A reverse transcriptase, nucleic acid molecules and methods of synthesizing cDNA

Abstract

The application discloses a reverse transcriptase, a nucleic acid molecule and a method for synthesizing cDNA, and relates to the technical field of reverse transcriptase mutants. The amino acid at the 322th position of a wild-type M-MLV reverse transcriptase is mutated into Val, so that the thermal stability of the reverse transcriptase is increased. The thermal stability experiment and the heat shock stability experiment prove that the reverse transcriptase with the mutation has higher thermal stability and heat shock stability. Compared with the wild-type reverse transcriptase, the reverse transcriptase provided by the application has higher sensitivity and higher detection rate in reverse transcription amplification detection.

Description

Technical Field

[0001] This invention relates to the field of reverse transcriptase mutant technology, and more specifically, to a reverse transcriptase, nucleic acid molecules, and a method for synthesizing cDNA. Background Technology

[0002] M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase is a 75kD monomeric enzyme with RNA- and DNA-dependent polymerase activities, RNase H activity, and terminal deoxynucleotidyl transferase (TdT) activity. The RNA-dependent polymerase activity synthesizes first-strand DNA (cDNA) complementary to the RNA; the DNA-dependent polymerase activity synthesizes a DNA strand complementary to the first-strand cDNA, ultimately yielding a complete cDNA double-stranded product; the RNase H activity specifically degrades the RNA in RNA-DNA hybrids; and the TdT adds a template-independent base to the 3' end of the first-strand cDNA. M-MLV reverse transcriptase has been widely used in cDNA synthesis, cDNA library construction, and isothermal amplification techniques.

[0003] Common reverse transcriptases also include reverse transcriptase from AMV (avian myeloblastosis virus), a heterodimer composed of α and β subunits, where the α subunit is obtained by enzymatic hydrolysis of the β subunit; similar heterodimers include Rous sarcoma virus (RSV) reverse transcriptase, composed of p95 and p63 subunits; and HIV-1 (human immunodeficiency virus) reverse transcriptase, a heterodimer composed of p66 and p52 subunits.

[0004] Currently, compared to AMV reverse transcriptase, wild-type M-MLV reverse transcriptase exhibits poorer thermostability but better fidelity, and lacks DNA endonuclease activity with lower RNase H activity. In view of these characteristics, this invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a reverse transcriptase with higher thermostability than wild-type M-MLV reverse transcriptase. Higher thermostability means the reverse transcriptase is more resistant to high temperatures, which is beneficial for disrupting the secondary structure of the RNA template under high-temperature conditions, denaturing high-GC templates, reducing non-specific primer binding, improving reverse transcription efficiency, and thus obtaining more reverse transcription products.

[0006] This invention is implemented as follows:

[0007] The present invention provides a reverse transcriptase having an A322V mutation compared to the amino acid sequence shown in SEQ ID NO: 1.

[0008] The inventors have discovered for the first time that a mutation at amino acid position 322 of wild-type M-MLV reverse transcriptase, replacing it with Val, can increase the thermostability of the reverse transcriptase. Thermostability and heat shock stability experiments confirmed that the reverse transcriptase with this mutation exhibits higher thermostability and heat shock stability. Furthermore, it demonstrates higher sensitivity, higher detection rate, better repeatability, and better reverse transcription activity in reverse transcription amplification detection. The inventors found that the reverse transcriptase with this mutation can meet the reverse transcription requirements of different RNA samples and is unaffected by inhibitors in the sample.

[0009] The amino acid sequence shown in SEQ ID NO: 1 is as follows:

[0010] LTLNIEDEHRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGNLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLLIENSSP。

[0011] As used herein, "the position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 1" refers to a position related to the three-dimensional structure of the loop structure in wild-type M-MLV reverse transcriptase, and specifically refers to position 322 of the amino acid sequence of the M-MLV reverse transcriptase mutant or position 322 of the amino acid sequence corresponding to position 322 of the amino acid sequence of the wild-type M-MLV reverse transcriptase. "The position corresponding to position 322 of the amino acid sequence of the M-MLV reverse transcriptase mutant" can be easily determined by comparing or aligning the amino acid sequence of the mutant with that of the wild-type, for example using known algorithms. Similarly, as used herein, amino acid positions refer to amino acid positions in the wild-type amino acid sequence, and include positions in the amino acid sequence of the mutant corresponding to amino acid positions in the corresponding wild-type amino acid sequence.

