A method for accurate quantitative detection of sheep, pig, chicken and duck derived components in meat products based on real-time fluorescent PCR and application thereof
By utilizing real-time fluorescence PCR technology and the application of single-copy nuclear genome genes, the problem of accurate quantitative detection of sheep, pig, chicken, and duck-derived components in meat products has been solved, achieving highly specific and sensitive quantitative detection and supporting the healthy development of the meat product industry.
Patent Information
- Application Number
- CN202311379273.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-23
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2043-10-23
AI Technical Summary
Existing technologies are unable to achieve accurate quantitative detection of sheep, pork, chicken, and duck-derived ingredients in meat products, resulting in the inability to distinguish between malicious adulteration and unintentional contamination. The lack of scientific testing standards has affected the healthy development of the meat food industry.
Using real-time fluorescence PCR technology, specific primers and probes were designed and combined with single-copy genes from the nuclear genome to establish an absolute quantitative detection method. The percentage content of animal-derived components was calculated by real-time fluorescence PCR amplification and Ct value analysis.
It achieves highly specific, accurate, and sensitive quantitative detection of mutton, pork, chicken, and duck-derived components in meat products, with a quantification limit of 0.1%, conforming to the EU standard ENGL, providing scientific detection results, and combating meat adulteration.
Smart Images

Figure CN117625799B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of inspection detection technology, in particular to a precise quantitative detection method and application of mutton, pork, chicken and duck derived components in meat food, and more particularly, the present application provides a precise quantitative detection method and application of mutton, pork, chicken and duck derived components in meat food based on real-time fluorescent PCR. BACKGROUND
[0002] At present, the detection standard of meat industry adulteration only has a qualitative detection method, which cannot distinguish intentional adulteration and unintentional pollution. In the process of meat food production, transportation and storage, different meats contact each other, share processing tools and production lines, and the contaminated meat food will be defined as "adulterated meat". So far, there is no quantitative detection standard of meat derived components in China, and only a few literatures report the quantitative detection method of pork derived components and chicken derived components in mutton food. The method for simultaneously quantitatively detecting pork, chicken and duck derived components in mutton food has not been reported. Therefore, it is urgent to establish a stable, accurate and rapid quantitative detection method, which can accurately quantify the content of pork, chicken and duck derived components in mutton food, provide more scientific detection results for law enforcement departments, achieve no wrong detection and no missed detection, and promote the healthy development of meat food industry. SUMMARY
[0003] The purpose of the present application is to provide a precise quantitative detection method and application of mutton, pork, chicken and duck derived components in meat food based on real-time fluorescent PCR. The method can quantify the content of pork, chicken and duck derived components in mutton food, distinguish malicious adulteration and unintentional pollution, crack down on meat source adulteration, and promote the healthy and sustainable development of meat food industry.
[0004] In order to achieve the above purpose, the technical scheme of the present application is as follows:
[0005] A real-time fluorescent PCR precise quantitative detection method of mutton, pork, chicken and duck derived components in meat food, comprising the following steps:
[0006] (1) designing upstream primers, downstream primers and probes of mutton, pork, chicken and duck marker genes;
[0007] (2) extracting DNA of mutton, pork, chicken and duck standard materials and test samples, respectively;
[0008] (3) diluting the DNA of mutton, pork, chicken and duck standard materials extracted in step (2), respectively, preparing a series of standard solutions with gradient concentrations of copy number, taking the standard solution as a template to perform real-time fluorescent PCR amplification, measuring the Ct value of each group of standard solutions, and drawing a standard curve y=ax+b of mutton, pork, chicken and duck, wherein y is the Ct value of the test sample, a is the slope of the standard curve, x is the logarithm of the template copy number with 10 as the base, and b is the intercept of the standard curve;
[0009] (4) Taking the DNA of the test sample extracted in step (2) as a template, real-time fluorescent PCR amplification is performed; the Ct value of the test sample is obtained, and the copy number of the sheep, pig, chicken and duck marker genes in the test sample is calculated according to the standard curve drawn in step (3);
[0010] (5) The percentage content of the animal-derived component in the test sample is calculated according to the formula , wherein C is the percentage content of the animal component to be detected in the test sample, Nd is the copy number of the marker gene of the animal to be detected in the test sample, and Nz is the sum of the copy numbers of all animal marker genes in the test sample.
