was recorded after the zebrafish died stably. The immune protection effect was evaluated by relative immune protection rate, that is, relative immune protection rate (RPS) = (1-number of deaths in the experimental group / number of deaths in the control group) × 100%.

[0280] 1.2.9 Data Processing

[0281] SPSS software was used to perform statistical analysis on the differences in variables between different strains. Independent-Sample T Test and One-Way ANOVA were used to compare categorical variables.

[0282] 2 Results and analysis

[0283] 2.1 Construction of ΔphoP and ΔphoPΔphoBR mutants

[0284] 2.1.1 Amplification and fusion of upstream and downstream homologous fragments of phoP

[0285] The electrophoresis results of the samples after purification and recovery of upstream and downstream homologous fragments and fusion fragments are as follows Figure 7 As shown, the fragment sizes are consistent with expectations. The upstream (up) and downstream (down) were amplified using the DNA of the wild strain C160501 as templates, with the size of up being 759 bp and the size of down being 838 bp. The fusion fragment was obtained by using the upstream and downstream fragments as templates, supplemented by bridge PCR and amplification PCR, with the size of RH being 1632 bp.

[0286] 2.1.2 Double restriction enzyme digestion of phoP upstream and downstream homologous fusion fragments and pRE112 plasmid

[0287] At the same time, the purified fusion fragment and the extracted pRE112 plasmid were double-digested with FastDigest XbaI and XmaI. The electrophoresis results of the purified and recovered samples after digestion were as follows: Figure 8 As shown, the fragment sizes were consistent with expectations: RH' was the fusion fragment after double enzyme digestion, with a size of 1626 bp; pRE' was the pRE112 plasmid after double enzyme digestion, with a size of 5734 bp.

[0288] 2.1.3 Identification of phoP knockout plasmid

[0289] Single colonies were picked from LB plates containing 50μg / ml CmR and 50μg / ml DAP. Only one colony grew. Primers RH identification-F / R (1132bp) were added to perform colony PCR. After expansion culture, plasmids were extracted and PCR was performed on upstream (795bp), downstream (838bp), RH identification (1132bp), and fusion fragment (1632bp). The electrophoresis results were all as follows: Fig. 9 , as expected, the plasmid map is as Fig.10 shown.

[0290] 2.1.4 Identification of ΔphoP and ΔphoPΔphoBR mutants

[0291] On the single-exchange CmR LB plate, the wild-type strain grew 5 colonies, but only one colony was a single-exchange. The ΔphoBR mutant strain grew 2 colonies, but only one colony was a single-exchange. Colony PCR was performed using primers RH-F / R. The electrophoresis results are as follows: Fig.11 (A is the wild strain, B is the ΔphoBR mutant). If the single exchange is successful, there will be a single and bright band at 1132bp. After double exchange, spread and pick a single colony on the sucrose plate. Use the primers phoP identification-F / R designed by the upstream and downstream homology arms on the genome to perform colony PCR. The electrophoresis results are as follows: Fig.11(In Figure C, 1-6 are ΔphoP mutants, 7-12 are ΔphoPΔphoBR mutants), the size of the phoP identification fragment is 2588bp. After the phoP knockout strain was expanded and cultured, the genome was extracted and PCR was performed. The primers were phoP identification-F / R, ScaB-F / R and phoP-F / RPCR. The electrophoresis results showed that the primer phoP identification-F / R amplified the target band and the primers ScaB-F / R and phoP-F / R amplified the strain without bands, such as Fig.11 (D and C Figure 1 The actual result is consistent with the expectation.

[0292] 2.2 Construction of ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complementation strains

[0293] 2.2.1 Amplification of phoP and pBBR1MCS-2Δ(lacZα) genes

[0294] First, the extracted plasmid pBBR1MCS-2 was digested with ScaI and purified. Then, the pBBR1MCS-2 after single digestion was used as a template and primers pBBR1 MCS-2Δ(lacZα)-F / R were added to amplify it. The bridged phoP gene was amplified by adding primers phoP bridge-F / R using the purified phoP gene as a template. The electrophoresis results after purification and recovery are as follows: Fig.12 , the fragment sizes were consistent with expectations.