[0012] In an alternative embodiment, the reverse transcriptase corresponds to the amino acid sequence shown in SEQ ID NO: 1 and also has two or more mutations.

[0013] In an alternative embodiment, the reverse transcriptase corresponds to the amino acid shown in SEQ ID NO: 1 and, in addition to the A322V mutation, has one or more mutations selected from H8, P51, H204, N249, M289, T306, F309, D524, E562, K571, D583, and T664.

[0014] In one alternative implementation, the reverse transcriptase described above has 2-13 mutations.

[0015] In one alternative embodiment, the reverse transcriptase has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 mutations.

[0016] In an alternative embodiment, the reverse transcriptase corresponds to the amino acid shown in SEQ ID NO: 1 and, in addition to the A322V mutation, has one or more mutations selected from H8Y, P51L, H204R, N249D, M289L, T306K, T306R, F309N, D524G, E562Q, K571R, D583N, and T664N.

[0017] In an alternative embodiment, the reverse transcriptase described above simultaneously possesses mutations in A322V, H204R, M289L, T306K, and F309N (i.e., M2).

[0018] The inventors discovered that simultaneously targeting the A322V, H204R, M289L, T306K, and F309N mutations can further enhance the thermostability of reverse transcriptase.

[0019] In an alternative embodiment, the reverse transcriptase described above simultaneously possesses mutations in A322V, H204R, M289L, T306K, F309N, D524G, E562Q, and D583N (i.e., M3).

[0020] The active site of RNase H is a motif composed of the three amino acids Asp-Glu-Asp, with catalytic active sites including D524, E562, D583, and D653. Simultaneously, mutations targeting A322V, H204R, M289L, T306K, F309N, D524G, E562Q, and D583N allow the reverse transcriptase to possess both high thermostability and low RNase H activity. Excessive RNase H activity may prematurely degrade the RNA template, reducing the yield of reverse transcription products. Therefore, providing a reverse transcriptase with reduced or absent RNase H activity would be beneficial for the reverse transcription synthesis of long cDNAs.

[0021] The synthesis of long cDNA requires reverse transcriptase to have a good continuous synthesis ability. The inventors discovered that by simultaneously targeting the mutations A322V, D524G, E562Q and D583N, the continuous synthesis ability of long chains of reverse transcriptase can be improved, thereby increasing the reverse transcription length of M-MLV reverse transcriptase, for example, amplifying it to 8k.

[0022] In one optional embodiment, the reverse transcriptase possesses mutations in A322V, F309N, H204R, and T306K. These F309N, H204R, and T306K mutations reduce TdT activity and improve the thermostability of the reverse transcriptase. Inhibiting TdT activity yields a cDNA product without nucleotide doping at the ends, reducing the generation of unpaired bases. The simultaneous presence of these mutations allows the reverse transcriptase to possess both high thermostability and low TdT activity.

[0023] In an alternative embodiment, the aforementioned reverse transcriptase simultaneously possesses the mutations A322V, M289L, F309N, H204R, T306K, D524G, E562Q, D583N, H8Y, P51L, N249D, K571R, and T664N (i.e., M4). The reverse transcriptase exhibits higher thermostability, low RNase H activity, extremely low TdT activity, and high reverse transcription efficiency.

[0024] The mutated amino acid sequence is shown in SEQ ID NO: 2:

[0025] .

[0026] This invention provides a nucleic acid molecule that encodes the aforementioned reverse transcriptase.

[0027] The present invention also provides an expression cassette, expression vector, recombinant cell or recombinant bacteria, which contain the above-mentioned nucleic acid molecules.

