A polypeptide having binding affinity to Epstein-Barr virus nuclear antigen 1 and its application

By mutating the amino acid sequence of Staphylococcus A protein Z segment amino acid sequence, combining conjugates to form targeted molecules, the limitations of existing targeted treatment of EBNA1 are solved, efficient binding and targeting of EBNA1 are achieved, and new treatment methods for EBV infection-related diseases are provided.

CN117466982BActive Publication Date: 2025-08-26WENZHOU MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311210113.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-19
Publication Date
2025-08-26
Estimated Expiration
2043-09-19

AI Technical Summary

Technical Problem

The existing targeted treatment of EB virus nuclear antigen 1 (EBNA1) methods have limitations such as weak tissue permeability, high toxicity and side effects, and are difficult to effectively prevent and treat EBV infection and its related tumors.

Method used

A polypeptide is designed to obtain a polypeptide with high affinity for EBNA1 by mutating 12-20 amino acids into the Z segment amino acid sequence of Staphylococcus A protein, and is linked to the conjugate to form a targeting molecule for targeting EBNA1.

Benefits of technology

Efficient binding and targeting of EBNA1 is achieved, new molecular targeted treatment methods are provided, and the therapeutic effect of EBV infection-related diseases is improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117466982B_ABST
    Figure CN117466982B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biomedicine, and more specifically, to a polypeptide with binding affinity for Epstein-Barr virus nuclear antigen 1 (EBNA1) and its use. The present invention provides a polypeptide with binding affinity for EBNA1, using EBNA1 as the target antigen. The inventors used the Z domain of Staphylococcus protein A as a scaffold, randomly mutated its surface amino acid residues to mimic antibody binding sites, constructed a mutant library using phage display technology, and subjected this library to affinity screening using EBNA1 as the target antigen. After extensive screening, a polypeptide with high affinity for EBNA1 was ultimately obtained. After in-depth research, the present invention discloses a polypeptide with binding affinity for EBNA1. Furthermore, the present invention provides the use of this polypeptide as a drug or molecular targeting agent for diagnosis or treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and more specifically, to a polypeptide having binding affinity to Epstein-Barr virus nuclear antigen 1 and applications thereof. Background Art

[0002] Epstein-Barr virus (EBV) is a common herpesvirus that infects humans. After initial infection, it often presents asymptomatically as a latent infection. This latent infection is closely associated with the development and progression of tumors such as nasopharyngeal carcinoma (NPC), lymphoma, Hodgkin's disease, and gastric cancer. NPC is one of the most common tumors in my country. According to statistics, approximately 80% of NPC cases worldwide occur in my country. EBV infection and its associated tumors pose a serious threat to the health of the Chinese population, particularly in Guangdong and Guangxi, where NPC incidence and mortality rates are the highest worldwide. To date, there are no effective vaccines or specific treatments for EBV infection and NPC. Although chemoradiotherapy and chemotherapy can achieve some efficacy in the treatment of NPC, the clinical efficacy of chemoradiotherapy alone is suboptimal for patients with advanced, recurrent, or metastatic NPC. Therefore, research into specific molecularly targeted therapies for the prevention and treatment of EBV infection and its associated tumors is urgent.

[0003] EBV typically exists in a latent state in the human body. During latent infection, the EBV genome exists as an episome, with minimal viral gene expression and no viral particle production. This latent mechanism allows for stable viral replication at low levels and evasion of immune surveillance. During latent infection, EBV expresses latent membrane proteins (LMPs), such as LMP1 and LMP2, and EBV nuclear antigens (EBNAs), such as EBNA1, 2, 3A / 3B / 3C, and LP. These products maintain EBV latent infection and induce transformation in infected cells. EBV nuclear antigen 1 (EBNA1) is the only viral protein expressed during both latent and proliferative infection. It is present in all EBV-associated tumors, suggesting a crucial role in the development and progression of EBV-associated tumors. EBNA1 consists of 641 amino acids and typically exists as a homodimer. The C-terminal 459-607 aa domain is a key domain for homodimer formation and DNA binding with OriP. Dimerization plays a crucial role in viral genome transcription and replication. EBNA1 binds to OriP, the viral latent replication promoter, to initiate viral genome replication and maintain the viral genome as an episome, playing a crucial role in maintaining latent infection. EBNA1 is also a multifunctional protein that can interact with certain components within the host cell, induce host genome instability, promote malignant transformation, and induce tumor development and progression by regulating pathways such as TGF-β1, STAT1, and NF-κB. EBNA1 is consistently and stably expressed at high levels in EBV-associated tumor tissues, making it an ideal target for the diagnosis and treatment of EBV-associated tumors.

[0004] Currently, with the emergence of persistent pathogen infections and the breakthrough research progress brought about by molecular targeted tumor therapy, domestic and foreign scholars have attempted to shift the research on the treatment of infectious diseases to molecular targeted therapy. Targeted therapy represented by monoclonal antibodies (mAbs) has brought new hope for the treatment of infectious diseases and tumors, such as the FDA-approved palivizumab for the prevention of respiratory syncytial virus infection in infants and young children, risbacumab for the treatment of inhalation anthrax, and trastuzumab (Herceptin) for the treatment of metastatic breast cancer. However, mAb-based targeted therapy still has its limitations, such as poor tissue penetration, significant toxic side effects, and high cost, which seriously affect the widespread application of mAbs in targeted therapy. Based on the above, this field still urgently needs to study new methods for the targeted treatment of EBV-related diseases to improve the current clinical status. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a polypeptide having binding affinity to Epstein-Barr virus nuclear antigen 1 and its application.

[0006] In a first aspect, the present invention provides a polypeptide having binding affinity for EBNA1. The polypeptide is obtained by using the amino acid sequence of the Z segment (Z domain) of Staphylococcus A protein (SPA) as a backbone and performing 12-20, preferably 13-16, amino acid mutations.

[0007] In a preferred embodiment, relative to the amino acid sequence of the Z segment of Staphylococcus A protein (SEQ ID NO: 1), the polypeptide having binding affinity to EBNA1 undergoes amino acid mutations at positions 9-11, 13-14, 17-18, 24-25, 27-28, 32, and 35.

