A method, product and application for detecting ATPase activity of recombinant enzyme auxiliary protein

Abstract

The invention discloses a method, product and application for detecting the ATPase activity of a recombinase auxiliary protein, a system for detecting the ATPase activity of a recombinase auxiliary protein, and a method for detecting the ATPase activity of a recombinase auxiliary protein. The invention provides an application for rapidly detecting the ATPase activity of a recombinase auxiliary protein, and the application includes using the aforementioned system and method. The system, method and application provided by the invention can visualize the judgment of enzyme activity, do not require cumbersome and expensive complex instruments and equipment, have high sensitivity, are simple and convenient to operate, do not require complex procedures and conditions, have a wide range of applications, and have good application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for detecting ATPase activity of a recombinase auxiliary protein, a product and an application thereof. Background Art

[0002] Recombinase polymerase amplification technology simulates DNA amplification in vivo and produces target fragments under isothermal conditions. This technology mainly relies on recombinase UvsX, recombinase UvsY, single-strand binding protein GP32 and strand displacement DNA polymerase Bsu. Recombinase UvsX can unwind double-stranded DNA without heating. At the beginning of the recombinase polymerase amplification reaction, recombinase UvsX binds to the primer with the participation of ATP to form a recombinase UvsX-primer complex, which can scan the target double-stranded DNA complementary to the primer sequence. Then, the nucleic acid protein complex invades the 5' end site to form a D-shaped loop. The single-strand binding protein GP32 binds to the displaced single strand to stabilize it. At the same time, the recombinase UvsX leaves the 3' end of the oligonucleotide and is used by the DNA polymerase after degradation. Afterwards, the strand displacement DNA polymerase Bsu binds to the free 3' end of the nucleic acid protein complex to extend the chain and form a new complementary chain. In the recombinase polymerase amplification technology, the recombinase UvsY can change the reversible reaction process of the dissociation and rebinding of the recombinase UvsX-primer complex, making the reaction more conducive to the progress of RPA.

[0003] T4 UvsY protein is a key enzyme in RPA technology. It works together with T4 UvsX protein in RPA to promote the RPA reaction. There is an urgent need to find a method to detect the activity of T4 UvsY protein.

[0004] The UvsY coenzyme is derived from T4 bacteriophage and is recombinantly expressed in E. coli. The enzyme can promote the activity of the DNA-dependent ATPase of the T4 UvsX recombinase, including ATP binding sites and interaction sites, and reduce the critical concentration of UvsX required for its activity, thereby promoting strand displacement. Therefore, judging and quantifying the ATPase activity of UvsY is conducive to better guiding and promoting the development and application of RPA technology in actual inspection and detection processes. Summary of the invention

[0005] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides a system for detecting the ATPase activity of a recombinase auxiliary protein, wherein the system comprises a volume ratio of reaction buffer: VP2-R: SSB: ATP: enzyme-free water = 2.8:1:1:5:5.2.

[0007] Furthermore, the reaction buffer includes Tris-HCl, KCl, MgCl2, and DTT.

[0008] Furthermore, the pH value of the Tris-HCl is 7.9.

[0009] Furthermore, the concentration range of the Tris-HCl is 100-150 mM.

[0010] In some embodiments, the concentration range of Tris-HCl includes 100 mM, 105 mM, 110 mM, 115 mM, 120 mM, 125 mM, 130 mM, 135 mM, 140 mM, 145 mM, 150 mM.

[0011] Furthermore, the concentration range of KCl is 450-550 mM.

[0012] In some embodiments, the concentration range of KCl includes 450 mM, 460 mM, 470 mM, 480 mM, 490 mM, 500 mM, 510 mM, 520 mM, 530 mM, 540 mM, 550 mM.

[0013] Furthermore, the concentration range of the MgCl2 is 50-100 mM.

[0014] In some embodiments, the concentration range of MgCl2 includes 50mM, 55mM, 60mM, 65mM, 70mM, 75mM, 80mM, 85mM, 90mM, 95mM, 100mM.

[0015] Furthermore, the concentration range of DTT is 1-10 mM.

[0016] In some embodiments, the concentration range of DTT includes 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM.

[0017] Furthermore, the concentration range of the VP2-R is 0-10 μM.

[0018] In some embodiments, the concentration range of VP2-R includes 0 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, and 10 μM.

[0019] Furthermore, the concentration range of the SSB is 0-1 mg / mL.

[0020] In some embodiments, the concentration range of SSB includes 0 mg / mL, 0.005 mg / mL, 0.01 mg / mL, 0.015 mg / mL, 0.02 mg / mL, 0.025 mg / mL, 0.03 mg / mL, 0.035 mg / mL, 0.04 mg / mL, 0.045 mg / mL, 0.05 mg / mL, 0.055 mg / mL, 0.06 mg / mL, 0.065 mg / mL, 0.07mg / mL, 0.075mg / mL, 0.08mg / mL, 0.085mg / mL, 0.09mg / mL, 0.095mg / mL, 0.1mg / mL, 0 .2mg / mL, 0.3mg / mL, 0.4mg / mL, 0.5mg / mL, 0.6mg / mL, 0.7mg / mL, 0.8mg / mL, 0.9mg / mL, 1.0mg / mL.

[0021] Furthermore, the concentration range of the ATP is 0-10 mM.

[0022] In some embodiments, the concentration range of ATP includes 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM.

[0023] Furthermore, the concentration of the Tris-HCl is 120 mM.

[0024] Furthermore, the concentration of KCl is 540 mM.

[0025] Furthermore, the concentration of MgCl2 is 60mM.

[0026] Furthermore, the concentration of DTT is 6 mM.

[0027] Furthermore, the concentration of VP2-R is 2 μM.

[0028] Furthermore, the concentration of ATP is 5 mM.

[0029] Furthermore, the concentration of SSB is 0.5 mg / mL.

[0030] In some embodiments, the VP2-R refers to a template for detecting the ATPase activity of UvsY, and the specific sequence of the VP2-R is AGTTTGTATTTCCCATTTGAGTTACACCACGTCT.

[0031] The second aspect of the present invention provides a method for detecting the ATPase activity of a recombinase auxiliary protein, the method comprising the following steps:

[0032] 1) After the system described in the first aspect of the present invention is prepared, the system is placed under a constant temperature of 37° C. for incubation;

[0033] 2) adding recombinase and recombinase auxiliary protein to the product after the reaction in step 1), supplementing with enzyme-free water, and obtaining a second reaction system, and continuing to incubate the reaction at a constant temperature of 37° C.;

[0034] 3) adding a phosphorus fixative to the product of the reaction in step 2) and incubating the reaction at a constant temperature of 45° C.;

[0035] 4) taking the product of the reaction completed in step 3) and detecting the absorbance at 660 nm;

[0036] 5) Calculate the ATPase activity of UvsY based on the phosphate ion concentration standard curve and the absorbance value obtained in step 4).

[0037] Furthermore, the incubation reaction time in step 1) is 15 minutes.