[0011] In an embodiment, in steps (3) and (4), the amplification primers and the probe of the real-time fluorescent PCR are as follows:
[0012] The upstream primer of sheep Ovi-F: ATGCTTGCTGTGGTCATTGCT;
[0013] The downstream primer of sheep Ovi-R: TGTAACGCAAGGCCTGCTACA;
[0014] The probe of sheep Ovi-P: VIC-TTCTCGCAGTCGCATCA-BHQ1;
[0015] The upstream primer of pig Sus-F: GCAAGGCCAGGGATCGA;
[0016] The downstream primer of pig Sus-R: AGCAGAAACCAGCCATGGATT;
[0017] The probe of pig Sus-P: FAM-CCGCGTCCTCATGG-BHQ1;
[0018] The upstream primer of chicken Gal-F: CGTCCCTCACTTCCATATTGATG;
[0019] The downstream primer of chicken Gal-R: ATCTTCACTGTCAATGCCTTCACA;
[0020] The probe of chicken Gal-P: Cy5-CCTCTTTGTGGATCCTGT-BHQ3;
[0021] The upstream primer of duck Ana-F: CAGTCCCCCCTGCCTAGGA;
[0022] The downstream primer of duck Ana-R: TCAGTGTACAGGTAGCCCCTCTCT;
[0023] The duck probe Ana-P: Texas-AAGTGCCAGTATGCGGG-BHQ2.
[0024] As preferred, in steps (3) and (4), the real-time fluorescent PCR reaction system for sheep is qPCR TaqMan Probe Master Mix 12.5 μL, Ovi-F and Ovi-R: primers each 1.0 μL, Ovi-P probe each 0.6 μL, DNA template 2 μL, and ddH2O to 25 μL.
[0025] As preferred, in steps (3) and (4), the real-time fluorescent PCR reaction system for pigs is qPCR TaqMan Probe Master Mix 12.5 μL, Sus-F and Sus-R: primers each 1.0 μL, Sus-P probe each 0.6 μL, DNA template 2 μL, and ddH2O to 25 μL.
[0026] As preferred, in steps (3) and (4), the real-time fluorescent PCR reaction system for chickens is qPCR TaqMan Probe Master Mix 12.5 μL, Gal-F and Gal-R: primers each 1.0 μL, Gal-P probe each 0.6 μL, DNA template 2 μL, and ddH2O to 25 μL.
[0027] As preferred, in steps (3) and (4), the real-time fluorescent PCR reaction system for ducks is qPCR TaqMan Probe Master Mix 12.5 μL, Ana-F and Ana-R: primers each 1.0 μL, Ana-P probe each 0.6 μL, DNA template 2 μL, and ddH2O to 25 μL.
[0028] As preferred, in steps (3) and (4), the real-time fluorescent PCR reaction conditions are: first stage 95℃, 5 min; second stage 95℃, 10 s, 62℃, 30 s, cycle number 40; and the fluorescence signal is collected during the annealing and extension period of the second stage.
[0029] In one embodiment, the present application provides a use in real-time fluorescent PCR quantitative detection of sheep, pig, chicken, and duck-derived components in meat food.
[0030] In one embodiment, the present application provides a kit comprising primers and probes.
[0031] In one embodiment, the primers and probes are used in the preparation of a kit for real-time fluorescent PCR quantitative detection of sheep, pig, chicken, and duck-derived components in meat food.
[0032] The application takes a single copy of a nuclear genome as a marker gene to establish a method for quantitatively detecting sheep, pig, chicken and duck components in meat food, which is high in specificity, accuracy and sensitivity, wherein the quantitative limit of the method for cattle, pig, chicken and duck is 0.1%, and the detection limit is 5, 5, 5 and 10 copies, respectively. The method is used for quantitatively detecting 35 commercial meat products, and the detection results of most sheep food are consistent with the labels, and no illegal adulteration is found, but a small amount of sheep food contains very low or even no sheep.
[0033] Compared with the prior art, the application has the following beneficial effects.
[0034] 1. The marker gene of the application is a single copy of a nuclear genome of sheep, pig, chicken and duck, putative HERV-K_5913.3 provirus ancestral Env polyprotein-like (PHPAP), prion protein (PRNP), transforming growth factor beta 3 (TF-GB3) and Beta-actin gene, which exists only in the animal cell nucleus, and the copy number of the marker gene can represent the number of animal cells. Most of the prior art uses mitochondrial genes as marker genes, and the number of mitochondria in animal cells varies greatly, so the accuracy of the quantitative detection method using mitochondrial genes as marker genes is poor.
[0035] 2. The real-time fluorescent PCR precise quantitative detection method for sheep, pig, chicken and duck components in meat food established by the application is based on Taqman probes, and is more specific than the dye method.