[0028] In one optional embodiment, the expression cassette is connected to a regulatory sequence for regulating the expression of the nucleic acid molecule, including but not limited to a promoter, enhancer, signal peptide coding sequence, selection marker gene, terminator, histidine tag, etc.

[0029] The present invention also provides a recombinant bacterium or recombinant cell containing the above-described expression cassette or vector. The recombinant cell may be a competent cell, for example, selected from Escherichia coli or yeast competent cells.

[0030] Recombinant bacteria include, but are not limited to, Escherichia coli, such as BL21, DH5α, Top10, etc.

[0031] Based on the disclosure of the amino acid sequence of reverse transcriptase in this invention, those skilled in the art will readily conceive of preparing reverse transcriptase using genetic engineering or other techniques (chemical synthesis), such as isolating and purifying reverse transcriptase from the culture product of recombinant cells capable of recombinantly expressing any of the above reverse transcriptases. This is easily achievable by those skilled in the art. Therefore, regardless of the technique used to prepare the reverse transcriptase of this invention, it falls within the protection scope of this invention.

[0032] The present invention also provides a reagent or kit comprising the reverse transcriptase described above.

[0033] The reagents include, but are not limited to, compositions containing reverse transcriptase. They also include, for example, preservatives, antiseptics, and other adjuvants.

[0034] The kit, for example, is a reverse transcription kit that includes reverse transcriptase, oligo(dT), RNasin, etc.

[0035] The present invention also provides a method for synthesizing cDNA, the method comprising the step of synthesizing DNA complementary to template RNA using the reverse transcriptase described above.

[0036] This invention also provides a method for constructing a cDNA library, comprising:

[0037] RNA is extracted from the biological sample to be tested to obtain mRNA; based on the mRNA, the cDNA synthesis method described above is used to process the cDNA to obtain cDNA molecules; based on the cDNA molecules, amplification and library construction are performed to obtain a cDNA library.

[0038] The biological samples to be tested are selected from at least one of soil, feces, blood, and serum. Samples from different biological sources contain a variety of inhibitors that inhibit M-MLV RT activity, such as humic acid in soil and feces, hemoglobin in blood, and various blood anticoagulants in serum, such as heparin and citrate, as well as guanidine, thiocyanate, ethanol, formamide, EDTA, and plant acidic polysaccharides. Therefore, improving the enzyme's ability to resist inhibitors can more effectively expand the application range of reverse transcriptase.

[0039] The present invention has the following beneficial effects:

[0040] In one specific technical solution, the present invention addresses the wild-type M-MLV reverse transcriptase with a mutation at amino acid position 322 to Val, which can increase the thermostability of the reverse transcriptase. Thermostability and heat shock stability experiments have confirmed that the reverse transcriptase with the above mutation exhibits higher thermostability and heat shock stability.

[0041] In one specific technical solution, compared with wild-type reverse transcriptase, the reverse transcriptase provided by the present invention has higher sensitivity and higher detection rate for reverse transcription amplification detection.

[0042] In one specific technical solution, compared with wild-type reverse transcriptase, the reverse transcriptase provided by the present invention has higher thermal stability and heat shock stability, and has higher sensitivity and detection rate for reverse transcription amplification detection. Detailed Implementation

[0043] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0044] Unless otherwise specified, the practice of this invention will employ conventional techniques of cell biology, molecular biology (including recombinant technologies), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. This technique is well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Animal Cell Culture* (edited by R.R. Freshney, 1987); *Methods in Enzymology* (Academic Press, Inc.); *Handbook of Experimental Immunology* (edited by D.M. Weir and C.C. Blackwell); *Gene Transfer Vectors for Mammalian Cells* (edited by J.M. Miller and M.P. Calos, 1987); *Current Protocols in Molecular Biology* (edited by F.M. Mausubel et al., 1987); and *PCR: The Polymerase Chain Reaction*. The references cited in the references are: "Reaction" (Mullis et al., ed., 1994); and "Current Protocols in Immunology" (JEColigan et al., ed., 1991), each of which is explicitly incorporated herein by reference.