[0038] Furthermore, the incubation reaction time in step 2) is 15 minutes.

[0039] Furthermore, the volume ratio of the system in step 1), the recombinase in step 2), the recombinase auxiliary protein in step 2), the second reaction system in step 2), and the phosphorus fixative in step 3) is 15:1:2:20:180.

[0040] Furthermore, the phosphorus fixing agent includes ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water.

[0041] Furthermore, the volume ratio of the ammonium molybdate, ascorbic acid, sulfuric acid and enzyme-free water is 0.3:1:1:2.7.

[0042] Furthermore, the sources of the recombinase include bacteriophage, prokaryotes, and eukaryotes.

[0043] Furthermore, the bacteriophage includes T4, T6, Rb69 or Aeh 1.

[0044] Furthermore, the recombinase comprises UvsX of T4 bacteriophage.

[0045] Further, the prokaryotic organism is Escherichia coli.

[0046] Furthermore, the recombinase includes RecA of Escherichia coli.

[0047] Furthermore, the recombinase includes Rad51 of eukaryotic organisms.

[0048] The term "recombinase" used in the present invention mainly refers to recombinases (recombinant proteins) that can be used for RPA reactions, and these recombinases are derived from prokaryotes, viruses or eukaryotes.

[0049] Furthermore, the sources of the recombinase auxiliary protein include bacteriophage and Escherichia coli.

[0050] Furthermore, the bacteriophage includes T4, T6, Rb69 or Aeh 1.

[0051] Furthermore, the recombinase auxiliary protein includes UvsY of T4 phage.

[0052] Furthermore, the recombinase auxiliary protein includes RecR, RecO or RecF derived from Escherichia coli.

[0053] The term "recombinase auxiliary protein" in the present invention may be from prokaryotes, viruses or eukaryotes. Typical loading proteins include Escherichia coli RecO, Escherichia coli RecR, UvsY, and their mutants or fragments, or combinations thereof.

[0054] Furthermore, the incubation reaction time in step 3) is 15 minutes.

[0055] Furthermore, the concentration of ammonium molybdate is 13% W / W.

[0056] Furthermore, the ascorbic acid concentration is 10% W / W.

[0057] Furthermore, the concentration of sulfuric acid is 2.5M.

[0058] Furthermore, the concentration range of the recombinase UvsX is 0-1 mg / mL.

[0059] In some embodiments, the recombinase UvsX concentration range includes 0 mg / mL, 0.005 mg / mL, 0.01 mg / mL, 0.015 mg / mL, 0.02 mg / mL, 0.025 mg / mL, 0.03 mg / mL, 0.035 mg / mL, 0.04 mg / mL, 0.045 mg / mL, 0.05 mg / mL, 0.055 mg / mL, 0.06 mg / mL, 0.0 65mg / mL, 0.07mg / mL, 0.075mg / mL, 0.08mg / mL, 0.085mg / mL, 0.09mg / mL, 0.095mg / mL, 0.1mg / mL, 0.2mg / mL, 0.3mg / mL, 0.4mg / mL, 0.5mg / mL, 0.6mg / mL, 0.7mg / mL, 0.8mg / mL, 0.9mg / mL, 1.0mg / mL.

[0060] In some embodiments, the recombinase UvsX protein can be derived from myoviridae phage proteins, such as T4 / T2 / Rb69 / Aehl / KVP40 / Acinetobacter phage 133 / Aeromonas phage 65 / cyanophage P-SSM2 / cyanophage PSSM4 / cyanophage S-PM2 / Rb14 / Rb32 / Aeromonas phage 25 / Vibrio phage nt-1 / phi-1 / Rbl6 / Rb43 / phage 31 / phage 44RR2.8t / Rb49 / phage Rb3 and phage LZ2.

[0061] Furthermore, the concentration range of the recombinase auxiliary protein UvsY is 0-1 mg / mL.

[0062] In some embodiments, the concentration range of the recombinase auxiliary protein UvsY includes 0 mg / mL, 0.005 mg / mL, 0.01 mg / mL, 0.015 mg / mL, 0.02 mg / mL, 0.025 mg / mL, 0.03 mg / mL, 0.035 mg / mL, 0.04 mg / mL, 0.045 mg / mL, 0.05 mg / mL, 0.055 mg / mL, 0.06 mg / mL, 0.075 mg / mL, 0.080 mg / mL, 0.090 mg / mL, 0.100 mg / mL, 0.110 mg / mL, 0.120 mg / mL, 0.130 mg / mL, 0.140 mg / mL, 0.150 mg / mL, 0.160 mg / mL, 0.170 mg / mL, 0.180 mg / mL, 0.190 mg / mL, 0.200 mg / mL, 0.210 mg / mL, 0.220 mg / mL, 0.230 mg / mL, 0.240 mg / mL .065mg / mL, 0.07mg / mL, 0.075mg / mL, 0.08mg / mL, 0.085mg / mL, 0.09mg / mL, 0.095mg / mL, 0.1mg / mL , 0.2mg / mL, 0.3mg / mL, 0.4mg / mL, 0.5mg / mL, 0.6mg / mL, 0.7mg / mL, 0.8mg / mL, 0.9mg / mL, 1.0mg / mL.

[0063] In some embodiments, the recombinase auxiliary protein can be a typical UvsY protein, whose sources include myoviral phages such as T4 / T2 / T6 / Rb69 / Aehl / KVP40 / Acinetobacter phage / Aeromonas phage 65 / cyanophage P-SSM2 / cyanophage PSSM4 / cyanophage S-PM2 / Rbl4 / Rb32 / Aeromonas phage 25 / Vibrio phage nt-1 / phi-1 / Rbl6 / Rb43 / phage 31 / phage 44RR2.8t / Rb49 / phage Rb3 and phage LZ2.

[0064] Furthermore, the concentration of the recombinase UvsX is 0.5 mg / mL.

[0065] Furthermore, the concentration of the recombinase auxiliary protein UvsY is 0.5 mg / mL.

[0066] Furthermore, the construction of the phosphate ion concentration standard curve includes the following steps: using the reaction buffer, KH2PO4 standard solution, and enzyme-free water described in the first aspect of the present invention to form a phosphate ion concentration standard curve preparation system, and incubating the reaction at a constant temperature of 37°C; supplementing a phosphorus fixative, incubating the reaction at a constant temperature of 45°C, measuring the absorbance at 660nm, and obtaining the phosphate ion concentration standard curve based on the absorbance.

[0067] Furthermore, the volume ratio of the reaction buffer, KH2PO4 standard solution, enzyme-free water, and phosphorus fixative is 2.8:1:16.2:180.

[0068] Furthermore, the incubation reaction time is 15 minutes.

[0069] Furthermore, the concentration range of the KH2PO4 standard solution is 0-100 mM.

[0070] In some embodiments, the concentration range of the KH2PO4 standard solution includes 0 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, and 100 mM.

[0071] Further, the concentration of the KH2PO4 standard solution includes 0, 10, 20, 40, 50, 60, 80 and 100 mM.

