A feces sample preservation solution and application thereof

Abstract

The invention discloses a stool sample preservation solution and its application, wherein the preservation solution contains the following ingredients: guanidine isothiocyanate, Tween 80, PEG-8000, NaCl and anhydrous ethanol. The stool sample preservation solution prepared by the invention adopts a special formula, which is different from the traditional stool sample preservation solution. The traditional stool sample preservation solution can usually only be preserved for 7-10 days at room temperature (15°C-30°C). The preservation solution of the invention can quickly release sample nucleic acid at room temperature (37±2)°C, and can stably preserve nucleic acid for at least 30 days, which greatly extends the storage period of stool samples, is more conducive to the transportation of samples and related detection in the later stage, and has the advantages of low cost and convenient use.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a stool sample preservation solution and application thereof. Background Art

[0002] Fecal samples are a challenging type of sample, with complex composition and greatly affected by dietary habits and physical condition. After the feces are removed from the body, due to the huge changes in the environment, strictly anaerobic microorganisms in them no longer proliferate or even die, while facultative anaerobic microorganisms can still proliferate and grow, and other biological substances such as proteins, fats, and polysaccharides are gradually degraded under the influence of various enzymes. In addition, some people with high-sugar and high-fat diets have high lipid content in their fecal samples, and such samples will further affect the preservation of feces. In addition, fecal samples often contain heme, bile salts, etc. The residues of these substances also greatly affect the preservation of feces and inhibit downstream PCR and second-generation sequencing reactions.

[0003] Therefore, stool samples should be stored appropriately and within a short time after collection to ensure the relative stability of their bacterial community structure and biological substances. Currently, there are three main methods for preserving stool samples: cryopreservation, refrigeration, and preservation in a preservative solution. Cryopreservation involves storing stool at -20°C or -80°C after collection. Freezing at -80°C is considered the optimal method (gold standard) for preserving stool. This method involves freezing collected stool at -80°C. At low temperatures, bacterial metabolic rates decrease, maintaining the bacterial composition of the stool for a period of time and stabilizing its microbial composition. Immediate freezing at -80°C after collection (within 30 minutes of transportation) can maintain the original structure and composition of the fecal microbiome for up to 5 years. However, in actual research, it is not easy to immediately freeze freshly collected specimens, and most samples are exposed to room temperature or other environments for a period of time. If improperly stored, bacterial nucleic acid degradation can lead to a decrease in the species and diversity of the bacterial community in the specimen, seriously affecting the final experimental results. Refrigerated storage primarily utilizes the principle that low temperatures (2°C-8°C) can reduce intracellular endonuclease activity and prevent rapid nucleic acid degradation. Under refrigerated storage conditions, 24 hours of storage does not significantly alter the fecal microbial community structure. In clinical trials, since laboratory personnel cannot immediately place stool samples for analysis in a -80°C freezer, especially during transport back to the laboratory, preserving samples in a 2-8°C freezer or 0°C ice packs is a viable option. This significantly increases the flexibility of preserving patient stool samples in clinical practice. Once in the laboratory, it is recommended that samples be immediately transferred to a -80°C freezer for long-term storage. Preservative solution preservation utilizes special components in the preservative solution to prevent degradation of stool sample components and is widely used for sample collection, storage, and transportation at room temperature. Preserving stool samples in a preservative solution can inhibit the effects of nucleases to varying degrees, reducing nucleic acid degradation. It also effectively and long-term fixes the abundance of fecal microorganisms and maintains the integrity of fecal DNA molecules. Collecting stool samples in a preservative solution rather than freezing the stool sample provides relatively reproducible and stable results for stool sample analysis. Preservative solutions can provide high-quality DNA for subsequent genetic testing and analysis, including PCR, qPCR, NGS, nucleic acid mass spectrometry, and microarray analysis. Ultra-low temperature preservation requires refrigeration equipment and is also limited in long-distance transportation. Therefore, it is crucial to develop a preservative solution that can be used at room temperature and effectively maintain the stability of intestinal microorganisms and biological substances in fecal samples. Summary of the Invention

[0004] Based on the above background technology, the technical problem to be solved by the present invention is to provide a stool sample preservation solution, its preparation method and use. In order to achieve the purpose of the present invention, the following technical solution is proposed:

[0005] One aspect of the present invention relates to a stool sample preservation solution. Each 1L of the cell preservation solution contains the following components:

[0006] name Mass / Volume Guanidine thiocyanate 50g-100g Tween 80 50mL-150mL PEG-8000 20g-60g NaCl 20g-60g Anhydrous ethanol 50mL-150mL

[0007] The preservation solution of the present invention can quickly release sample nucleic acid at room temperature (37±2)°C and can stably preserve nucleic acid for at least 30 days, greatly extending the storage period of stool samples, making it more conducive to sample transportation and subsequent related testing, and has the advantages of low cost and ease of use.