[0036] 3. The real-time fluorescent PCR precise quantitative detection method for sheep, pig, chicken and duck components in meat food established by the application is an absolute quantitative method, most of the prior art is a relative quantitative method, the absolute quantitative method does not depend on internal reference genes, and the copy number of the animal meat source marker gene to be detected is quantified absolutely, so that the precise detection can be realized for single or complex meat components.
[0037] 4. Compared with the prior art, the application tests the specificity, accuracy, quantitative limit and detection limit according to the EU standard ENGL, 2015, and the test results show that the application is high in specificity, accuracy and sensitivity. Through quantitative detection of commercial meat food, it is proved that the method of the application can quantify the content of pig, chicken and duck components in sheep food, and provides technical support for the healthy development of the meat food industry. BRIEF DESCRIPTION OF DRAWINGS
[0038] The application will be described by examples and with reference to the accompanying drawings, in which:
[0039] Figure 1 This is a graph showing the specificity test of the primers and probes in Example 2.
[0040] Figure 2 This is the standard curve and amplification diagram in Example 2. DETAILED DESCRIPTION
[0041] Any feature disclosed in this specification, unless otherwise stated, may be replaced by other equivalent or similar features. That is, unless otherwise stated, each feature is only an example of a series of equivalent or similar features.
[0042] Example 1
[0043] 1. Experimental Materials
[0044] 1.1 Standard substances
[0045] Cows, pigs, sheep, chickens, ducks, horses, dogs, donkeys, and sika deer.
[0046] 1.2 Commercial meat products
[0047] Cat, goose, deer, mink, pigeon, quail, carp, prawn, eel, bullfrog, mutton, mutton kebabs, mutton rolls, ham, luncheon meat, bacon, chicken thighs, chicken breasts, chicken sausages, duck wings, duck necks, and duck legs.
[0048] 1.3 Laboratory preparation
[0049] The 26 reference samples of the plant mixture, microbial mixture, beef, pork, chicken, and duck standard substance DNA mixed according to the copy number ratio are as follows: A1 (goat 50%, pig 50%), A2 (goat 90%, pig 10%), A3 (goat 95%, pig 5%), A4 (goat 99%, pig 1%), A5 (goat 99.5%, pig 0.5%), A6 (goat 99.9%, pig 0.1%), A7 (goat 50%, chicken 50%), A8 (goat 90%, chicken 10%), A9 (goat 95%, chicken 5%), A10 (goat 99%, chicken 1%), A11 (goat 99.5%, chicken 0.5%), A12 (goat 99.9%, chicken 0.1%), A13 (goat 50%, duck 50%), A14 (goat 90%, duck 10%), A15 (goat 95%, duck 5%), A16 (goat 99%, duck 1%), A17 (goat 99.5%, duck 0.5%), A18 (goat 99.9%, duck 0.1%), A19 (goat 40%, pig 30%, chicken 30%), A20 (goat 25%, pig 25%, chicken 25%, duck 25%), A21 (pig 40%, chicken 30%, duck 30%), A22 (chicken 50%, duck 50%), Q1 (goat 0.1%, pig 39.9%, chicken 10%, duck 50%), Q2 (pig 0.1%, beef 99.9%), Q3 (chicken 0.1%, beef 99.9%), and Q4 (duck 0.1%, beef 99.9%). The 4 reference samples of the beef, pork, chicken, and duck standard substance DNA prepared according to the copy number concentration are as follows: D1 (goat 20 copies / μL, pig 20 copies / μL, chicken 20 copies / μL, duck 20 copies / μL), D2 (goat 10 copies / μL, pig 10 copies / μL, chicken 10 copies / μL, duck 10 copies / μL), D3 (goat 5 copies / μL, pig 5 copies / μL, chicken 5 copies / μL, duck 5 copies / μL), and D4 (goat 1 copy / μL, pig 1 copy / μL, chicken 1 copy / μL, duck 1 copy / μL).