[0072] Furthermore, the method further comprises a step of enzyme activity calculation, wherein the step comprises a specific enzyme activity calculation formula:

[0073] in, is the phosphate ion concentration calculated based on the linear relationship / mM,

[0074] 200 is the volume of the reaction system / μL,

[0075] V is the volume of UvsY used / μL.

[0076] In some embodiments, in the method, in an acidic medium, phosphate ions react with molybdate ions to form a dark blue complex, and the phosphate ion content in the solution can be indirectly determined by measuring the absorbance at 660 nm. Based on this process, the ATP hydrolysis process is combined with the phosphomolybdenum blue color development process to achieve a rapid judgment of the ATPase activity of UvsY.

[0077] In some embodiments, the enzyme activity unit U is defined as 1 μg of the recombinant enzyme auxiliary protein UvsY protein catalyzing 50 nmol of ATP to produce 1 nmol of phosphate ions within 15 min as 1 enzyme activity unit U. In some embodiments, the phosphomolybdenum blue reagent combines with phosphate ions to form a dark blue complex, the higher the phosphate ion concentration, the darker the color, and the absorbance value at 660 nm of the solution is measured, which is linearly related to the phosphate ion concentration.

[0078] The third aspect of the present invention provides a composition, which comprises the reagent used in the method described in the second aspect of the present invention.

[0079] The term "composition" encompasses and discloses any physical entity that contains (or consists of or consists essentially of) the respective listed substances, and the physical form of the composition is not limited. For example, the term "composition" encompasses and discloses a powder, wherein the listed substances are each present in powder form. In one embodiment, the term "composition" also encompasses and discloses a liquid solution, wherein the listed substances are each present in a soluble form. In one embodiment, the term "composition" also encompasses and discloses an emulsion, wherein the listed substances are present. In one embodiment, the term "composition" also encompasses and discloses a suspension, wherein the listed substances are present. In one embodiment, the term "composition" also encompasses and discloses a mixture, wherein the reagents as defined above are in one form.

[0080] Furthermore, the composition comprises the reaction buffer described in the second aspect of the present invention, a KH2PO4 standard solution, enzyme-free water, a phosphorus fixative, a recombinase UvsX, and a recombinase auxiliary protein UvsY.

[0081] The fourth aspect of the present invention provides the system described in the first aspect of the present invention and the use of the method described in the second aspect of the present invention in the rapid detection of ATPase activity of a recombinase auxiliary protein.

[0082] The fifth aspect of the present invention provides the system described in the first aspect of the present invention, and the use of the method described in the second aspect of the present invention in preparing a system or device for automatically detecting the ATPase activity of a recombinase auxiliary protein.

[0083] The term "automated" refers to a situation where any one or more steps (e.g., cell collection) of a procedure or method do not need to be performed "by hand" (i.e., manually), but wherein the desired step or procedure (e.g., cell collection) can be performed by one or more suitable devices or systems such as one or more robots, liquid handling robots and / or other (e.g., solvent preparation) liquid transfer devices, which are programmed before performing one or more steps so that the corresponding steps and modes (especially the collection step) are performed in an automated manner according to the programmed content.

[0084] A sixth aspect of the present invention provides a system or device, wherein the system or device comprises a processing module, and the processing module is used to implement the method described in the second aspect of the present invention.

[0085] Furthermore, the system or device also includes a storage module.

[0086] Furthermore, the storage module stores computer programs.

[0087] Furthermore, the computer program is used to programmatically execute the steps of the method described in the second aspect of the present invention.

[0088] Furthermore, the computer program is implemented by a processing module to perform specific operations.

[0089] The term "system" or the term "apparatus" refers not only to a system or apparatus having a configuration in which a plurality of computers, pieces of hardware, apparatuses, etc. are connected to each other via a communication unit such as a network (including communication connections established in a one-to-one manner), but also to a system or apparatus realized by one computer, one piece of hardware, one apparatus, etc. The term "apparatus" and the term "system" are used as terms having the same meaning.

[0090] In a specific embodiment, one of the computer programs can construct a processing module, or multiple processing modules can be constructed using one program. On the contrary, multiple computer programs can be used to construct a processing module. In addition, multiple computer programs can be executed by one computer, and multiple processing modules can be operated by one computer; similarly, a single computer program can be executed by multiple computers, and a single processing module can be operated by multiple computers. In certain embodiments, the computer stores a storage module. Examples of storage modules may include a hard disk (HD), a random access memory module (RAM), an external storage medium, a storage medium connected via a communication line, and a register included in a central processing unit (CPU), which can be stored separately or in the form of a storage device in the computer.

[0091] The term "processing module" is intended to include any integrated circuit or other electronic and mechanical device capable of operating on at least one instruction language, such as executing instructions, codes, computer programs and scripts accessed from a storage medium. However, the term "processing module" should not be construed as limited to hardware capable of executing software, but rather refers in a general manner to a processing device, which may include, for example, a microprocessing module, an integrated circuit, or a programmable logic device (PLD). A processing module may also encompass one or more graphics processing units (GPUs), whether for computer graphics and image processing or other functions.

[0092] The seventh aspect of the present invention provides a kit for the ATPase activity of a recombinase auxiliary protein, the kit comprising the system described in the first aspect of the present invention, the reagents used in the method described in the second aspect of the present invention, an incubation container and step instructions.

[0093] The term "container" refers to a compartment (e.g., a microfluidic channel, a well, a tube, or a droplet) in which a biochemical reaction (e.g., target protein and antibody binding, nucleic acid hybridization, and primer extension) or cell growth can occur. The terms "container" and "compartment" can be used interchangeably. The container or compartment can be solid-walled (when the boundary of the container or compartment is solid, such as glass, plastic, or polydimethylsiloxane (PDMS)), or liquid-walled (when the boundary of the container or compartment is liquid, such as oil). A solid-walled container can contain a solid scaffold that is a continuous solid connecting all containers. The volume of the compartment can be as large as to allow industrial, large-scale production, or as small as 1 picoliter. The volume of the aqueous contents in the compartment can be less than or approximately equal to the volume of the compartment. The container can contain a variety of polymerizable or gelable polymers and / or monomers. A variety of polymerizable or gelable polymers and / or monomers can form a hydrogel or hardened matrix when polymerized or gelled, thereby forming hardened particles. The hardened particles can be beads.