[0008] In another preferred embodiment, relative to the amino acid sequence of segment Z of Staphylococcus A protein, the polypeptide having binding affinity to EBNA1 is:

[0009] The amino acid at position 9 was mutated to G;

[0010] The amino acid at position 10 was mutated to N;

[0011] The amino acid at position 11 mutated to R;

[0012] The amino acid at position 13 was mutated to V;

[0013] The amino acid at position 14 was mutated to L;

[0014] The amino acid at position 17 mutated to D;

[0015] The amino acid at position 18 mutated to M;

[0016] The amino acid at position 24 was mutated to V;

[0017] The amino acid at position 25 was mutated to G;

[0018] The amino acid at position 27 was mutated to L;

[0019] The amino acid at position 28 mutated to R;

[0020] The amino acid at position 32 was mutated to L;

[0021] The amino acid at position 35 was mutated to A.

[0022] In another preferred embodiment, the amino acid sequence of the polypeptide having binding affinity to EBNA1 is shown in SEQ ID NO: 2.

[0023] In another preferred embodiment, the KD value of the interaction between the polypeptide having binding affinity to EBNA1 and the EBNA1 protein is 1.96×10 -7 M.

[0024] In another aspect of the present invention, a targeting molecule targeting EBNA1 is provided, wherein the targeting molecule comprises any of the aforementioned polypeptides, and a conjugate connected (or coupled) to the polypeptide, wherein the conjugate includes but is not limited to: a cysteine ​​residue, a polypeptide tag, a drug that inhibits EBV, or a detectable marker; the detectable marker includes but is not limited to: a fluorescent marker, an enzyme, biotin, or a radioactive isotope.

[0025] In a preferred embodiment, the conjugate is a peptide, and the conjugate and the polypeptide having binding affinity to EBNA1 constitute a fusion polypeptide.

[0026] In another preferred embodiment, the polypeptide tag includes but is not limited to: His tag (such as 6×His), Myc tag, GST tag, Flag tag.

[0027] In another preferred embodiment, the enzyme includes but is not limited to: alkaline phosphatase or horseradish peroxidase.

[0028] In another preferred embodiment, the conjugate and the polypeptide having binding affinity to EBNA1 are connected via a flexible peptide, and the flexible peptide includes but is not limited to: (Gly4Ser)3.

[0029] In another aspect of the present invention, an isolated polynucleotide is provided, which encodes the aforementioned polypeptide having binding affinity to EBNA1. The polynucleotide sequence is shown in SEQ ID NO: 3.

[0030] In another aspect of the present invention, a polynucleotide is provided, which encodes the targeting molecule targeting EBNA1, wherein the conjugate is a peptide.

[0031] In another aspect of the present invention, a recombinant vector is provided, which comprises the polynucleotide.

[0032] In another aspect of the present invention, a host cell is provided, which comprises the recombinant vector, or comprises or has the polynucleotide integrated into its genome.

[0033] In another aspect of the present invention, a method for preparing any of the aforementioned polypeptides having binding affinity for EBNA1 is provided, the method comprising: (1) culturing the cells to express the polypeptide having binding affinity for EBNA1; and (2) isolating and purifying the polypeptide obtained in (1).

[0034] In another aspect of the present invention, the use of the polypeptide having binding affinity for EBNA1 or the targeting molecule targeting EBNA1 is provided for preparing a drug for treating EBV infection-related diseases; or for preparing a detection reagent for detecting EBNA1 protein; or for preparing a diagnostic reagent for diagnosing EBV infection.

[0035] In a preferred embodiment, in the targeting molecule targeting EBNA1, the conjugate is an anti-EBV drug (such as a toxin), and the polypeptide having binding affinity to EBNA1, or the targeting molecule targeting EBNA1 is used to treat EBV infection.

[0036] In another preferred embodiment, in the targeting molecule targeting EBNA1, the conjugate is a detectable marker (such as a fluorescent marker or an enzyme), and the polypeptide having binding affinity to EBNA1, or the targeting molecule targeting EBNA1 is used for EBNA1-expressing cells.

[0037] In another preferred embodiment, the EBNA1-positive expression cells include: nasopharyngeal carcinoma cells, EBV-related gastric cancer cells, lymphoma cells, etc.

[0038] In another aspect of the present invention, a pharmaceutical composition is provided, comprising: any of the aforementioned polypeptides having binding affinity to EBNA1 or any of the aforementioned targeting molecules targeting EBNA1; and a pharmaceutically acceptable carrier.

[0039] In another aspect of the present invention, a drug kit for diagnosing or treating EBV infection-related diseases is provided, comprising: any of the aforementioned polypeptides having binding affinity to EBNA1, or any of the aforementioned targeting molecules targeting EBNA1, or the aforementioned pharmaceutical composition.

[0040] In a preferred embodiment, the polypeptide having binding affinity to EBNA1 or the targeting molecule targeting EBNA1 is in an effective amount.

[0041] In another aspect of the present invention, a method for treating EBV infection-related diseases is provided, comprising administering the polypeptide having binding affinity to EBNA1 or the targeting molecule targeting EBNA1 to a subject in need of treatment.

[0042] In another aspect of the present invention, a method for diagnosing EBNA1-positive cells is provided, comprising administering the EBNA1-targeting molecule to a subject in need of treatment; wherein the conjugate in the targeting molecule is a detectable marker (such as a fluorescent marker or enzyme).

[0043] Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

[0044] The present invention will be further described below with reference to the accompanying drawings and specific implementation methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments or descriptions of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work. Figure 1 , Z WT With Z EBNA1 :332 sequence comparison;

[0046] Figure 2 , prokaryotic expression and identification of EBNA1 (aa459-607) recombinant protein and preparation and analysis of rabbit serum antibodies.

[0047] (A) SDS-PAGE electrophoresis analysis of EBNA1 (aa459-607) protein, M: protein marker; 1: E. coli BL21 (DE3); 2. E. coli BL21 (DE3) transformed with pET21a(+) / EBNA1; 3. E. coli BL21 (DE3) transformed with pET21a(+) / EBNA1 before IPTG induction; 4. E. coli BL21 (DE3) transformed with pET21a(+) / EBNA1 after IPTG induction; 5. Purified EBNA1 protein (aa459-607); (B) Western blot analysis of purified recombinant EBNA1 (aa459-607) protein, using a his-tag monoclonal antibody as the primary antibody; (C) The titer of serum antibodies in mice after immunization with the recombinant EBNA1 (aa459-607) protein.

[0048] Figure 3 , Z produced in Example 1 EBNA1 ELISA screening diagram.