[0008] In a preferred embodiment of the present invention, each 1L of cell preservation solution contains the following components:

[0009] name Mass / Volume Guanidine thiocyanate 55-65g Tween 80 90-110mL PEG-8000 35-45g NaCl 35-45g Anhydrous ethanol 90-110mL

[0010] Particularly preferably, each 1L of cell preservation solution contains the following components:

[0011] name Mass / Volume Guanidine thiocyanate 60g Tween 80 100mL PEG-8000 40g NaCl 40g Anhydrous ethanol 100mL

[0012] Another aspect of the present invention relates to a method for preparing the above-mentioned preservation solution, which is characterized by comprising the following steps:

[0013] After the components are fully dissolved in water, the pH value is adjusted to 7.0-8.5 with dilute hydrochloric acid, the volume is fixed to 1000 mL, and then filtered through a 0.22 μm filter membrane for sterilization.

[0014] Another aspect of the present invention relates to a method for preserving a stool sample, characterized in that the mass volume ratio of the stool sample to the above-mentioned preservation solution is 1 g: 3-5 ml.

[0015] Another aspect of the present invention also relates to an application of a stool sample preservation solution, wherein the stool sample preservation solution is used to improve the stability of Helicobacter pylori nucleic acid samples in stool samples.

[0016] Beneficial effects

[0017] The stool sample preservation solution prepared by the present invention uses a special formula. Unlike traditional stool sample preservation solutions, which can usually only be preserved for 7-10 days at room temperature (15°C-30°C), the preservation solution of the present invention can quickly release sample nucleic acids at room temperature (37±2)°C and can stably preserve nucleic acids for at least 30 days, greatly extending the storage period of stool samples, making it more convenient for sample transportation and subsequent related testing, and having the advantages of low cost and ease of use. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : PCR amplification curve. DETAILED DESCRIPTION

[0019] To further understand the present invention, the following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0020] Unless otherwise specified, all reagents involved in the embodiments of the present invention are commercially available products and can be purchased through commercial channels.

[0021] Example 1:

[0022] 1. Prepare stool sample preservation solution according to the characteristics of the stool sample. The formula is as follows:

[0023] Reagent name Mass / Volume Guanidine thiocyanate 50g-100g Tween 80 50mL-150mL PEG-8000 20g-60g NaCl 20g-60g Anhydrous ethanol 50mL-150mL

[0024] After the reagent is fully dissolved, the pH value is adjusted to 7.0-8.5 with dilute hydrochloric acid, the volume is made up to 1000 mL, and then sterilized by filtration using a 0.22 μm filter membrane.

[0025] 2. Optimization of the concentration of each component in the preservation solution

[0026] 2.1 Preparation of different sample storage solutions

[0027] 2.1.1 Prepare stool sample preservation solutions containing different concentrations of guanidine thiocyanate according to the following table:

[0028]

[0029]

[0030] Take 25 positive samples, divide the same sample into 5 parts, add them into the preservation solution of combination 1 to combination 25 respectively, with the mass volume ratio of stool sample to preservation solution being 1g:3-5ml, mix well and place at (37±2)℃, take out after 30 days, shake and mix thoroughly, centrifuge at 10,000g for 10 minutes, take 200-400μL of supernatant, and use conventional stool nucleic acid extraction reagent with automatic extraction instrument for nucleic acid extraction.

[0031] 2.2PCR detection:

[0032] 2.2.1 Preparation of PCR reaction solution:

[0033] Reagent name Dosage per person (μL) 10X PCR Buffer (Mg2+plus) 2.5 dNTPs [including dUTP] (25mM) 0.2 MgCl2 (25 mM) 3 Helicobacter pylori upstream primer (20 μM) 0.3 Helicobacter pylori downstream primer (20 μM) 0.3 Helicobacter pylori probe (20 μM) 0.15 HS Taq (5U / μL) 0.6 UNG (2 U / μL) 0.05 H2O 12.9 template 5 total 25

[0034] Helicobacter pylori upstream primer sequence: ACGGGTGAGTAACGCATAGG

[0035] Helicobacter pylori downstream primer sequence: ACCCTCTCAGGCCGGATACC

[0036] Helicobacter pylori probe sequence: CGGGGGAAAGATTTATCGCTAAGAGATC

[0037] 2.2.2PCR reaction procedure:

[0038]

[0039] 2.2.3PCR reaction results:

[0040] Reagent name Combined 1Ct value Combined 2Ct value Combined 3Ct value Combined 4Ct value Combined 5Ct value Sample 1 / 25.26 25.60 25.91 27.53 Sample 2 / 20.74 20.16 20.44 22.07 Sample 3 / 30.44 30.06 30.52 32.25 Sample 4 / 28.36 28.08 28.47 30.58 Sample 5 / 32.85 32.11 32.71 35.86