[0295] 2.2.2 Identification of pBBR1MCS-2Δ(lacZα)-phoP recombinant plasmid

[0296] Six single colonies were picked from the LB plate containing 50 μg / ml Kana and 50 μg / ml DAP and the colony PCR was performed using primers pBBR1MCS-2-F / R. The electrophoresis results were as follows: Fig.13 (A), all 6 colonies were in line with expectations. After 6 expansion cultures, plasmids were extracted and the amplified products after PCR with plasmid DNA as template were run together with the plasmids. The electrophoresis results are shown in Fig.13 (B). Pick three bright and single electrophoresis bands of PCR products with plasmid DNA as template and send them for sequencing. In the sequencing results, one base mutated and the base mutation also changed the amino acid. So pick one of the two colonies without point mutation.

[0297] 2.2.3 Identification of ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complementation strains

[0298] The recombinant plasmid was transferred to the ΔphoP and ΔphoPΔphoBR mutants by conjugation experiments. Six single colonies were selected on the Amp and Kana double antibody plates of ΔphoP and ΔphoPΔphoBR, respectively. Colony PCR was performed using primers pBBR1MCS-2 identification-F / R and phoP identification-F / R. Primer phoP identification-F / R ensured that phoP was still missing from the colony genome. The electrophoresis results were as follows: Fig.14 (A and B), all 12 colonies were in line with expectations. Three colonies with single and bright electrophoresis bands were selected for expansion culture, plasmid DNA was extracted, and it was used as a template with primer pBBR1MCS-2 to identify -F / RPCR. The electrophoresis results are shown in Fig.14 (C) are consistent with expectations.

[0299] 2.3 Construction of ΔphoP+pBBR1MCS-2 and ΔphoPΔphoBR+pBBR1MCS-2 strains

[0300] The plasmid pBBR1MCS-2 was transferred to the ΔphoP and ΔphoPΔphoBR mutants through conjugation experiments, and two single colonies were selected on the Amp and Kana double-antibody plates of ΔphoP and ΔphoPΔphoBR, respectively. Colony PCR was performed using primers pBBR1MCS-2 to identify -F / R, phoP to identify -F / R and F0 / R0 (to identify whether the genome was knocked out). The target fragment sizes should be 969bp, 1277bp, 3270bp (ΔphoP) and 1315bp (ΔphoPΔphoBR), respectively. The electrophoresis results are shown in Figure 1. Fig.15 , as expected.

[0301] 2.4 Phenotypic analysis

[0302] 2.4.1 Detection of genetic stability of mutants

[0303] After 50 subcultures of the ΔphoP and ΔphoPΔphoBR mutants, the last subculture solution was diluted to about 1×10 3 cfu / ml, 50 μl was taken for coating, and 5 single colonies were picked from the ΔphoP and ΔphoPΔphoBR mutants to verify the phoP deletion in the genome to determine its genetic stability. The electrophoresis results were as follows Fig.16 , 1-5 are ΔphoP mutants, 6-10 are ΔphoPΔphoBR mutants, and the target fragment size is correct, indicating that the knockout of phoP in ΔphoP and ΔphoPΔphoBR mutants is genetically stable.

[0304] 2.4.2 Drug sensitivity results

[0305] The paper strip method was used to test the changes in resistance to 19 antibiotics in 12 categories. Table 4 shows that the phoP mutation causes Aeromonas dakar to weaken its resistance to erythromycin and clarithromycin, which are macrolides, while enhancing its resistance to neomycin, which is an aminoglycoside. The loss of phoBR can also cause Aeromonas dakar to weaken its resistance to erythromycin and clarithromycin, which are macrolides. Since the paper strip method cannot detect subtle changes in resistance, it is not certain whether this effect is affected by the loss of phoP. Since the primers used to construct the complement strain carry the aminoglycoside Kana resistance, the complement strain has stronger resistance to neomycin, which is an aminoglycoside, than the knockout strain.