[0049] Using the above-mentioned EBNA1 (aa459-607) recombinant protein as the target, after three rounds of screening, several affinity molecules Z with high affinity to the target protein were screened from the phage display library. EBNA1 .

[0050] Figure 4 , Z EBNA1Schematic diagram of the recombinant plasmid (A) and SDS-PAGE (B) and Western blot (C) analysis of the prokaryotic expression and purification of the recombinant protein.

[0051] (A) is Z EBNA1 Schematic diagram of the composition of the recombinant plasmid, ZEBNA1 represents an amino acid sequence selected from SEQ ID NO: 2, Zwt represents an amino acid sequence selected from SEQ ID NO: 1, and His-tag represents a six-histidine tag. (B) and (C) are Z EBNA1 SDS-PAGE (B) and Western blot (C) analysis of the purified recombinant protein expressed in prokaryotes, M: protein marker; 1-2 are the purified Z EBNA1 In Western blot experiments, the primary antibody was a His tag monoclonal antibody.

[0052] Figure 5 , Z EBNA1 SPR detection of the affinity between affibody and EBNA1 recombinant protein on the ProteOn XPR36 instrument.

[0053] AB are Z EBNA1 And affinity analysis of Zwt protein and target protein EBNA1 protein.

[0054] Figure 6 , Z EBNA1 Immunoprecipitation identification of affibody binding to EBNA1 protein.

[0055] AB are Z EBNA1 Affibody and EBV + B95-8 cells, EBV - Western blot analysis of EBNA1 protein binding in HNE2 cells. The internal controls were immunoglobulin heavy and light chains.

[0056] Figure 7 , Z EBNA1 Effect of affibody on EBNA1 protein dimer formation. DETAILED DESCRIPTION

[0057] The present invention is specifically described below through examples, which are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Technical engineers in this field can make some non-essential improvements and adjustments to the present invention based on the contents of the above invention.

[0058] As used herein, the "polypeptide having binding affinity for EBNA1" refers to a polypeptide obtained by using the amino acid sequence of the Z segment of Staphylococcus A protein as a backbone and performing 12-20 amino acid mutations, and the polypeptide can specifically bind to EBNA1 with little or no non-specific binding.

[0059] As used herein, the "polypeptide of the present invention", "polypeptide having binding affinity to EBNA1", "EBNA1 binding polypeptide", "Z EBNA1 affibody peptide", "Z EBNA1 affibody", "Z EBNA1 :332", "affibody protein", "affibody recombinant protein", "Z EBNA1 "P recombinant protein" can be used interchangeably; SPAZ and Zwt can be used interchangeably.

[0060] As used herein, the term "targeting molecule" refers to a molecule capable of targeting EBNA1, obtained by linking a polypeptide of the present invention having binding affinity for EBNA1 to another functional conjugate. The conjugate may include a cysteine ​​residue, a polypeptide tag, an EBV-inhibiting drug, an enzyme, or a detectable marker.

[0061] As used herein, the "fusion polypeptide" is a subordinate concept of the "targeting molecule", which refers to a molecule that can target EBNA1 obtained by linking the polypeptide of the present invention that has binding affinity for EBNA1 with other functional peptides (such as toxin proteins or functional protein fragments).

[0062] The inventors selected EBNA1 as the target antigen. Using the Z domain of Staphylococcus aureus protein A (Zwt, SEQ ID NO: 1) as a scaffold, they randomly mutated its surface amino acid residues to mimic the antibody binding site. Using phage display technology, they constructed a mutant library. This library was then affinity screened using EBNA1 as the target antigen. After extensive screening, they ultimately obtained a polypeptide with a high affinity for EBNA1.

[0063] The polypeptide of the present invention is a polypeptide obtained by using the amino acid sequence of the Z domain of Staphylococcus A protein as a skeleton and performing 14-20 (preferably 14) amino acid mutations. As a preferred embodiment of the present invention, the polypeptide of the present invention undergoes amino acid mutations at positions 9-11, 13-14, 17-18, 24-25, 27-28, 32, 35, and 43 relative to the amino acid sequence of the Z domain of Staphylococcus A protein (SEQ ID NO: 1). More preferably, the polypeptide of the present invention has the amino acid sequence shown in SEQ ID NO: 2, such as Figure 1 shown.

[0064] The present invention also encompasses polypeptides formed by adding additional amino acid residues to either or both ends of the amino acid sequence of the EBNA1-binding polypeptide. These additional amino acid residues may play a role in the polypeptide's binding to EBNA1, but may also serve other purposes, such as one or more of the production, purification, stabilization, conjugation, or detection of the polypeptide. These additional amino acid residues may include one or more amino acid residues added for chemical conjugation purposes, such as at the first or last position of the polypeptide chain, i.e., a cysteine ​​residue at the N- or C-terminus. Such additional amino acid residues may also include a "tag" for polypeptide purification or detection, such as a hexahistidine peptide (His6) tag that interacts with a labeled antibody, or a "myc" or "flag" tag. Other alternatives known to those skilled in the art are also encompassed by the present invention.

[0065] The "additional amino acid residues" may also constitute one or more polypeptide domains with desired functions, such as the same binding function as an EBNA1 binding domain, or other binding functions, or an enzymatic function, or a fluorescent function, or a combination thereof.

[0066] The present invention also encompasses polypeptides modified from the aforementioned EBNA1-binding polypeptides to enhance their stability under alkaline conditions. This stability comprises site-specific substitution of any asparagine residues present in the unmodified sequence with amino acid residues less sensitive to alkaline conditions. Because affinity chromatography columns undergo frequent strong alkaline treatment for elution between reactions, this reduced sensitivity to alkalinity facilitates the use of the polypeptides of the present invention as affinity ligands in affinity chromatography, extending the lifespan of the affinity chromatography matrix.

[0067] The present invention also encompasses polypeptides obtained by modifying the EBNA1-binding polypeptides of the present invention. These modifications (generally without altering the primary structure) include in vivo or in vitro chemical derivatization of the polypeptide, such as acetylation or carboxylation. Modifications also include glycosylation, such as those resulting from glycosylation during polypeptide synthesis and processing, or during further processing steps. Such modifications can be accomplished by exposing the polypeptide to a glycosylation enzyme (e.g., a mammalian glycosylase or deglycosylase). Modifications also include sequences containing phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, and phosphothreonine). Also encompassed are polypeptides modified to enhance their resistance to proteolysis or optimize their solubility.