[0094] Advantages and beneficial effects of the present invention:

[0095] The present invention provides a method, product and application for detecting ATPase activity of a recombinant enzyme auxiliary protein, which has multiple advantages, such as visual judgment of enzyme activity; no need for cumbersome and expensive complex instruments and equipment; the method has high sensitivity and can detect phosphate ion concentration of 50 μM; the operation is simple and convenient, and no complicated procedures and conditions are required. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 is a standard curve diagram of phosphate ion concentration and phosphomolybdenum blue reagent absorbance in Example 1;

[0097] Figure 2 This is the correlation diagram between the SSB protein concentration and the absorbance of the phosphomolybdenum blue reagent in the recombinase auxiliary protein UvsY detection system;

[0098] Figure 3 is a standard curve diagram of phosphate ion concentration and phosphomolybdenum blue reagent absorbance in Example 2;

[0099] Figure 4 This is a correlation diagram between the concentration of UvsX protein and the absorbance of phosphomolybdenum blue reagent in the recombinase auxiliary protein UvsY detection system;

[0100] Figure 5 is a standard curve diagram of phosphate ion concentration and phosphomolybdenum blue reagent absorbance in Example 3;

[0101] Figure 6 It is a correlation diagram between the concentration of UvsY protein and the absorbance of phosphomolybdenum blue reagent in the recombinase auxiliary protein UvsY detection system;

[0102] Figure 7 It is a standard curve diagram of phosphate ion concentration and phosphomolybdenum blue reagent absorbance in Example 4. DETAILED DESCRIPTION

[0103] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0104] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0105] Example 1

[0106] 1. Experimental Materials

[0107] The reagents used in the experiment are listed in Table 1.

[0108] Table 1

[0109] Reagent name Symbol / Abbreviation Manufacturer Part Number batch number Potassium dihydrogen phosphate <![CDATA[KH2PO4]]> Sinopharm 10017608 20210403 Ammonium molybdate <![CDATA[(NH4)2MoO4]]> Sinopharm 10002316 20221214 ascorbic acid VC Sinopharm 10004014 20230215 sulfuric acid <![CDATA[H2SO4]]> Sinopharm 10021618 20210802 Tris(hydroxyaminomethane) hydrochloride Tris-HCl Sinopharm XW1247635151 20220303 Potassium chloride KCl Sinopharm 10016308 20230315 Magnesium chloride MgCl2 Sinopharm 10012817 20220625 Dithiothreitol DTT Sinopharm XW275654191 20221223 Sodium chloride NaCl Sinopharm 10019308 20211223 ATP ATP Sinopharm XW00566551 20220811 Ethylenediaminetetraacetic acid disodium salt EDTA Sinopharm 10009717 20220330 glycerin Glycerol Sinopharm 10010618 20220522 Sodium hydroxide NaOH Sinopharm 10019718 20221110 Enzyme-free water <![CDATA[free-DNase H2O]]> Sinopharm IAM9932 20230504 PBS Phosphate Buffered Saline PBS Sinopharm 72016960 20230509 Single-chain binding protein SSB East Anti EB0112 20230217 Recombinase UxF East Anti EB0109 20230512 Recombinase accessory protein UxfV East Anti EB0111 20230718-776 ssDNA VP2-R Bioengineering 1939871041 112557167

[0110] The formula of the reaction buffer in the experimental recipe is shown in Table 2.

[0111] Table 2

[0112] Recipe Name Components Final concentration of each component / mM Response buffer Tris-HCl (pH = 7.9) 100～150 KCl 450～550 <![CDATA[MgCl2]]> 50～100 DTT 1～10

[0113] The sequence of VP2-R in the experiment is shown as AGTTTGTATTTCCCATTTGAGTTACACCACGTCT (SEQ ID NO: 1).

[0114] 2. Experimental methods

[0115] 1) According to the experimental requirements, each reagent group was prepared into the required concentration: VP2-R concentration range was 0-10 μM, ATP concentration range was 0-10 mM, SSB concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme UvsX concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme auxiliary protein UvsY concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), and KH2PO4 standard solution concentration range was 0-100 mM;

[0116] 2) Prepare the recombinase auxiliary protein UvsY detection system: the specific components include 2.8 μL reaction buffer, 1 μL VP2-R, 1 μL SSB, 5 μL ATP, and enzyme-free water, and the total volume is maintained at 15 μL; the final concentration of Tris-HCl in each component of the reaction buffer is 120 mM, the final concentration of KCl is 540 mM, the final concentration of MgCl2 is 60 mM, and the final concentration of DTT is 6 mM; the final concentration of VP2-R is 2 μM; the final concentration of ATP is 5 mM; the final concentration of SSB is 0.1, 0.3, 0.5, 0.7, 0.9, 1.0 mg / mL;

[0117] 3) Incubate the recombinase auxiliary protein UvsY detection system in step 2) at 37° C. for 15 minutes;

[0118] 4) Add 1 μL of UvsX and 2 μL of UvsY to the reaction system product of step 3) and add water to a total volume of 20 μL, and continue to incubate the reaction at 37°C for 15 min; wherein the concentration of the recombinase UvsX is 0.5 mg / mL; the concentration of the recombinase auxiliary protein UvsY is 0.5 mg / mL;

[0119] 5) During the 15-min incubation of the reaction system in step 4), a phosphate ion concentration standard curve system was prepared; the specific components included 2.8 μL of reaction buffer, 1 μL of KH2PO4 standard solution, and enzyme-free water, with a total volume of 20 μL; the reaction was incubated at 37° C. for 15 min; wherein the concentrations of the KH2PO4 standard solution were 0, 10, 20, 40, 50, 60, 80, and 100 mM;

[0120] 6) During the incubation of the reaction system in step 4) for 15 minutes, a phosphomolybdic blue color developing solution is prepared, wherein the specific components include: ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water; the ratio of each component is 0.3:1:1:2.7; wherein the concentration of ammonium molybdate is 13% (W / W); the concentration of ascorbic acid is 10% (W / W); and the concentration of sulfuric acid is 2.5 M;

[0121] 7) The reaction products of steps 4 and 5 were supplemented with 180 μL of phosphorus fixative (phosphomolybdenum blue color developing solution) respectively, and incubated at 45°C for 15 min;

[0122] 8) Take 80 μL of the product from step 7) and transfer to a transparent ELISA plate to measure the absorbance at 660 nm.

[0123] 3. Experimental results

[0124] Draw a standard curve between phosphate ion concentration and the absorbance of phosphomolybdenum blue reagent. The result is as follows: Figure 1 As shown, the results show that the formula of the standard curve is y=1.6333x-0.0178, R 2 =0.9976, indicating that the dark blue complex formed by the combination of the phosphomolybdenum blue reagent and phosphate ions is detected. The higher the phosphate ion concentration, the darker the color. The absorbance value at 660nm of the measured solution is linearly related to the phosphate ion concentration.

[0125] The results of the recombinase auxiliary protein UvsY detection system between SSB protein concentration and phosphomolybdenum blue reagent absorbance are as follows Figure 2 As shown, the results show that during the hydrolysis of ATP, the single-stranded binding protein SSB, the recombinase UvsX, and the recombinase auxiliary protein UvsY bind to the single-stranded DNA, and then contact ATP to achieve catalytic hydrolysis. As the concentration of SSB protein increases, the amount of single-stranded binding protein SSB bound to the single-stranded DNA increases. When the final concentration of SSB in the system reaches 0.025 mg / mL, the binding of some recombinases UvsX and recombinase auxiliary proteins UvsY to single-stranded DNA is hindered in the subsequent experimental steps, and the hydrolysis process of ATP is competitively inhibited. This is manifested in the color development process of the phosphomolybdenum blue reagent as the absorbance value first increases and then decreases with the increase of SSB protein concentration.