[0041] Reagent name Combined 6Ct value Combined 7Ct value Combined 8Ct value Combined 9Ct value Combined 10Ct value Sample 6 / 25.60 25.58 25.31 28.88 Sample 7 / 20.58 20.31 20.04 23.48 Sample 8 / 30.39 30.33 30.37 33.22 Sample 9 / 28.64 28.02 28.26 31.30 Sample 10 / 32.88 32.41 32.05 /

[0042] Reagent name Combined 11Ct value Combined 12Ct value Combined 13Ct value Combined 14Ct value Combined 15Ct value Sample 11 / 25.59 25.06 25.28 29.87 Sample 12 / 20.14 20.46 20.27 25.00 Sample 13 / 30.66 30.15 30.99 / Sample 14 / 28.79 28.05 28.58 32.74 Sample 15 / 32.39 32.39 32.89 /

[0043]

[0044]

[0045] Reagent name Combined 21Ct value Combined 22Ct value Combined 23Ct value Combined 24Ct value Combined 25Ct value Sample 21 / 25.07 25.60 25.62 28.38 Sample 22 / 20.66 20.53 20.76 23.32 Sample 23 / 30.09 30.99 30.54 33.03 Sample 24 / 28.30 28.18 28.23 31.62 Sample 25 / 32.31 32.60 32.70 /

[0046] The results showed that combinations 1, 6, 11, 16, and 21 lacking any one of the components of the present invention could not achieve successful preservation of stool samples;

[0047] The results showed that the Ct values ​​of combination 2 to combination 4 were similar, and all were better than combination 1 and combination 5. Therefore, the optimal range of guanidine thiocyanate was 50 g / L-100 g / L.

[0048] The results showed that the Ct values ​​of combinations 7 to 9 were similar, and all were better than combinations 6 and 10. Therefore, the optimal range of Tween 80 was 50 mL / L-150 mL / L.

[0049] The results showed that the Ct values ​​of combinations 12 to 14 were similar, and all were better than combinations 11 and 15. Therefore, the optimal range of PEG-8000 was 20 g / L-60 g / L.

[0050] The results showed that the Ct values ​​of combinations 12 to 14 were similar, and all were better than combinations 11 and 15. Therefore, the optimal range of NaCl was 20 g / L-60 g / L.

[0051] The results showed that the Ct values ​​of combinations 12 to 14 were similar, and all were better than combinations 11 and 15. Therefore, the optimal range of anhydrous ethanol was 50 mL / L-150 mL / L.

[0052] 3. Extraction of Helicobacter pylori nucleic acid from stool samples

[0053] The collected fecal samples were divided into three parts, one was stored at -75℃~-85℃, one was stored at 2℃~8℃, and the other fecal sample was placed in preservation solution (formula see the table below) and stored at (37±2)℃ for 30 days.

[0054] name Mass / Volume Guanidine thiocyanate 60g Tween80 100mL PEG-8000 40g NaCl 40g Anhydrous ethanol 100mL

[0055] Then, the frozen stool samples and the stool samples stored at (37±2)°C were taken out simultaneously for nucleic acid extraction. The nucleic acid extraction of the frozen stool samples was performed according to the instructions for nucleic acid extraction of conventional stool samples. The extraction steps for the stool samples in the storage solution were as follows:

[0056] The mixture was thoroughly shaken and mixed, centrifuged at 10000 g for 10 min, and 200-400 μL of the supernatant was taken. A conventional fecal nucleic acid extraction reagent was used in combination with an automatic extractor for PCR amplification nucleic acid extraction.

[0057] 3.1PCR amplification curve:

[0058] Amplification curves such as Figure 1 As shown, from Figure 1 As can be seen from the amplification curve shown, the amplification curve of the stool sample preserved using the preservation solution of the present invention is basically consistent with the amplification curve of -75°C to -85°C (gold standard), which shows that the preservation solution of the preferred formula of the present invention can achieve a preservation effect similar to that of the gold standard.

[0059] 3.2Ct value:

[0060]

[0061] From the above Ct value test results, it can be seen that the preferred preservation solution formula of the present invention can achieve a preservation effect similar to that of the gold standard.

[0062] The preferred embodiments of the present invention are described above, but they are not intended to limit the present invention. Those skilled in the art may make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present invention.

Claims

1. A stool sample preservation solution, each 1L of stool sample preservation solution containing the following components: 。 2. A stool sample preservation solution, wherein each 1L of stool sample preservation solution contains the following components: 。 3. The method for preparing the stool sample preservation solution according to claim 1 or 2, characterized in that The steps include: After the components are fully dissolved in water, the pH value is adjusted to 7.0-8.5 with dilute hydrochloric acid, the volume is fixed to 1000 mL, and then filtered and sterilized with a 0.22 μm filter membrane.

4. A method for preserving stool samples, characterized in that: The mass volume ratio of the stool sample to the preservation solution described in claim 1 or 2 is 1 g: 3-5 ml.

5. Use of the stool sample preservation solution according to claim 1 or 2, wherein the stool sample preservation solution is used to improve the stability of Helicobacter pylori nucleic acid samples in stool samples.

Images