[0068] The EBNA1 binding polypeptide of the present invention can be linked to a conjugate to form a functional targeting molecule. This connection can be achieved by chemical bonds (including peptide bonds) or adsorption; the chemical bonds are covalent bonds or non-covalent bonds. As a preferred embodiment, the fusion polypeptide is formed by peptide bond connection. The EBNA1 binding polypeptide and the conjugate can be directly connected or connected through a polypeptide linker (connecting peptide). The linker, for example, includes 1-30 amino acids; preferably 1-20 amino acids. The setting of the connecting peptide does not substantially affect the activity of each polypeptide in the fusion protein. Preferably, a flexible peptide (Gly4Ser)3 can be used for connection. Other connecting peptides well known to those skilled in the art can also be applied to the present invention.

[0069] In "heterologous" fusion polypeptides, the EBNA1-binding polypeptide constitutes the first domain or portion, and the second and further portions have functions other than binding to EBNA1, and these contemplated results are also within the scope of the present invention. The second and further portions of the fusion polypeptide may comprise binding domains with affinity for target molecules other than EBNA1. Such binding domains may also be related to the SPA domain, but with substitution mutations at one to about 20 positions. The result is a fusion polypeptide having at least one EBNA1-binding domain and at least one domain with affinity for the other target molecule. This expands the applications of the polypeptides of the present invention, such as as therapeutic agents or as capture, detection, or separation reagents.

[0070] Other options for the second and other parts of the fusion polypeptide of the present invention include one or more parts for therapeutic applications. In therapeutic applications, other molecules can also be covalently or non-covalently coupled to the polypeptide of the present invention by other methods, such as connecting the modified Pseudomonas aeruginosa exotoxin PE38KDEL or granzyme (GrB) to the C-terminus of the EBNA1 binding polypeptide through a flexible peptide to form a fusion protein. Non-limiting examples include enzymes that use the polypeptide of the present invention to guide effector enzymes (such as carboxypeptidases) to perform "ADEPT" (antibody-directed enzyme prodrug therapy); proteins used to recruit effector cells and other components of the immune system; cytokines such as IL-2, IFNγ, IL-12, TNFa, IP10; procoagulant factors such as tissue factor and von Willebrand factor; toxins such as ricin A, calcheamicin, and maytansinoids; and toxic small molecules such as auristatin analogs and doxorubicin. At the same time, in order to facilitate the incorporation of radionuclides (such as 68 Ga, 76 Br, 111 In, 99Tc, 124 I. 125 I) for diagnosis or radionuclides (such as 90 y、 131 I. 211 For therapeutic use, additional amino acids to those listed above (particularly hexahistidine labeling and cysteine) may be considered for the purpose of coupling radioisotope chelators to the polypeptide sequence.

[0071] The present invention also encompasses linking a detectable marker (such as a fluorescent marker, biotin or radioisotope) to the EBNA1 binding polypeptide, thereby enabling the detection of EBNA1-positive cells based on the specificity of the polypeptide of the present invention.

[0072] "EBNA1 binding affinity" refers to a property of a polypeptide that can be measured, for example, using surface plasmon resonance technology, such as a device. EBNA1 binding affinity can be measured by an assay in which the EBNA1 protein is immobilized on a sensor chip of the device, and a sample containing the polypeptide to be tested is passed over the chip. Alternatively, the polypeptide to be tested can be immobilized on a sensor chip of the device, and a sample containing EBNA1 is passed over the chip. A person skilled in the art can use the resulting sensor image to establish at least one qualitative measurement of the polypeptide's EBNA1 binding affinity. If a quantitative measurement is desired, such as to establish a KD value for an interaction, surface plasmon resonance methods can also be used. For example, binding values ​​can be measured using a Biacore 2000 device (Biocore AB). EBNA1 protein is immobilized on a sensor chip of the device, and the polypeptide sample to be tested for affinity is prepared by serial dilution and injected in a random order. The KD value can then be calculated from the results. In an embodiment of the present invention, the KD value of the polypeptide described reaches 1.96×10 -7 The present invention also provides an isolated nucleic acid encoding the EBNA1 binding polypeptide, targeting molecule, or fusion polypeptide of the present invention, or a complementary strand thereof. The nucleic acid can be synthesized in its entirety or obtained separately by PCR amplification.

[0073] The present invention also provides a vector comprising a nucleic acid encoding the fusion protein. The vector may further comprise an expression control sequence operably linked to the nucleic acid sequence to facilitate expression of the fusion protein. As used herein, "operably linked" or "operably linked to" refers to a situation in which certain portions of a linear DNA sequence can affect the activity of other portions of the same linear DNA sequence. For example, if a promoter controls the transcription of a coding sequence, it is operably linked to the coding sequence.

[0074] In the present invention, any suitable vector may be used, such as vectors used for cloning and expression in bacteria, fungi, yeast, and mammalian cells, as described in Pouwels et al., Cloning Vectors: A Laboratory Manual.

[0075] In addition, recombinant cells containing the nucleic acid sequence are also included in the present invention. The term "host cell" includes prokaryotic cells and eukaryotic cells. Commonly used prokaryotic host cells include Escherichia coli, Bacillus subtilis, etc.; for example, Escherichia coli cells ( E. coli ), such as Escherichia coli HMS174 (DE3) or BL21 (DE3). Commonly used eukaryotic host cells include yeast cells, insect cells and mammalian cells.

[0076] Also included in the present invention are methods for producing the EBNA1-binding polypeptides, targeting molecules, or fusion polypeptides of the present invention. These methods comprise culturing recombinant cells containing nucleic acid encoding the corresponding polypeptide to obtain the polypeptide product. The polypeptide produced can be purified to substantially homogeneous properties, such as to form a single band on SDS-PAGE electrophoresis.

[0077] Based on the information about the polypeptide to be expressed and the current state of the art in recombinant protein expression, combined with the disclosure of the present invention, one skilled in the art can readily prepare the polypeptides of the present invention. For example, a plasmid expressing an unmodified Z domain can be used as a starting material. Using known techniques, the desired substitution mutation can be introduced into this plasmid to obtain the expression vector of the present invention.