[0126] The results of the effect of the recombinase auxiliary protein UvsY on ATP hydrolysis at different SSB protein concentrations are shown in Table 3. The results show that according to Figure 1 The linear relationship between the absorbance of the phosphomolybdenum blue reagent and the phosphate ion concentration (y=1.6333x-0.0178) can be used to calculate the phosphate ion concentration generated in this experiment, and the enzyme activity can be calculated according to the definition of enzyme activity. Enzyme activity calculation formula: in is the phosphate ion concentration calculated based on the linear relationship / mM, 200 is the reaction system volume / μL, and V is the volume of UvsY used / μL.

[0127] Table 3

[0128] SSB protein concentration mg / mL Abs Calculated concentration of phosphate ion / mM Enzyme activity / (U / μL) 0.000 0.2297 0.1516 15.16 0.005 0.5287 0.3347 33.47 0.015 0.7242 0.4544 45.44 0.025 0.7700 0.4824 48.24 0.035 0.5780 0.3649 36.49 0.045 0.5260 0.3330 33.30 0.050 0.4265 0.2721 27.21

[0129] Example 2

[0130] 1. Experimental Materials

[0131] The reagents used in the experiment are listed in Table 4.

[0132] Table 4

[0133] Reagent name Symbol / Abbreviation Manufacturer Part Number batch number Potassium dihydrogen phosphate <![CDATA[KH2PO4]]> Sinopharm 10017608 20210403 Ammonium molybdate <![CDATA[(NH4)2MoO4]]> Sinopharm 10002316 20221214 ascorbic acid VC Sinopharm 10004014 20230215 sulfuric acid <![CDATA[H2SO4]]> Sinopharm 10021618 20210802 Tris(hydroxyaminomethane) hydrochloride Tris-HCl Sinopharm XW1247635151 20220303 Potassium chloride KCl Sinopharm 10016308 20230315 Magnesium chloride MgCl2 Sinopharm 10012817 20220625 Dithiothreitol DTT Sinopharm XW275654191 20221223 Sodium chloride NaCl Sinopharm 10019308 20211223 ATP ATP Sinopharm XW00566551 20220811 Ethylenediaminetetraacetic acid disodium salt EDTA Sinopharm 10009717 20220330 glycerin Glycerol Sinopharm 10010618 20220522 Sodium hydroxide NaOH Sinopharm 10019718 20221110 Enzyme-free water <![CDATA[free-DNase H2O]]> Sinopharm IAM9932 20230504 PBS Phosphate Buffered Saline PBS Sinopharm 72016960 20230509 Single-chain binding protein SSB East Anti EB0112 20230217 Recombinase UxF East Anti EB0109 20230512 Recombinase accessory protein UxfV East Anti EB0111 20230718-776 ssDNA VP2-R Bioengineering 1939871041 112557167

[0134] The formula of the reaction buffer in the experimental recipe is shown in Table 5.

[0135] Table 5

[0136] Recipe Name Components Final concentration of each component / mM Response buffer Tris-HCl (pH = 7.9) 100～150 KCl 450～550 <![CDATA[MgCl2]]> 50～100 DTT 1～10

[0137] The sequence of VP2-R in the experiment is shown as AGTTTGTATTTCCCATTTGAGTTACACCACGTCT (SEQ ID NO: 1).

[0138] 2. Experimental methods

[0139] 1) According to the experimental requirements, each reagent group was prepared into the required concentration: VP2-R concentration range was 0-10 μM, ATP concentration range was 0-10 mM, SSB concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme UvsX concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme auxiliary protein UvsY concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), and KH2PO4 standard solution concentration range was 0-100 mM;

[0140] 2) Prepare the recombinase auxiliary protein UvsY detection system: the specific components include 2.8 μL reaction buffer, 1 μL VP2-R, 1 μL SSB, 5 μL ATP, and enzyme-free water, and the total volume is maintained at 15 μL; the final concentration of Tris-HCl in each component of the reaction buffer is 120 mM, the final concentration of KCl is 540 mM, the final concentration of MgCl2 is 60 mM, and the final concentration of DTT is 6 mM; the final concentration of VP2-R is 2 μM; the final concentration of ATP is 5 mM; the final concentration of SSB is 0.5 mg / mL;

[0141] 3) Incubate the recombinase auxiliary protein UvsY detection system in step 2) at 37° C. for 15 minutes;

[0142] 4) Add 1 μL of UvsX and 2 μL of UvsY to the reaction system product of step 3) and add water to a total volume of 20 μL, and continue to incubate the reaction at 37°C for 15 min; wherein the concentration of the recombinase UvsX is 0.1, 0.3, 0.5, 0.7, 0.9, 1.0 mg / mL; the concentration of the recombinase auxiliary protein UvsY is 0.5 mg / mL;

[0143] 5) During the 15-min incubation of the reaction system in step 4), a phosphate ion concentration standard curve system was prepared; the specific components included 2.8 μL of reaction buffer, 1 μL of KH2PO4 standard solution, and enzyme-free water, with a total volume of 20 μL; the reaction was incubated at 37° C. for 15 min; wherein the concentrations of the KH2PO4 standard solution were 0, 10, 20, 40, 50, 60, 80, and 100 mM;

[0144] 6) During the incubation of the reaction system in step 4) for 15 minutes, a phosphomolybdic blue color developing solution is prepared, wherein the specific components include: ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water; the ratio of each component is 0.3:1:1:2.7; wherein the concentration of ammonium molybdate is 13% (W / W); the concentration of ascorbic acid is 10% (W / W); and the concentration of sulfuric acid is 2.5 M;

[0145] 7) The reaction products of steps 4 and 5 were supplemented with 180 μL of phosphorus fixative (phosphomolybdenum blue color developing solution) respectively, and incubated at 45°C for 15 min;

[0146] 8) Take 80 μL of the product from step 7) and transfer to a transparent ELISA plate to measure the absorbance at 660 nm.

[0147] 3. Experimental results

[0148] Draw a standard curve between phosphate ion concentration and the absorbance of phosphomolybdenum blue reagent. The result is as follows: Figure 3 As shown, the results show that the formula of the standard curve is y=1.6397x-0.0124, R 2 =0.9953. This indicates that the dark blue complex formed by the combination of phosphomolybdenum blue reagent and phosphate ions, the higher the phosphate ion concentration, the darker the color, and the absorbance value at 660nm of the measured solution is linearly related to the phosphate ion concentration.