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0046] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0047] Example 1

[0048] This embodiment provides a reverse transcriptase (mutant M1), which is obtained by replacing the A322V amino acid in wild-type M-MLV.

[0049] The mutant construction method is as follows:

[0050] 1. Gene synthesis

[0051] The wild-type M-MLV sequence (SEQ ID NO: 1, GenBank: AAC82568.2) was obtained from NCBI. Codon optimization of the sequence using *E. coli* was performed, and the resulting M-MLV template was synthesized by Universal Biotechnology. The M-MLV sequence was amplified using Q5 high-fidelity polymerase (NEB, catalog number M0491L). The amplified fragment and pET30a vector were digested with Nde I and HindIII (Takara, catalog numbers 1621 and 1605, respectively). Ligation was performed using T4 DNA ligase (Takara, catalog number 2011A), followed by transformation into BL21(DE3). Appropriate transformants were selected for identification, and sequencing verification yielded pET30a-M-MLV.

[0052] 2. Construction of M-MLV mutant M1.

[0053] Based on the wild-type M-MLV, an amino acid substitution of A322V was performed. The mutation was carried out by designing primers to perform point mutation after synthesizing the wild-type sequence. Gene synthesis, enzyme digestion and ligation were performed. The gene was transformed into BL21(DE3), and appropriate transformants were selected for identification and sequencing verification to obtain the recombinant vector pET30a-M1-MMLV of M1.

[0054] 3. Expression and purification of M1-MMLV

[0055] (1) Recombinant expression

[0056] The recombinant strain E. coli BL21(DE3) / pET30a-M1-MMLV was cultured at 37°C and 220 rpm until the OD600 was approximately 0.6–0.8. It was then pre-cooled on ice for 30 min, and IPTG was added to a final concentration of 1 mM. After induction at 28°C for 4 hours, the bacteria were harvested.

[0057] (2) Crushing and purification

[0058] The bacterial cells were resuspended in lysis buffer, sonicated, and purified by nickel column, heparin, and S cation exchange column. The purified cells were then stored in 200 mM potassium phosphate, 0.05% (v / v) Triton X-100, 50% glycerol, 0.01 mM EDTA, and 1 mM DTT to obtain M1-MMLV.

[0059] Example 2

[0060] This embodiment provides a reverse transcriptase mutant M2, which is obtained by replacing the amino acids H204R, M289L, T306K and F309N based on M1-MMLV in Example 1.

[0061] The mutant construction method is the same as shown in Example 1, except that the mutation sequence is different.

[0062] Example 3

[0063] This embodiment provides a reverse transcriptase mutant M3, which is obtained by replacing the amino acids D524G, E562Q and D583N based on the reverse transcriptase mutant M2 of Example 2.

[0064] The mutant construction method is the same as shown in Example 1, except that the mutation sequence is different.

[0065] Example 4

[0066] This embodiment provides a reverse transcriptase mutant GS-MMLV, which is obtained by replacing the amino acids H8Y, P51L, N249D, K571R and T664N based on the reverse transcriptase mutant M3 in Example 3, resulting in GS-MMLV (i.e., M4).

[0067] The mutant construction method is the same as shown in Example 1, except that the mutation sequence is different.

[0068] Comparative Example 1

[0069] Wild-type M-MLV was prepared using the gene synthesis method described in Example 1.

[0070] Experimental Example 1

[0071] The heat resistance of the reverse transcriptases in Examples 1-4 and Comparative Example 1 was identified. The reverse transcriptases in each example and comparative example were treated as follows: (1) direct activity detection, (2) activity detection after being placed in a constant temperature incubator at 37 degrees Celsius for 7 days, and (3) activity detection after being treated at 50 degrees Celsius for 8 hours.

[0072] qPCR system for thermostability testing (all components used in the qPCR system are from Phytobio, catalog number MD013):

[0073] 5x buffer: 10μl;

[0074] 10x Solution I: 5μl;

[0075] RNasin: 0.5 μl;

[0076] Anstart Taq DNA Polymerase: 0.6μl;

[0077] 25mM dNTPs: 0.4μl;

[0078] Primer-probe mixture: 2.5 μl;

[0079] Reverse transcriptase: 0.4 μl (200 U / μl);

[0080] Template: 5 μl; (10^4 copies / ml) add water to 50 μl.