[0078] When chemical polypeptide synthesis methods are used to prepare the polypeptides, targeting molecules or fusion proteins of the present invention, any naturally occurring amino acid residue in the above-mentioned polypeptides can be replaced by any corresponding, non-naturally occurring amino acid residue or its derivative, as long as the function of the product polypeptide is not substantially impaired.

[0079] The present invention also relates to the use of the EBNA1 binding polypeptide or targeting molecule or fusion polypeptide in different aspects, including use in treatment, diagnosis and / or detection.

[0080] The EBNA1 binding polypeptide of the present invention can be used as a substitute for EBNA1 antibodies in various applications.

[0081] As a non-limiting example, they can be used to treat diseases characterized by EBNA1 expression, such as urogenital Chlamydia trachomatis infection. By binding to intracellular EBNA1, they can be used for in vivo and in vitro diagnosis of related diseases. The polypeptides of the present invention can be used as detection reagents, capture reagents, or separation reagents, and can also be used directly as therapeutic agents or as a means of targeting other therapeutic agents to the EBNA1 protein. In vitro methods using the polypeptides of the present invention can be carried out in various formats, such as microtiter plates, protein arrays, biosensor surfaces, and tissue sections. To adapt the polypeptides of the present invention for specific applications, modifications and / or additions may be made to the polypeptides of the present invention without departing from the scope of the present invention.

[0082] These modifications and additions are described in detail below and may include additional amino acids included in the same polypeptide chain, or labels and / or therapeutic agents that are chemically modified or otherwise conjugated to the polypeptides of the invention. Furthermore, the invention also encompasses fragments of the polypeptides that retain the ability to bind EBNA1.

[0083] The EBNA1-binding properties of the polypeptides of the present invention, as well as the stability of targeting molecules (including fusion proteins) and / or labeled binding molecules produced using the polypeptides, mean that the polypeptides can also be used to target other active substances to sites of Chlamydia infection, including cells expressing EBNA1. Therefore, another aspect of the present invention provides the use of the EBNA1-binding polypeptides described herein coupled to a substance having anti-cancer activity, to deliver the substance to cells expressing EBNA1, thereby causing damage or apoptosis of the target cells.

[0084] Such anticancer active substances may be proteins coupled to the EBNA1 binding polypeptide by fusion or chemical bonds, such as effector enzymes selected from the group consisting of effector enzymes for "ADEPT" (antibody-directed enzyme prodrug therapy); proteins for recruiting effector cells and other components of the immune system; cytokines such as IL-2, IFNγ, IL-12, TNFα, IP 10, etc.; procoagulant factors such as tissue factor, von Willebrand factor, etc.; toxins such as ricin A, pseudomonas exotoxin, calcheamicin, maytansinoids, etc. Alternatively, the active substance may also be a cytotoxic drug such as an auristatin analog or doxorubicin or a radioactive isotope (such as 90 y、 131 I. 211 At, etc.), this isotope can be directly bound to the EBNA1 binding polypeptide, or can be bound to the EBNA1 binding polypeptide through a chelating agent, such as the well-known chelating agents DOTA or DTPA.

[0085] In a related aspect, the present invention also provides a method for targeting a substance having anti-EBV activity to cells expressing EBNA1 in vivo, comprising administering to a patient a conjugate of the active substance described herein and an EBNA1 binding polypeptide. Such a conjugate has been appropriately described above.

[0086] The present invention also includes using the polypeptide binding to EBNA1 to detect EBNA1 in a sample.

[0087] For example, this assay can be used to diagnose disease conditions characterized by EBNA1 expression. Detection of EBNA1 can be performed both in vivo and in vitro. Preferred methods for in vivo diagnosis include Western blot and ELISA. The sample being tested can be, for example, a biological fluid sample or a tissue sample. Currently, a common method involves the use of antibodies against EBNA1, a method that can be applied to the EBNA1-binding polypeptides of the present invention. This method involves detecting the presence of EBNA1 using Western blot, ELISA, and other methods, and can be used to identify EBNA1 expression in fresh or frozen tumor samples.

[0088] The polypeptides of the present invention can also be used as part of a fusion protein, wherein the other domain is a reporter enzyme or a luciferase. Alternatively, they can be labeled with one or more fluorescent agents and / or radioisotopes, optionally via a chelating agent. Suitable radioisotopes include 68 Ga, 76 Br, 111 In, 99 Tc, 124 I and 125 I etc.

[0089] The present invention also includes using the EBNA1-binding polypeptides described herein for detecting EBNA1 in a biological fluid sample. This method comprises the following steps: (1) providing a biological fluid sample from a patient to be tested, (2) adding the EBNA1-binding polypeptide described herein to the sample under conditions that allow the polypeptide to bind to any EBNA1 present in the sample, (3) removing unbound polypeptide, and (4) detecting bound polypeptide. The amount of bound polypeptide detected is related to the amount of EBNA1 present in the sample. In step (2), the EBNA1-binding polypeptide can be added to the sample in any suitable form, including, for example, when the EBNA1-binding polypeptide is immobilized on a solid support through which the sample is contacted, or when the EBNA1-binding polypeptide is present in solution.

[0090] Other uses of the EBNA1-binding polypeptides include methods for detecting EBNA1 in a sample, comprising the following steps: (1) providing a tissue sample suspected of containing EBNA1, such as a frozen section, (2) adding the EBNA1-binding polypeptide of the invention to the sample under conditions that are conducive to binding of the polypeptide to any EBNA1 present in the sample, (3) removing unbound polypeptide, and (4) detecting bound polypeptide. The amount of bound polypeptide detected is correlated with the amount of EBNA1 present in the sample.

[0091] The present invention also provides a kit for diagnosing EBNA1 expression in tissue samples, comprising an EBNA1 binding polypeptide of the present invention fused with a reporter enzyme (such as alkaline phosphatase or horseradish peroxidase), a reagent for detecting enzyme activity, and positive and negative control tissue sections.

[0092] The present invention also provides a kit for diagnosing EBNA1 expression in a tissue sample, comprising an EBNA1 binding polypeptide of the present invention fused to a tag (such as a flag tag or a myc tag) for detection by an antibody, a primary antibody specific for the tag, a secondary antibody specific for the primary antibody and conjugated to a reporter enzyme, a reagent for detecting enzyme activity, and positive and negative control tissue sections.