[0306] Table 4 Effect of phoP mutation on antibiotic resistance of Aeromonas dakar

[0307]

[0308]

[0309] 1) Table Notes: IMP (imipenem), CEP (cephalothin), AZT (aztreonam), CFX (cefoxitin), ERY (erythromycin), CLR (clarithromycin), CIP (ciprofloxacin), NOR (norfloxacin), TE (tetracycline), DO (doxycycline), NEO (neomycin), GM (gentamicin), CAP (chloramphenicol), FFC (florfenicol), PB (polymyxin B), RMP (rifampicin), SIZ (sulfisoxazole), F (nitrofurantoin), SXT (trimethoprim-sulfamethoxazole). S: sensitive; I: moderately sensitive; R: resistant

[0310] 2.4.3 Survival of Aeromonas dakka under different concentrations of polymyxin B

[0311] The survival curve of the strains at different concentrations of polymyxin B (final concentrations 0 μg / ml, 2.5 μg / ml, 5 μg / ml, 10 μg / ml, 20 μg / ml, 40 μg / ml) is shown in Figure 2. Fig.17 .Depend on Fig.17 It can be seen that under the pressure of polymyxin B, the survival ability of the strain decreased after phoP knockout, and the survival ability increased after complementation. At the same time, the loss of phoBR also reduced the survival ability of the strain.

[0312] 2.4.4 Survival rate of bacteria under different concentrations of antimicrobial peptides

[0313] The survival rate curve of the strains at different concentrations of COT1 (final concentration 0μg / ml, 25μg / ml, 50μg / ml, 100μg / ml) is as follows: Fig.18 .Depend on Fig.18It can be seen that in the presence of the antimicrobial peptide COT1, as the concentration of the antimicrobial peptide increased, the survival rates of the eight strains of bacteria decreased significantly. At the same concentration of COT1, the survival rate of the strain decreased significantly after phoP knockout, and the survival rate increased after complementation. At the same time, the loss of phoBR had a greater impact on the survival of Aeromonas dakar under COT1 conditions than the loss of phoP, but the simultaneous knockout of phoBR and phoP did not significantly decrease the survival rate of the bacteria.

[0314] 2.4.5 Virulence test: Survival rate of bacteria at different concentrations of antimicrobial peptides

[0315] To test the effect of phoP deficiency on virulence, 50 zebrafish were injected with 10 μl of 1×10 8 cfu / ml of bacterial solution, and the final number of zebrafish deaths is shown in Table 5. The loss of phoP and phoBR will weaken the virulence of Aeromonas dakar, but when they are lost at the same time, there is no obvious weakening of virulence compared with the loss of each alone. After complementation of phoP, the virulence of the mutant strain is weaker.

[0316] Table 5 Effect of phoP mutation on virulence of Aeromonas dakar

[0317]

[0318] 2.4.6 Median lethal dose (LD 50 )

[0319] In order to further understand the effect of phoP deficiency on virulence, eight zebrafish were used as an experimental group. Each bacteria was injected with five concentration gradients. The number of deaths of zebrafish in each group was observed and counted. The LD was calculated by the weighted probability unit method (Bliss's method). 50 LD of 8 strains 50 As shown in Table 6, compared with the wild-type strain, the virulence of the mutant and complemented strains was weakened, among which the LD of the complemented strains ΔphoP+CphoP and ΔphoPΔphoBR+CphoP 50 The highest value means the weakest virulence. Compared with the wild strain, the virulence is weakened by 20-50 times.

[0320] Table 6 Median lethal dose (LD 50 )

[0321]

[0322]

[0323]

[0324] 2.4.7 Immune protection analysis

[0325] Dilute the 7 strains to 1×10 7 cfu / ml, 50 zebrafish of each strain were injected with 10 μl of bacterial solution in the abdomen for immune protection. After 15 days, 40 zebrafish from each group were randomly selected and injected with 10 μl of 1×10 8 cfu / ml of wild strain C160501, and the total number of deaths was recorded after the zebrafish died stably. The relative immune protection efficiency of each bacteria was compared, and the results are shown in Table 7. Compared with the PBS group, all strains were significantly enhanced; the protection effect of the ΔphoBR mutant was higher than that of the ΔphoPΔphoBR mutant; the relative immune protection efficiency of the ΔphoP+CphoP complement strain was the strongest, and the ΔphoPΔphoBR+CphoP complement strain was second only to it; there was no significant difference between ΔphoP+pBBR1MCS-2 and ΔphoPΔphoBR+pBBR1MCS-2 compared with ΔphoP and ΔphoPΔphoBR mutants.