[0149] The results of the recombinase auxiliary protein UvsY detection system between the UvsX protein concentration and the absorbance of the phosphomolybdenum blue reagent are as follows Figure 4As shown, the results show that during the hydrolysis of ATP, the single-stranded binding protein SSB, the recombinase UvsX, and the recombinase auxiliary protein UvsY bind to the single-stranded DNA, and then contact ATP to achieve catalytic hydrolysis. As the concentration of the recombinase UvsX protein increases, when the final concentration of the recombinase UvsX in the system reaches 0.025 mg / mL, the binding with the single-stranded DNA and the binding amount of the recombinase auxiliary protein UvsY basically reach saturation. When the concentration of UvsX continues to increase, the excess UvsX does not participate in the reaction, which is manifested in the color development process of the phosphomolybdenum blue reagent as the absorbance value first increases with the increase of the UvsX protein concentration and then gradually flattens and remains unchanged.

[0150] The results of the effect of the recombinase auxiliary protein UvsY on ATP hydrolysis at different UvsX protein concentrations are shown in Table 6. The results show that according to Figure 3 The linear relationship between the absorbance of the phosphomolybdenum blue reagent and the phosphate ion concentration (y=1.6397x-0.0124) can be used to calculate the phosphate ion concentration generated in this experiment, and the enzyme activity can be calculated according to the definition of enzyme activity. Enzyme activity calculation formula: in is the phosphate ion concentration calculated based on the linear relationship / mM, 200 is the reaction system volume / μL, and V is the volume of UvsY used / μL.

[0151] Table 6

[0152]

[0153] Example 3

[0154] 1. Experimental Materials

[0155] The reagents used in the experiment are listed in Table 7.

[0156] Table 7

[0157] Reagent name Symbol / Abbreviation Manufacturer Part Number batch number Potassium dihydrogen phosphate <![CDATA[KH2PO4]]> Sinopharm 10017608 20210403 Ammonium molybdate <![CDATA[(NH4)2MoO4]]> Sinopharm 10002316 20221214 ascorbic acid VC Sinopharm 10004014 20230215 sulfuric acid <![CDATA[H2SO4]]> Sinopharm 10021618 20210802 Tris(hydroxyaminomethane) hydrochloride Tris-HCl Sinopharm XW1247635151 20220303 Potassium chloride KCl Sinopharm 10016308 20230315 Magnesium chloride <![CDATA[MgCl2]]> Sinopharm 10012817 20220625 Dithiothreitol DTT Sinopharm XW275654191 20221223 Sodium chloride NaCl Sinopharm 10019308 20211223 ATP ATP Sinopharm XW00566551 20220811 Ethylenediaminetetraacetic acid disodium salt EDTA Sinopharm 10009717 20220330 glycerin Glycerol Sinopharm 10010618 20220522 Sodium hydroxide NaOH Sinopharm 10019718 20221110 Enzyme-free water <![CDATA[free-DNase H2O]]> Sinopharm IAM9932 20230504 PBS Phosphate Buffered Saline PBS Sinopharm 72016960 20230509 Single-chain binding protein SSB East Anti EB0112 20230217 Recombinase UxF East Anti EB0109 20230512 Recombinase accessory protein UxfV East Anti EB0111 20230718-776 ssDNA VP2-R Bioengineering 1939871041 112557167

[0158] The formula of the reaction buffer in the experimental recipe is shown in Table 8.

[0159] Table 8

[0160] Recipe Name Components Final concentration of each component / mM Response buffer Tris-HCl (pH = 7.9) 100～150 KCl 450～550 <![CDATA[MgCl2]]> 50～100 DTT 1～10

[0161] The sequence of VP2-R in the experiment is shown as AGTTTGTATTTCCCATTTGAGTTACACCACGTCT (SEQ ID NO: 1).

[0162] 2. Experimental methods

[0163] 1) According to the experimental requirements, each reagent group was prepared into the required concentration: VP2-R concentration range was 0-10 μM, ATP concentration range was 0-10 mM, SSB concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme UvsX concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme auxiliary protein UvsY concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), and KH2PO4 standard solution concentration range was 0-100 mM;

[0164] 2) Prepare the recombinase auxiliary protein UvsY detection system: the specific components include 2.8 μL reaction buffer, 1 μL VP2-R, 1 μL SSB, 5 μL ATP, and enzyme-free water, and the total volume is maintained at 15 μL; the final concentration of Tris-HCl in each component of the reaction buffer is 120 mM, the final concentration of KCl is 540 mM, the final concentration of MgCl2 is 60 mM, and the final concentration of DTT is 6 mM; the final concentration of VP2-R is 2 μM; the final concentration of ATP is 5 mM; the final concentration of SSB is 0.5 mg / mL;

[0165] 3) Incubate the recombinase auxiliary protein UvsY detection system in step 2) at 37° C. for 15 minutes;

[0166] 4) Add 1 μL of UvsX and 2 μL of UvsY to the reaction system product of step 3) and add water to a total volume of 20 μL, and continue to incubate the reaction at 37°C for 15 min; wherein the concentration of the recombinase UvsX is 0.5 mg / mL; the concentration of the recombinase auxiliary protein UvsY is 0.1, 0.3, 0.5, 0.7, 0.9, 1.0 mg / mL;

[0167] 5) During the 15-min incubation of the reaction system in step 4), a phosphate ion concentration standard curve system was prepared; the specific components included 2.8 μL of reaction buffer, 1 μL of KH2PO4 standard solution, and enzyme-free water, with a total volume of 20 μL; the reaction was incubated at 37° C. for 15 min; wherein the concentrations of the KH2PO4 standard solution were 0, 10, 20, 40, 50, 60, 80, and 100 mM;

[0168] 6) During the incubation of the reaction system in step 4) for 15 minutes, a phosphomolybdic blue color developing solution is prepared, wherein the specific components include: ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water; the ratio of each component is 0.3:1:1:2.7; wherein the concentration of ammonium molybdate is 13% (W / W); the concentration of ascorbic acid is 10% (W / W); and the concentration of sulfuric acid is 2.5 M;

[0169] 7) The reaction products of steps 4 and 5 were supplemented with 180 μL of phosphorus fixative (phosphomolybdenum blue color developing solution) respectively, and incubated at 45°C for 15 min;

[0170] 8) Take 80 μL of the product from step 7) and transfer to a transparent ELISA plate to measure the absorbance at 660 nm.

[0171] 3. Experimental results

[0172] Draw a standard curve between phosphate ion concentration and the absorbance of phosphomolybdenum blue reagent. The result is as follows: Figure 5 As shown, the results show that the formula of the standard curve is y = 1.6825x-0.0115, R 2 =0.9929. This indicates that the dark blue complex formed by the combination of phosphomolybdenum blue reagent and phosphate ions, the higher the phosphate ion concentration, the darker the color, and the absorbance value at 660nm of the measured solution is linearly related to the phosphate ion concentration.