[0093] One area of ​​diagnostic application is the in vivo detection of EBV infected cells or aggregates thereof. The present invention provides a kit for performing such a diagnosis, comprising an EBNA1 binding polypeptide of the present invention labeled with a chelate, a diagnostic radioisotope (a non-limiting example is 68 Ga, 76 Br, 111 In, 99 Tc, 124 I and 125 I, etc.), and reagents for analyzing incorporation efficiency.

[0094] As described above, the present invention encompasses the use of the EBNA1 binding polypeptides of the present invention to target active substances to cells expressing EBNA1, such as urogenital mucosal cells. The present invention also provides a kit for this purpose, comprising an EBNA1 binding polypeptide of the present invention labeled with a chelate, a therapeutic radioisotope (a non-limiting example is 90 Y. 131 I. 211 At), and reagents for analyzing incorporation efficiency.

[0095] The present invention also provides a pharmaceutical composition comprising: an effective amount of the polypeptide having binding affinity to the EBNA1 protein or the targeting molecule targeting the EBNA1 protein according to the present invention, and a pharmaceutically acceptable carrier.

[0096] As used herein, a "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity), that is, a substance with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent, including various excipients and diluents. The term refers to pharmaceutical carriers that are not essential active ingredients themselves and are not overly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. A full description of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991). Pharmaceutically acceptable carriers in the composition may contain liquids such as water, saline, glycerol and sorbitol. In addition, auxiliary substances such as lubricants, glidants, wetting agents or emulsifiers, pH buffer substances and stabilizers such as albumin may also be present in these carriers.

[0097] The composition can be prepared into various dosage forms suitable for administration to mammals, including but not limited to injections, capsules, tablets, emulsions, and suppositories.

[0098] During use, a safe and effective amount of the polypeptide or targeting molecule of the present invention having binding affinity for the EBNA1 protein is administered to a mammal (e.g., a human). The safe and effective amount is generally at least about 1 μg / kg body weight, and in most cases does not exceed about 10 mg / kg body weight. Preferably, the dose is about 1 μg / kg body weight to about 1 mg / kg body weight. Of course, the specific dosage will also take into account factors such as the route of administration and the patient's health condition, all of which are within the skill of a skilled physician.

[0099] The present invention will be further described below with reference to specific embodiments.

[0100] Example 1. Preparation and identification of EBNA1 (aa459-607) recombinant protein

[0101] The pET21a(+) / EBNA1(aa459-607) constructed and preserved in the laboratory was transformed into Escherichia coli BL21(DE3). The recombinant protein was expressed after IPTG induction. The protein was purified by Ni-NTA affinity chromatography and serum antibodies were prepared by conventional immunization of Japanese white-eared rabbits. The results showed that a clear protein band appeared at a relative molecular mass (Mr) of approximately 17 kDa, which was consistent with the expected protein size (Mr). Figure 2 A); Western blot analysis using mouse anti-6×His mAb as primary antibody showed a single signal reaction band at Mr 17kDa ( Figure 2B), indicating that EBNA1 protein can be specifically recognized and bound by His tag antibody. ELISA test showed that rabbits immunized with EBNA1 protein showed high titer antibody response, indicating that high titer EBNA1-specific rabbit serum antibody was successfully prepared ( Figure 2 C).

[0102] Example 2: Construction and screening of EBNA1-binding peptide library

[0103] A random combinatorial library of phage-displayed EBNA1-binding peptides, namely a library of many different SPA domain-related peptides, was constructed. EBNA1-binding peptides were screened from the library and their affinity was identified.

[0104] 1. Construction and identification of a random combinatorial phage display library of EBNA1-binding peptides

[0105] Based on the amino acid sequence and structure of wild-type SPA-Z (Nilsson B et al., Protein Eng. 1987; 1(2): 107-113), random primers were designed for the coding sequences corresponding to the three helical regions. The SPA coding sequence that could cause random amino acid mutations was amplified by PCR and named SPA-N. According to conventional molecular cloning methods, the SPA-N coding sequence was cloned into the pCANTAB5E vector through the SfiI and NotI sites to construct the pCANTAB5E / SPA-N recombinant plasmid and transformed into competent cells. E. coli TG1 cells were plated on 2YT-A plates and incubated overnight at 37°C. This constituted the primary library, labeled as the affibody primary library for future use. Twenty monoclonal colonies that emerged from the plates were randomly selected and their extracted plasmids were digested with SfiI and NotI to identify positive clones. These clones were then sequenced and analyzed for randomness.

[0106] Results: According to the sequencing results, 18 clones were sequenced out of the 20 clones sent for sequencing, and the randomness was completely different, so the recombination rate was 18 / 20 = 90%; the diversity was 18 / 18 = 100%. The culture solution after transformation was diluted with 2×YT culture medium (1:10, 1:10 2 ......), spread on SOB-AG plates, count the number of single colonies on the plates, and estimate the library capacity. The library capacity was accumulated by increasing the number of ligation and transformation. After multiple ligation and transformation, the number of clones reached 2.4×10 6 The invention discloses a Z protein variant (affibody molecule) having randomized amino acid residues at positions 9, 10, 11, 13, 14, 17, 18, 24, 25, 27, 28, 32, and 35.

[0107] 2. Screening and titer determination of EBNA1-binding peptides

[0108] The purified EBNA1 was coated on a 96-well ELISA plate, blocked, incubated with phage library (primary library), and then added E. coli Incubate at TG137°C with gentle shaking; take 100 μl and make serial dilutions with 2*YT medium; take 100 μl of the dilution and spread it on SOB-AG plates, incubate at 30°C overnight, count the number of phage-infected colonies, and calculate the EBNA1-binding phage titer; if colonies are visible on the plate, the titer is 1×10 5 At this time, the first round of washing is completed, and the other part of the bacterial solution is added with 10 10 Helper phage M 13 KO7 was cultured with kanamycin overnight, and the supernatant was filtered through a 0.22 μm filter membrane after centrifugation to obtain the phage library after EBNA1 affinity screening, which was the primary library. The above three rounds of enrichment screening were repeated to obtain the phage library after EBNA1 affinity screening, which was the secondary library, with titers of 1×10 6 Repeat the above four rounds of enrichment screening on the basis of the secondary library to form the tertiary library. At the same time, set up a blank control without adding phage for simultaneous screening.