[0081] Template sequence (SEQ ID NO: 3):

[0082] ATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAAT.

[0083] Primer and probe sequences:

[0084] 02F (SEQ ID NO: 4): ATGGCAGTATTCATTCA.

[0085] 02P (SEQ ID NO: 5): GTACCCCCCAATCCCC (FAM-BHQ1).

[0086] 02R (SEQ ID NO: 6): ATTATGTCTATTATTCTTT.

[0087] Q-PCR program: 95℃ for 3 minutes, (read fluorescence signal at 95℃ for 15 seconds, 60℃ for 15 seconds, and 72℃ for 15 seconds) × 40 cycles.

[0088] The results of the thermal stability test are shown in Table 1 below:

[0089] Table 1 shows the thermal stability test results for different embodiments and comparative examples.

[0090]

[0091] Note: NoCt in the table indicates no amplification.

[0092] The comparison shows that the thermal stability of M1, M2 and M4 provided in the embodiments of the present invention gradually improves, and under the conditions of being placed in a constant temperature incubator at 37 degrees for 7 days and treated at 50 degrees for 8 hours, the thermal stability of M1 and M2 is significantly better than that of the direct detection group.

[0093] Experiment Example 2

[0094] The sensitivity of the reverse transcriptases in Examples 1-4 and Comparative Example 1 was determined.

[0095] The qPCR system for sensitivity detection (all components used in the qPCR system are from Phytobio, catalog number MD013):

[0096] 5x buffer: 10μl;

[0097] 10 x Solution I: 5 μl;

[0098] RNasin: 0.5 μl;

[0099] Anstart Taq DNA Polymerase: 0.6μl;

[0100] 25mM dNTPs: 0.4μl;

[0101] Primer-probe mixture: 2.5 μl;

[0102] Reverse transcriptase: 0.4 μl (200 U / μl);

[0103] Template: 5μl;

[0104] Four linear gradient templates were used: 10^3 copies / ml, 10^4 copies / ml, 10^5 copies / ml, and 10^6 copies / ml. Water was added to a final volume of 50 μl. The template and primer / probe sequences were the same as in Experiment 1.

[0105] Q-PCR program: 95℃ for 3 minutes, (read fluorescence signal at 95℃ for 15 seconds, 60℃ for 15 seconds, and 72℃ for 15 seconds) × 40 cycles.

[0106] The results of the sensitivity detection experiment are shown in Table 2 below:

[0107] Table 2 shows the sensitivity test results for different embodiments and comparative examples.

[0108] Ct value Wild-type M-MLV mutant M1 mutant M2 mutant M3 mutant M4 10^3 copies / ml NoCt NoCt 38.7037 37.4581 35.6902 10^4 copies / ml 36.4724 36.2442 35.441 34.2013 32.483 10^5 copies / ml 33.478 33.1192 32.2962 30.856 28.7717 10^6 copies / ml 29.1733 28.868 28.0553 26.629 25.3431

[0109] Note: NoCt in the table indicates no amplification.

[0110] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A reverse transcriptase, characterized in that, The amino acid sequence of the reverse transcriptase is shown in SEQ ID NO:

2.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the reverse transcriptase as described in claim 1.

3. An expression box or expression carrier, characterized in that, The expression cassette or expression vector comprises the nucleic acid molecule as described in claim 2.

4. A recombinant cell or recombinant bacterium, characterized in that, The recombinant cells or recombinant bacteria comprise the nucleic acid molecules described in claim 2.

5. A reagent or kit, characterized in that, The reagent or kit includes the reverse transcriptase as described in claim 1.

6. A method for synthesizing cDNA, characterized in that, The method includes the step of synthesizing DNA complementary to the template RNA using the reverse transcriptase as described in claim 1.

Images