[0173] The results of the recombinase auxiliary protein UvsY detection system between the UvsY protein concentration and the absorbance of the phosphomolybdenum blue reagent are as follows Figure 6 As shown, the results show that during the hydrolysis of ATP, the single-stranded binding protein SSB, the recombinase UvsX, and the recombinase auxiliary protein UvsY bind to the single-stranded DNA and then contact ATP to achieve catalytic hydrolysis. As the concentration of the recombinase auxiliary protein UvsY increases, the recombinase auxiliary protein gradually becomes excessive. When the final concentration in the system increases to 0.05 mg / mL, since the ATP in the system has been completely hydrolyzed, there is no more ATP to participate in the reaction. Therefore, in the color development process of the phosphomolybdenum blue reagent, the absorbance value increases first and then gradually becomes flat and remains unchanged as the concentration of the UvsY protein increases.

[0174] The results of the effect of the recombinant enzyme auxiliary protein UvsY on ATP hydrolysis at different UvsY protein concentrations are shown in Table 9. The results show that according to Figure 5 The linear relationship between the absorbance of the phosphomolybdenum blue reagent and the phosphate ion concentration (y=1.6825x-0.0115) can be used to calculate the phosphate ion concentration generated in this experiment, and the enzyme activity can be calculated according to the definition of enzyme activity. Enzyme activity calculation formula: in is the phosphate ion concentration calculated based on the linear relationship / mM, 200 is the reaction system volume / μL, and V is the volume of UvsY used / μL.

[0175] Table 9

[0176]

[0177] Example 4

[0178] 1. Experimental Materials

[0179] The reagents used in the experiment are shown in Table 10.

[0180] Table 10

[0181] Reagent name Symbol / Abbreviation Manufacturer Part Number batch number Potassium dihydrogen phosphate <![CDATA[KH2PO4]]> Sinopharm 10017608 20210403 Ammonium molybdate <![CDATA[(NH4)2MoO4]]> Sinopharm 10002316 20221214 ascorbic acid VC Sinopharm 10004014 20230215 sulfuric acid <![CDATA[H2SO4]]> Sinopharm 10021618 20210802 Tris(hydroxyaminomethane) hydrochloride Tris-HCl Sinopharm XW1247635151 20220303 Potassium chloride KCl Sinopharm 10016308 20230315 Magnesium chloride <![CDATA[MgCl2]]> Sinopharm 10012817 20220625 Dithiothreitol DTT Sinopharm XW275654191 20221223 Sodium chloride NaCl Sinopharm 10019308 20211223 ATP ATP Sinopharm XW00566551 20220811 Ethylenediaminetetraacetic acid disodium salt EDTA Sinopharm 10009717 20220330 glycerin Glycerol Sinopharm 10010618 20220522 Sodium hydroxide NaOH Sinopharm 10019718 20221110 Enzyme-free water <![CDATA[free-DNase H2O]]> Sinopharm IAM9932 20230504 PBS Phosphate Buffered Saline PBS Sinopharm 72016960 20230509 Single-chain binding protein SSB East Anti EB0112 20230217 Recombinase UxF East Anti EB0109 20230512 Recombinase accessory protein UxfV East Anti EB0111 20230718-776 ssDNA VP2-R Bioengineering 1939871041 112557167

[0182] The formula of the reaction buffer in the experimental recipe is shown in Table 11.

[0183] Table 11

[0184] Recipe Name Components Final concentration of each component / mM Response buffer Tris-HCl (pH = 7.9) 100～150 KCl 450～550 <![CDATA[MgCl2]]> 50～100 DTT 1～10

[0185] The sequence of VP2-R in the experiment is shown as AGTTTGTATTTCCCATTTGAGTTACACCACGTCT (SEQ ID NO: 1).

[0186] 2. Experimental methods

[0187] 1) According to the experimental requirements, each reagent group was prepared into the required concentration: VP2-R concentration range was 0-10 μM, ATP concentration range was 0-10 mM, SSB concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme UvsX concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), recombinant enzyme auxiliary protein UvsY concentration range was 0-1.0 mg / mL (prepared by dilution with PBS), and KH2PO4 standard solution concentration range was 0-100 mM;

[0188] 2) Prepare the recombinase auxiliary protein UvsY detection system: the specific components include 2.8 μL reaction buffer, 1 μL VP2-R, 1 μL SSB, 5 μL ATP, and enzyme-free water, and the total volume is maintained at 15 μL; the final concentration of Tris-HCl in each component of the reaction buffer is 120 mM, the final concentration of KCl is 540 mM, the final concentration of MgCl2 is 60 mM, and the final concentration of DTT is 6 mM; the final concentration of VP2-R is 2 μM; the final concentration of ATP is 5 mM; the final concentration of SSB is 0.5 mg / mL;

[0189] 3) Incubate the recombinase auxiliary protein UvsY detection system in step 2) at 37° C. for 15 minutes;

[0190] 4) Add 1 μL of UvsX and 2 μL of UvsY to the reaction system product of step 3) and add water to a total volume of 20 μL, and continue to incubate the reaction at 37°C for 15 min; wherein the concentration of the recombinase UvsX is 0.5 mg / mL; the concentration of the recombinase auxiliary protein UvsY is 0.5 mg / mL;

[0191] 5) During the 15-min incubation of the reaction system in step 4), a phosphate ion concentration standard curve system was prepared; the specific components included 2.8 μL of reaction buffer, 1 μL of KH2PO4 standard solution, and enzyme-free water, with a total volume of 20 μL; the reaction was incubated at 37° C. for 15 min; wherein the concentrations of the KH2PO4 standard solution were 0, 10, 20, 40, 50, 60, 80, and 100 mM;

[0192] 6) During the incubation of the reaction system in step 4) for 15 minutes, a phosphomolybdic blue color developing solution is prepared, wherein the specific components include: ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water; the ratio of each component is 0.3:1:1:2.7; wherein the concentration of ammonium molybdate is 13% (W / W); the concentration of ascorbic acid is 10% (W / W); and the concentration of sulfuric acid is 2.5 M;

[0193] 7) The reaction products of steps 4 and 5 were supplemented with 180 μL of phosphorus fixative (phosphomolybdenum blue color developing solution) respectively, and incubated at 45°C for 15 min;

[0194] 8) Take 80 μL of the product from step 7) and transfer to a transparent ELISA plate to measure the absorbance at 660 nm.

[0195] 3. Experimental results

[0196] Draw a standard curve between phosphate ion concentration and the absorbance of phosphomolybdenum blue reagent. The result is as follows: Figure 7 As shown, the results show that the formula of the standard curve is y = 1.6845x-0.0125, R 2 =0.9991. This indicates that the dark blue complex formed by the combination of phosphomolybdenum blue reagent and phosphate ions, the higher the phosphate ion concentration, the darker the color, and the absorbance value at 660nm of the measured solution is linearly related to the phosphate ion concentration.

[0197] The ATPase activities of different batches of UvsY produced by our company detected by this method are shown in Table 12. The results show that according to Figure 7 The linear relationship between the absorbance of the phosphomolybdenum blue reagent and the phosphate ion concentration (y=1.6845x-0.0125) can be used to calculate the phosphate ion concentration generated in this experiment, and the enzyme activity can be calculated according to the definition of enzyme activity. Enzyme activity calculation formula: in is the phosphate ion concentration calculated based on the linear relationship / mM, 200 is the reaction system volume / μL, and V is the volume of UvsY used / μL.