[0109] 3. Preparation of EBNA1-binding peptide monoclonal phage and ELISA identification

[0110] ELISA was used to screen for phage expressing EBNA1-binding affibody molecules. EBNA1 was coated onto a 96-well microtiter plate at 2 μg / well at 4°C overnight. The plate was washed with PBS and blocked with 2% skim milk powder for 2 h. After washing, phage obtained after four rounds of screening were mixed with an equal volume of 3% skim milk powder (200 μl / well) and incubated at 37°C for 2 h. After washing, a 1:10,000 dilution of HRP / anti-M13 enzyme-linked secondary antibody (rabbit anti-M13, Abcam #ab6188) was added at 200 μl / well and incubated at 37°C for 1 h. After washing, OPD color development solution (200 μl / well) was added at 37°C for 15 min. The reaction was terminated with 50 μl / well of 2 M H₂SO₄. OD₄90 values ​​were read on a microtiter plate reader.

[0111] Affibody molecules that bind to the antigen were selected through four rounds of panning. After these four rounds of selection, their binding activity to EBNA1 was further analyzed by phage ELISA. An ELISA value of A490 above 0.5 was used as the selection criterion to identify phage encoding EBNA1-binding polypeptides. 45 clones with a signal above this ELISA value were selected for DNA sequence analysis.

[0112] 4. Sequence detection and screening of EBNA1 affibody molecules

[0113] A total of 45 clones were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing using the primer CATATGGTTGACAACAAATTCAACAAAGAA (SEQ ID NO: 5). Sequencing results were analyzed using DNASTAR software. The standard sequences Zwt and SPA-N were further analyzed for randomness and diversity within the three helical regions. Twenty completely correct clones were obtained. Some sequences were completely duplicated, and after merging the duplicates, 20 completely correct clones were obtained.

[0114] According to the DNA sequencing results, the DNA sequence of the monoclonal phage with the strongest binding activity to EBNA1 (i.e., the monoclonal phage presenting the EBNA1 affinity molecule) was selected from the 20 clones with correct sequencing (Z EBNA1 ) was studied as the target, and the amino acid sequence was Figure 1 The SEQ ID NO: 2 in the table and their coding sequences are shown in SEQ ID NO: 3. They are used for molecular cloning, expression and functional testing of EBNA1 binding affinity bodies in the next step.

[0115] Example 3: Construction of EBNA1 binding polypeptide recombinant plasmid and prokaryotic protein expression and purification

[0116] One clone with higher ELISA reading was selected as before ( Figure 1 Z in EBNA1 ), and Zwt was used as a negative control for EBNA1 binding polypeptide. In order to perform functional testing on the screened affibody molecules, recombinant plasmid construction, prokaryotic protein expression and identification were performed, and purified protein was prepared.

[0117] 1. Construction and identification of pET21a(+) / affibody recombinant plasmid

[0118] PCR primers were designed based on the affibody gene sequence (GenBank: GY324633.1), upstream primer 5'GGGAATTCCATATGGTTGACAACAAATTCAACAAAGAA 3' (SEQ ID NO: 6), downstream primer 5'CCGGAATTCCGTTTCGGAGCCTGAGCGT 3' (SEQ ID NO: 7); affibody Z was cloned from the correctly sequenced tertiary library. EBNA1 The target gene of affibody (SEQ ID NO: 3) was amplified by PCR as a template, and the full sequence of affibodyZwt after prokaryotic codon optimization (SEQ ID NO: 4) was synthesized as a negative control. The target gene amplified by PCR was cloned into the pET21a(+) vector via NdeI and XhoI to construct pET21a(+) / ZEBNA1 The recombinant plasmid was identified by sequencing.

[0119] 2. ZEBNA1 Prokaryotic Protein Expression and Preparation

[0120] Transform the recombinant plasmid into Escherichia coli E. coli BL21 (DE3) cells were cultured at 37°C for 16 h, and 0.8 mM isopropylthio-β-D-thiogalactopyranoside (IPTG) (Merck, Germany) was added to induce the expression of His-tagged Z EBNA1 and Zwt proteins. The recombinant proteins expressed after induction were purified by affinity chromatography using nickel chelate affinity chromatography colloid (Ni-NTA Agarose) (QIAGEN, USA) and identified by SDS-PAGE analysis. Results: The pET21a(+) / ZEBNA1 recombinant plasmid was successfully constructed using molecular biology techniques, and the purified ZEBNA1 and Zwt recombinant fusion proteins were prepared using a prokaryotic expression system. The proteins were analyzed by SDS-PAGE electrophoresis and Western blot using a His tag antibody as the primary antibody ( Figure 4 ) confirmed that the molecular mass of the band stained intensely with Coomassie Brilliant Blue was approximately 7.8 kDa, consistent with the expected molecular mass of ZEBNA1. Western blot results further confirmed that the protein at this location was the target protein. The present invention selected the pET21a(+) vector, which was designed to utilize the initiation enzyme site of its multiple cloning site as NdeI (CATATG). Its codon ATG is the amino acid (M) start codon for translation of the target protein. This allows the protein expressed using the prokaryotic expression system to be the target protein ZEBNA1 without the carrier protein fragment, thus preventing interference of the carrier protein with the experimental results.

[0121] Example 4: Binding of ZEBNA1 to the target protein EBNA1

[0122] To identify the specificity of ZEBNA1 binding to EBNA1, surface plasmon resonance (SPR) was used to analyze the affinity and specificity of the screened ZEBNA1 and its control Zwt affibody binding to the target protein EBNA1.

[0123] EBNA1 protein and Z were detected by ProteOn XPR36 system (Bio-Rad). EBNA1Affinity analysis of the interaction between peptides, i.e., surface plasmon resonance (SPR) was used to analyze the interaction between the above-mentioned His-tagged ZEBNA1 and its control Zwt affibody molecules and EBNA1 protein. According to the operating manual, the EBNA1 protein was immobilized on different flow cells by coupling to the GLH chip, and the affinity between the EBNA1 protein and the screened peptides was measured. The surface of the seventh flow cell was activated and inactivated to serve as a blank control during injection. The affibody molecules were diluted to 7 different gradient concentrations, i.e., 10μM, 5μM, 2.5μM, 1.25μM, 0.63μM, 0.31μM, and 0.16μM, respectively, and bound to EBNA1. All analyses were performed at 25°C, the injection sample volume was 200μl, and it was injected in random order at a flow rate of 30μl / min, followed by washing with 100mM HCl (BIO-RAD catalog number: #176-2250100mM HCl) for 6min (dissociation), and using ProteOn Manager TM Binding curves (sensograms) were analyzed using a 1:1 Langmuir binding model using the Bio-Rad software.