[0050] 2 Experimental method of the example
[0051] 2.1 DNA extraction and purification
[0052] 2.1.1 Extraction and purification of animal DNA
[0053] The animal genomic DNA was extracted by using the whole blood tissue cell genomic DNA rapid extraction kit (from Beijing Aidley Biotechnology Co., Ltd.), and the specific steps were as follows according to the kit instructions with slight modifications:
[0054] (1) 20-50 mg of animal tissue was ground into powder in liquid nitrogen, transferred into a centrifuge tube containing 360 μL of tissue lysis solution TL, and fully mixed;
[0055] (2) Add 40 μL of proteinase K solution (20 mg / mL) and mix by vortexing;
[0056] (3) Place the centrifuge tube in a 55°C water bath until the tissue is completely digested. Gently shake the tube every hour during the water bath;
[0057] (4) Add 400 μL of binding buffer CB, mix by vortexing, and then place the tube in a 70°C water bath for 10 min;
[0058] (5) After cooling, add 200 μL of isopropanol, mix by vortexing, and a flocculent precipitate may appear at this time;
[0059] (6) Transfer the mixture to the adsorption column AC, centrifuge at 13,000 rpm for 60 s, and discard the waste liquid in the collection tube;
[0060] (7) Add 500 μL of inhibitor removal solution IR, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid in the collection tube;
[0061] (8) Rinse twice, each time adding 600 μL of washing buffer WB, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid in the collection tube;
[0062] (9) Place the adsorption column AC in an empty collection tube, centrifuge at 13,000 rpm for 2 min, and try to remove the washing buffer;
[0063] (10) Take out the adsorption column AC and place it in a clean centrifuge tube. Add 120 μL of elution buffer EB to the middle of the adsorption column, let it stand at room temperature for 3-5 min, and then centrifuge at 12,000 rpm for 1 min.
[0064] 2.1.2 Extraction and purification of plant DNA
[0065] According to the instructions of the Plant Genomic DNA Purification Kit (TIANGEN, Beijing) Biotech Co., Ltd.), isolate and purify the genomic DNA. 2.1.3 Extraction and purification of microbial DNA
[0066] According to the instructions of the Microbial Genomic DNA Purification Kit (TIANGEN, Beijing) Biotech Co., Ltd.), isolate and purify the genomic DNA.
[0067] 2.1.4 Determination of DNA concentration and purity
[0068] 2.1.4 Determination of DNA concentration and purity
[0069] The concentration and purity of the extracted DNA were measured by ultramicro UV spectrophotometer, and the purity requirement was 1.8≤260 / 280≤2.0 and 260 / 230≥2. According to the measured DNA concentration value, the DNA was diluted to a working concentration of 50 ng / μL for standby.
[0070] 2.1.5 Real-time fluorescent PCR reaction system and reaction conditions
[0071] The real-time fluorescent PCR reaction system is shown in Table 1. The real-time fluorescent PCR reaction conditions are as follows: the first stage is 95℃, 5 min; the second stage is 95℃, 10 s, 62℃, 30 s, and the cycle number is 40. The fluorescence signal is collected during the annealing and extension period of the second stage.
[0072] Table 1 Real-time fluorescent quantitative PCR reaction system
[0073]
[0074] In Table 1, Note: 1. According to the requirements of the instrument, the reaction system can be adjusted appropriately. “—” indicates that the volume is uncertain. According to the final concentration of TaqMan reaction solution, the volume is determined, and the volume of ddH2O is adjusted accordingly to make the total volume of the reaction system reach 25.0 μL. 2. If the real-time fluorescent PCR kit is used, the reaction system is prepared according to the recommended dosage of the kit, but the dosage of the primers and the probe is executed according to Table 1. 3. The reaction amplification system can be adjusted in proportion according to the actual use of the instrument and consumables.
[0075] Example 1 (Method test)
[0076] 1.1 Specificity test of the method
[0077] Using 19 kinds of animal, plant and microbial mixture DNA as templates, real-time fluorescent PCR reaction systems of cattle, pigs, chickens and ducks were prepared for amplification, and the experimental results showed that there were fluorescent signals only in the samples of sheep, pigs, chickens and ducks, and there were no fluorescent amplification signals in other non-target organisms and blank controls (Fig. 1), indicating that the primers and probes designed in the patent have good specificity. Figure 1
[0078] Figure 1 The specificity test chart of the method is given; wherein, Figure 1 A is the amplification chart of sheep-derived components, Figure 1 B is the amplification chart of pig-derived components, Figure 1 C is the amplification chart of chicken-derived components, Figure 1 D is the amplification chart of duck-derived components.