[0198] Table 12

[0199]

[0200] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A method for detecting the ATPase activity of a recombinase auxiliary protein, characterized in that: The method comprises the following steps: 1) After the ATPase activity detection system of the recombinant enzyme auxiliary protein is prepared, incubate the reaction at a constant temperature of 37°C; 2) adding recombinase and recombinase auxiliary protein to the product of step 1), supplementing with enzyme-free water, and obtaining a second reaction system, and continuing to incubate the reaction at a constant temperature of 37°C; 3) Add a phosphorus fixative to the product of the reaction in step 2) and incubate the reaction at a constant temperature of 45°C; 4) Take the product of the reaction completed in step 3) and measure the absorbance at 660 nm; 5) Calculate the ATPase activity of the recombinant enzyme auxiliary protein based on the phosphate ion concentration standard curve and the absorbance value obtained in step 4); The system for detecting the ATPase activity of the recombinase auxiliary protein is a volume ratio of reaction buffer: VP2-R: SSB: ATP: enzyme-free water = 2.8:1:1:5:5.2; the reaction buffer includes Tris-HCl, KCl, MgCl2, and DTT; the pH value of the Tris-HCl is 7.9; the concentration range of the Tris-HCl is 100-150 mM; the concentration range of the KCl is 450-550 mM; the concentration range of the MgCl2 is 50-100 mM; the concentration range of the DTT is 1-10 mM; the concentration range of the VP2-R is 1-10 μM; the concentration range of the SSB is 0.005-1 mg / mL; the concentration range of the ATP is 1-10 mM; The volume ratio of the system in step 1), the recombinase in step 2), the recombinase auxiliary protein in step 2), the second reaction system in step 2), and the phosphorus fixative in step 3) is 15:1:2:20:180; The phosphorus fixing agent includes ammonium molybdate, ascorbic acid, sulfuric acid, and enzyme-free water; The volume ratio of ammonium molybdate, ascorbic acid, sulfuric acid and enzyme-free water is 0.3:1:1:2.7; The ammonium molybdate concentration is 13% W / W; The ascorbic acid concentration is 10% W / W; The sulfuric acid concentration is 2.5 M; The concentration range of the recombinase UvsX is 0.015-1 mg / mL; The concentration range of the recombinase auxiliary protein UvsY is 0.03-1 mg / mL.

2. The method according to claim 1, wherein the concentration of Tris-HCl is 120 mM.

3. The method according to claim 1, wherein the concentration of KCl is 540 mM.

4. The method according to claim 1, wherein the concentration of MgCl2 is 60 mM. The method according to claim 1 , wherein the concentration of DTT is 6 mM. The method according to claim 1 , wherein the concentration of VP2-R is 2 μM. The method according to claim 1 , wherein the concentration of ATP is 5 mM.

8. The method according to claim 1, wherein the concentration of SSB is 0.5 mg / mL.

9. The method according to claim 1, wherein the incubation reaction time in step 1) is 15 min.

10. The method according to claim 1, wherein the incubation reaction time in step 2) is 15 min. The method according to claim 1 , wherein the source of the recombinase comprises bacteriophage, prokaryotic organism, or eukaryotic organism.

12. The method of claim 11, wherein the bacteriophage comprises T4, T6, Rb69 or Aeh 1.

13. The method according to claim 1, wherein the recombinase comprises UvsX of T4 bacteriophage.

14. The method according to claim 11, wherein the prokaryotic organism is Escherichia coli. The method according to claim 1 , wherein the recombinase comprises RecA of Escherichia coli. The method according to claim 1 , wherein the recombinase comprises eukaryotic Rad51.

17. The method according to claim 1, wherein the source of the recombinase auxiliary protein comprises bacteriophage and Escherichia coli.

18. The method of claim 17, wherein the bacteriophage comprises T4, T6, Rb69 or Aeh 1.

19. The method according to claim 1, wherein the recombinase auxiliary protein comprises UvsY of T4 bacteriophage.

20. The method according to claim 1, wherein the recombinase auxiliary protein comprises RecR, RecO or RecF derived from Escherichia coli.

21. The method according to claim 1, wherein the incubation time in step 3) is 15 min.

22. The method according to claim 1, wherein the concentration of the recombinant enzyme UvsX is 0.5 mg / mL.

23. The method according to claim 1, wherein the concentration of the recombinase auxiliary protein UvsY is 0.5 mg / mL.

24. The method according to claim 1, characterized in that The construction of the phosphate ion concentration standard curve comprises the following steps: using the reaction buffer, KH2PO4 standard solution, and enzyme-free water in the method of claim 1 to form a phosphate ion concentration standard curve preparation system, and incubating the reaction at a constant temperature of 37°C; supplementing a phosphorus fixative, incubating the reaction at a constant temperature of 45°C, measuring the absorbance at 660 nm, and obtaining a phosphate ion concentration standard curve based on the absorbance.

25. The method according to claim 24, wherein the volume ratio of the reaction buffer, KH2PO4 standard solution, enzyme-free water, and phosphorus fixative is 2.8:1:16.2:

180. The method according to claim 24 , wherein the incubation reaction time is 15 min.

27. The method according to claim 24, wherein the concentration range of the KH2PO4 standard solution is 0-100 mM.

28. The method of claim 24, wherein the concentration of the KH2PO4 standard solution comprises 0, 10, 20, 40, 50, 60, 80 and 100 mM.

29. The method according to claim 1, further comprising the step of calculating enzyme activity, wherein the step comprises a specific enzyme activity calculation formula: in, is the phosphate ion concentration calculated based on the linear relationship / mM, 200 is the reaction system volume / μL, V is the volume of UvsY used / μL.

30. A composition, characterized in that The composition comprises an agent used in the method of any one of claims 1-29.

31. The composition according to claim 30, comprising the reaction buffer, KH2PO4 standard solution, enzyme-free water, a phosphorus fixative, recombinase UvsX, and recombinase auxiliary protein UvsY in the method according to any one of claims 1-29.

32. Use of the method according to any one of claims 1 to 29 in the rapid detection of ATPase activity of a recombinase auxiliary protein.

33. Use of the method according to any one of claims 1 to 29 in preparing a system or device for automatically detecting the ATPase activity of a recombinase auxiliary protein.

34. A system or device, characterized in that: The system or device comprises a processing module, and the processing module is used to implement the method according to any one of claims 1-29.

35. The system or device of claim 34, further comprising a storage module.

36. The system or apparatus of claim 35, wherein the storage module stores a computer program.

37. The system or apparatus according to claim 36, wherein the computer program is used to programmatically execute the steps of the method according to any one of claims 1 to 29.

38. The system or device according to claim 36, wherein the computer program is used to execute specific operations by a processing module.

39. A kit for recombining the ATPase activity of an enzyme auxiliary protein, characterized in that The kit comprises reagents, an incubation container and step instructions used in the method according to any one of claims 1 to 29.

Images