[0326] Table 7 Effect of phoP mutation on immune protection of Aeromonas dakar

[0327]

Claims

1. A single mutant, double mutant or complemented strain of Aeromonas dhakensis phoP or phoBR, characterized in that: The single mutant strain is obtained by deleting the phoP or phoBR gene based on the wild strain of Aeromonas dakar; the double mutant strain is obtained by deleting both the phoP and phoBR genes based on the wild strain of Aeromonas dakar; the complemented strain is obtained by complementing and expressing the phoP gene based on the single mutant strain or the double mutant strain; The phoBR single mutant of Aeromonas dakar was constructed by a method comprising the following steps: (1) Design the following relevant primer sequences: F0:ACCAGGCCATCACCTTCTTTA R0:AGTTGCTGCATGGACAGGCC F1: ACGAATTCGACCCCGACTTTGCCACCAAC R1: CCATTGCTTGAAAGCATCCCTTTCTCCTCCTCTGTG F2:GCTTTTCAAGCAATGGGTTAGCAAT R2:ACAAGCTTACAGTTGCAGATCCTTGCCGGA F3: ATGAACATCAAAAAGTTTGCA R3:TTATTTGTTAACTGTTAATTGTCC (2) Construction of phoBR knockout plasmid 1) PCR amplification of upstream and downstream fragments of the phoBR gene Using the genome of wild strain of Aeromonas dakar as template, primers F1 and R1 were used to amplify the upstream homologous fragment of phoBR gene by PCR, and primers F2 and R2 were used to amplify the downstream homologous fragment, which were then purified and recovered respectively. 2) Bridging PCR of upstream and downstream fragments of phoBR gene The upstream and downstream homologous fragments of the phoBR gene were connected into a fusion fragment by bridge PCR, and then the primers F1 and R2 were added to amplify the fusion fragment in large quantities, and finally the fusion fragment was purified and recovered; 3) Double restriction enzyme digestion fusion fragment and pK18mobsacB plasmid The purified fusion fragment and pK18mobsacB plasmid were double-digested with restriction endonucleases FastDigest EcoR I and FastDigest Hind III, and the target product was finally recovered by gel purification. 4) Ligation reaction The pK18mobsacB plasmid and the upstream and downstream fusion fragments were connected by T4 DNA ligase after double restriction digestion and purification. 5) Transformation of Ligation Fluid The ligation solution was transformed into the prepared competent E. coli by heat shock method, and positive clones were screened by culturing overnight to obtain E. coli containing the recombinant plasmid pK18mobsacB-ΔphoBR; (3) Construction of ΔphoBR mutant 1) Joint transfer The obtained Escherichia coli containing the recombinant plasmid pK18mobsacB-ΔphoBR was co-cultured with the wild strain of Aeromonas dakar, and the conjugation transfer occurred during this period, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar cells; PCR amplification was performed with primers F3 and R3 to identify positive colonies; 2) Screening and identification of ΔphoBR mutant strains The designed F0 and R0 primers were used to perform colony PCR to verify whether the double exchange was successful, and the PCR products were sequenced to obtain the phoBR single mutant strain of Aeromonas dakar. The phoP single mutant strain and the phoP and phoBR double mutant strain of Aeromonas dakar were constructed by a method comprising the following steps: (1) Design the following relevant primer sequences: UP-F: TCACCCGGGAGTTTATCGGCATCACGGGCC UP-R: GCAGACGAAAGCCCATAAGGTGCCGATCATGGGGAT Down-F: ATGGGCTTTCGTCTGCCGCGCCCCAT Down-R: GCTCTAGATGCGCCGTCATCTGGATCAGCGCCA RH-F:TCAACCCGGGAGTTTATC RH-R:GCTCTAGATGCGCCGT RH identification-F: GACAACATGGATCTCGCCAT RH identification-R:GAAGTAGCTCTCGCCATTCT phoP identification-F: GGCATCGAAACCATCAAGAC phoP identification-R: CGTAGCTGTGCACGATTTC phoP-F:ATGAAAATTTTGTTGGTCGAAGACG phoP-R:TCAGCTGCACGACAGATTGAAGATG phoP bridge-F:ACACAGGAAACAGCTATGAAAATTTTGTTGGTCGAA phoP bridge-R:ACAAAATATTAACGCTCAGCTGCACGACAG ScaB-F:CAAACTATCACGGCTACCAC ScaB-R:TGTTTGTCTGCGTAGAATCC (2) Construction