[0124] As a result, Z EBNA1 As the molecular concentration increases, its ability to interact with the target protein EBNA1 increases, and the affinity equilibrium dissociation constant KD value, Z EBNA1 and its control Zwt molecule were 1.96×10 -7 mol / L and 2.58 mol / L( Figure 7 ). Z EBNA1 The KD values ​​of the molecules differed by up to 10 7 times. Z obtained by screening EBNA1 It can bind to the EBNA1 recombinant protein with high affinity, while the wild-type Zwt molecule has almost no binding affinity to the EBNA1 protein. EBNA1 The molecule has a high specific affinity with EBNA1 protein, and it also shows that the prokaryotic expression of Z EBNA1 Both the molecule and the EBNA1 protein have biological activity.

[0125] Therefore, Z of the present invention EBNA1 The molecule has the ability to bind and recognize EBNA1. EBNA1 Affinity for EBNA1.

[0126] Example 5, Z EBNA1 Binding of peptides to EBNA1 protein expressed in cells

[0127] To further verify the screening of Z EBNA1 Affinity for EBNA1 to EBV+ B95-8 cells were used as the research object, and immunoprecipitation was used to verify Z EBNA1 Binding between molecules and EBNA1 protein molecules.

[0128] Immunoprecipitation (IP): B95-8 cells were cultured to the logarithmic growth phase, and after adding cell lysate, the cells were centrifuged at 10,000 r / min for 15 minutes. A portion of the supernatant protein was incubated with rabbit anti-EBNA1 monoclonal antibody and shaken slowly at 4°C overnight. 20 μl of fully resuspended Protein A + GAgarose was added and the cells were shaken slowly at 4°C for 3 hours. Centrifuged at 2,500 r / min for 5 minutes and the supernatant was carefully removed. The precipitate was washed 5 times with PBS, the supernatant was removed, and 40 μl of 1× SDS-PAGE electrophoresis loading buffer was added to resuspend the precipitate. After boiling, the precipitate was subjected to SDS-PAGE electrophoresis and transferred to a membrane. The precipitate was detected by Z EBNA1 Western blot detection was performed using 100 μg / mL molecule as primary antibody, rabbit anti-His tag as secondary antibody, and HRP-goat anti-rabbit as tertiary antibody. EBNA1 The molecule can specifically recognize and bind to the intact EBNA1 with a molecular weight of approximately 88 kDa in B95-8 cells, while the band is not seen at the same position in EBV-negative HNE2 cells ( Figure 6 ); IP results showed that the protein specifically recognized and bound by rabbit EBNA1 monoclonal antibody could indeed be EBNA1 Molecular binding.

[0129] The above results further verified Z at the cellular level. EBNA1 The molecule has strong affinity and binding specificity to EBNA1.

[0130] Example 6, Z EBNA1 Effects of peptides on EBNA1 dimer formation

[0131] EBNA1 exerts its biological functions in the form of dimers. EBNA1 To investigate whether the peptide could inhibit the formation of EBNA1 dimers, we used EBNA1 DBD recombinant protein as the research object and used Western blot to verify Z EBNA1 Effects of peptides on EBNA1 dimer formation.

[0132] 2 μg of EBNA1 DBD recombinant protein was first mixed with different concentrations (5 μg, 10 μg, 15 μg) of Z EBNA1:332 peptide was incubated at 4 degrees overnight, and then 5mM DSS crosslinker was added to prevent the crosslinked EBNA1 dimer from dissociating into EBNA1 monomers after adding reducing agent and SDS denaturant. Western blot detection was performed using His-mAb as primary antibody and rabbit anti-His tag as secondary antibody. Western blot results showed that Z EBNA1 The molecule can significantly inhibit the formation of EBNA1 recombinant protein dimers and polymers, while the same dose of Zwt has no such function ( Figure 7 ).

[0133] Therefore, Z of the present invention EBNA1 The molecule can inhibit the formation of target protein EBNA1 dimers, thereby inhibiting the biological function of EBNA1.

Claims

1. A polypeptide having binding affinity for Epstein-Barr virus nuclear antigen 1, characterized in that: The amino acid sequence of the polypeptide is selected from the sequence shown in SEQ ID NO:

2.

2. A targeting molecule targeting Epstein-Barr virus nuclear antigen 1, characterized in that: The targeting molecule is composed of the polypeptide according to claim 1 and a conjugate connected to the polypeptide; the conjugate is a polypeptide tag or a detectable marker.

3. An isolated polynucleotide, characterized in that The polynucleotide is a polynucleotide encoding the polypeptide having binding affinity to Epstein-Barr virus nuclear antigen 1 according to claim 1, and the polynucleotide sequence is shown in SEQ ID NO:

3.

4. A recombinant vector, characterized in that The vector comprises the polynucleotide according to claim 3.

5. A host cell, characterized in that The host cell comprises the recombinant vector according to claim 4, or the polynucleotide according to claim 3 is integrated into its genome.

6. The use of the targeting molecule according to claim 2, characterized in that: Used to prepare detection reagents for detecting EB virus infection or used to prepare diagnostic reagents for diagnosing EB virus infection diseases.

7. A pharmaceutical composition, characterized in that The invention comprises: a polypeptide having binding affinity to EB virus nuclear antigen 1 according to claim 1 or a targeting molecule targeting EB virus nuclear antigen 1 according to claim 2; and a pharmaceutically acceptable carrier.

8. A kit for diagnosing Epstein-Barr virus infection, characterized in that: The drug kit comprises: a targeting molecule targeting EB virus nuclear antigen 1 as claimed in claim 2 and a detection reagent for detecting a polypeptide tag or a detectable marker.

9. A drug kit for treating Epstein-Barr virus infection, characterized in that: The drug kit comprises: a polypeptide having binding affinity to EB virus nuclear antigen 1 as described in claim 1, or a targeting molecule targeting EB virus nuclear antigen 1 as described in claim 2, or a pharmaceutical composition as described in claim 7.

Citation Information

Patent Citations

  • A therapeutic inhibitor for EBV-associated tumor with tailor responsive optical imaging

    CN109414495A

  • Inhibitors of epstein BARR virus nuclear antigen 1

    WO2007002587A2