of phoP knockout plasmid 1) PCR amplification of upstream and downstream fragments of the phoP gene Using the genome of wild-type Aeromonas dakar strain as a template, the upstream and downstream homologous fragments of the phoP gene were amplified by PCR using primers UP-F / R and Down-F / R, respectively, and then purified and recovered using a PCR product purification kit; 2) Bridging PCR of upstream and downstream fragments of phoP gene Use primer phoP bridge-F / R to bridge the upstream and downstream homologous fragments of the phoP gene to form a fusion fragment by PCR, then add primer RH-F / R for large-scale amplification, cut out the gel that meets the size of the fusion fragment, and purify and recover it using a PCR product purification kit; 3) Double enzyme digestion The purified fusion fragment and pRE112 plasmid were double-digested with restriction endonucleases FastDigest XmaI and FastDigest XbaI, and the target fragment was purified and recovered using a PCR product purification kit; 4) Ligation reaction The upstream and downstream fusion fragments after double digestion were connected with plasmid pRE112 by T4 ligase and heated in a constant temperature water bath at 25°C for 30 min; 5) Transformation of Ligation Fluid The ligation solution was transformed into the prepared competent E. coli by heat shock method, and positive clones were screened by culturing overnight; 6) Colony identification of knockout plasmid Pick a single colony from the transformed plate, add ddH2O and mix well, take 2 μl, add primer RH identification-F / R to perform colony PCR, and identify by 1% agarose gel electrophoresis to obtain E. coli containing the recombinant plasmid pRE112-ΔphoP; (3) Construction of ΔphoP and ΔphoPΔphoBR mutants 1)Join The obtained Escherichia coli containing the recombinant plasmid pRE112-ΔphoP is co-cultured with the wild-type strain of Aeromonas dakar or the ΔphoBR mutant strain, and the conjugation transfer that occurs during this period transfers the recombinant plasmid from the Escherichia coli cells to the wild-type strain of Aeromonas dakar C160501 or the ΔphoBR mutant strain; 2) Single exchange Pick a single colony and add primer RH identification-F / R to perform colony PCR, and identify it by 1% agarose gel electrophoresis; 3) Dual exchange Pick the colony with a single and bright target fragment in the previous step of electrophoresis, inoculate it to 5ml LB liquid and culture it overnight at 37℃ for double exchange; pick a single colony and add primer phoP identification-F / R for colony PCR, select the colony with a single and bright target fragment after electrophoresis, inoculate it to 5ml LB liquid and culture it overnight at 37℃, take 1ml to extract the DNA of phoP knockout bacteria, add primers phoP identification-F / R, ScaB-F / R and phoP-F / R PCR respectively for triple verification, the electrophoresis results show that the primer phoP identification-F / R amplifies the target band and the primers ScaB-F / R and phoP-F / R amplify no band. The strain is the final ΔphoP and ΔphoPΔphoBR mutant strains and the bacteria are stored in glycerol tubes; Wherein, the complementing strain is constructed by a method comprising the following steps: (1) Construction of phoP complementing plasmid 1) PCR amplification of phoP and pBBR1 MCS-2Δ(lacZα) sequences The phoP gene was amplified by PCR using the genome of the wild strain of Aeromonas dakar as a template and primers phoP-F / R. The target fragment gel was cut out after 1% agarose gel electrophoresis and the gel was purified and recovered using a PCR product purification kit. The purified phoP gene was then used as a template and primers phoP bridge-F / R were added for PCR amplification. The PCR product was directly purified and recovered. The pBBR1 MCS-2 plasmid was extracted and digested with ScaI, purified, recovered and stored. The pBBR1 MCS-2 after single digestion was used as a template and primers pBBR1 MCS-2Δ(lacZα)-F / R were added for amplification. After electrophoresis, pBBR1 MCS-2Δ(lacZα) was cut out of the gel and recovered. phoP-F:ATGAAAATTTTGTTGGTCGAAGACG phoP-R:TCAGCTGCACGACAGATTGAAGATG phoP bridge-F:ACACAGGAAACAGCTATGAAAATTTTGTTGGTCGAA phoP bridge-R:ACAAAATATTAACGCTCAGCTGCACGACAG pBBR1 MCS-2Δ(lacZα)-F:AGCTGTTTCCTGTGTGAAATTG pBBR1 MCS-2Δ(lacZα)-R:GCGTTAATATTTTGTTAAAATTCGCG pBBR1MCS-2 identification-F:TATTTAACGACCCTGCCCTG pBBR1MCS-2 identification-R: ATCTCATGCTGGAGTTCTTCG 2) Seamless cloning The whole process was carried out on ice at 4℃. The samples and dosages were added in sequence and mixed, then centrifuged immediately. The mixture was reacted at 50℃ for 10min and immediately placed on ice. 3) Transformation of recombinant fluid Using the heat shock method, the ligation solution of step 2) was transformed into the prepared competent E. coli, and the positive clones were screened by culturing overnight; 4) Colony identification of complemented plasmid Pick a single colony and add primers pBBR1MCS-2 identification-F / R for colony PCR. After electrophoresis identification, pick the colony with the correct band and inoculate it into 5ml LB liquid for overnight culture at 37℃. Take 1ml to extract the plasmid and add primers pBBR1MCS-2 identification-F / R for PCR. After electrophoresis, send the amplified product for sequencing to ensure that there is no mutation in the phoP gene sequence. The remaining bacterial liquid is stored in a glycerol tube. The obtained plasmid is named pBBR1MCS-2Δ(lacZα)-phoP. (2) Construction of ΔphoP+CphoP and ΔphoPΔphoBR+CphoP complementation strains 1)Join The obtained Escherichia coli containing the recombinant plasmid pBBR1MCS-2Δ(lacZα)-phoP was co-cultured with the single mutant strain ΔphoP or double mutant strain ΔphoPΔphoBR of Aeromonas dakar, and the conjugation transfer occurred during this period, transferring the recombinant plasmid from the Escherichia coli cells to the single mutant strain ΔphoP or double mutant strain ΔphoPΔphoBR of Aeromonas dakar; 2) Screening of complementary strains The colonies after conjugation were scraped off, washed twice with 1 ml LB liquid, diluted 10,000 times, and 50 μl was spread on a double-antibody LB plate containing 50 μg / ml Kana and Amp, and cultured at 37°C overnight; single colonies were picked and primers pBBR1MCS-2 identification-F / R and phoP identification-F / R were added for colony PCR, and primers phoP identification-F / R ensured that the strain was still a knockout strain, and the complemented strain was the knockout strain carrying pBBR1MCS-2Δ(lacZα)-phoP. The colonies with correct bands of amplification products of both primers were picked by electrophoresis, and inoculated to 5 ml LB liquid for overnight culture at 37°C; 1 ml bacterial liquid was used to extract the plasmid and primers pBBR1MCS-2 identification-F / R were added for amplification. After electrophoresis, the amplified product was sent for sequencing to ensure that there was no mutation in the phoP gene sequence. The remaining bacterial liquid was stored in a glycerol tube to obtain the complemented strains of the single mutant strain ΔphoP and the double mutant strain ΔphoPΔphoBR.

2. The Aeromonas dakar phoP or phoBR single mutant, double mutant or complemented strain thereof according to claim 1, characterized in that: The complemented strain constitutively expresses phoP.

3. The Aeromonas dakar phoP or phoBR single mutant, double mutant or complemented strain thereof according to claim 1, characterized in that: The wild strain of Aeromonas dhakensis is A.dhakensis C160501.

4. Use of the Aeromonas dakar phoP or phoBR single mutant, double mutant or complemented strain thereof according to claim 1 in the preparation of a medicament for treating or preventing a disease caused by Aeromonas dakar infection.

5. The use according to claim 4, characterized in that The medicine is a vaccine.

Images