[0079] 1.2 Drawing of standard curve
[0080] The DNA of standard materials of sheep, pig, chicken and duck was extracted, the DNA concentration was accurately measured and converted into copy number concentration, and then diluted by 5 times gradient as follows: (1) sheep: 34890, 6977, 1395, 279, 56; (2) pig: 40700, 8140, 1628, 326, 65; (3) chicken: 49780, 9956, 1991, 398, 80; (4) duck: 42130, 8427, 1685, 337, 67. Real-time fluorescence PCR amplification was carried out according to the above concentration, and a standard curve was fitted (see Figure 2 ). The parameters of the standard curve meet the requirements of the relevant standards, which is the key to establish the real-time fluorescence quantitative PCR method. According to the ENGL standard, the slope of the standard curve should be-3.1 to-3.6, the amplification efficiency should be 90% to 110%, and the correlation coefficient R2 should be greater than or equal to 0.98. It can be seen from Figure 2 that all parameters meet the requirements of the ENGL standard, indicating that the standard curve has good linear relationship and high amplification efficiency, and the real-time fluorescence quantitative PCR detection method for sheep, pig, chicken and duck is successfully established.
[0081] Figure 2 The standard curve and amplification diagram are given; wherein, Figure 2 A is the sheep standard curve amplification diagram, Figure 2 B is the sheep standard curve, Figure 2 C is the pig standard curve amplification diagram, Figure 2 D is the pig standard curve, Figure 2 E is the chicken standard curve amplification diagram, Figure 2 F is the chicken standard curve, Figure 2 G is the duck standard curve amplification diagram, H is the duck standard curve.
[0082] 1.3 Accuracy test of the method
[0083] In order to test the accuracy of the method, the reference samples A1-A22 were quantitatively detected by the method established in the application, and each sample was set with 3 parallel tests, and the experimental results are shown in Table 2. According to the standard curve, the copy number of each animal-derived component was calculated, and the percentage content of each animal-derived component was calculated according to the copy number. In order to confirm the accuracy of the results, the bias (Bias) and relative standard deviation (RSD) of all sample measurement results were calculated, and the bias (Bias) and relative standard deviation (RSD) of all samples were less than or equal to 25%, which met the requirements of the ENGL standard, indicating that the method established in the application has high accuracy.
[0084]
[0085]
[0086]
[0087] Note: B is the bias (formula for calculation: ); R is the relative standard deviation (formula for calculation: ).
[0088] 1.4 Quantitative limit test of the method
[0089] In order to test the quantitative limit of the method, the reference samples Q1-Q4 were quantitatively detected by the method established in the present application, and 15 parallel tests were set for each sample. The experimental results are shown in Table 3. The average values of real-time fluorescent quantitative detection were 0.09, 0.08, 0.09, and 0.12, respectively, the biases were 10.00%, 20.00%, 10.00%, and 20.00%, respectively, and the relative standard deviations were 22.22%, 25.00%, 11.11%, and 8.33%, respectively, all of which were less than or equal to 25%. Therefore, the quantitative limit of real-time fluorescent PCR quantitative detection method of sheep, pig, chicken, and duck-derived ingredients was determined to be 0.1%.
[0090]
[0091] 1.5 Test of detection limit of the method
[0092] In order to test the detection limit of the method, the reference samples D1-D4 were qualitatively detected by the method established in the present application, and 60 parallel tests were set for each sample. According to the LOD95% principle of ENGL standard, i.e. the requirement that the number of positive parallels / total number of parallels is greater than 95%, it can be known from Table 4 that the detection limits of sheep, pig, chicken, and duck were 5, 5, 5, and 10 copies, respectively.
[0093] Table 4 Test of detection limit of the method
[0094]
[0095] Example 2 (application of the method)
[0096] Application of the method of the present application to quantitative detection of commercial meat food
[0097] In order to verify the feasibility of the method, common commercial meat food is purchased to extract DNA, and the percentage of sheep, pig, chicken and duck ingredients in the meat food is quantitatively detected. The experimental results show that: most of the sheep meat food detection results are consistent with the label (as shown in Table 5), and no illegal adulteration is found, but a small number of sheep meat food contains very low or even no sheep meat, for example, S23 sheep roll, the label indicates that it contains sheep meat and pork, and the actual pork content is 100%; S37 and S39 two sheep rolls, the label indicates that it contains sheep meat and pork, and the sheep meat content is only 20.26% and 0.91%, respectively, and the producers fill a large amount of pork in the sheep roll. Such phenomenon seriously damages the legitimate rights and interests of consumers, and the development of the precise quantitative method will provide technical support for the healthy development of the meat industry.
[0098]
[0099]
[0100] The present application is not limited to the foregoing specific embodiments. The present application extends to any novel one, or any new combination, of the characteristics disclosed in this specification, as well as to any novel method or process disclosed in any step, or any new combination.
[0101] The application has been described in great detail in the foregoing specification, including specific embodiments thereof. It will of course be understood that various modifications can be made thereto without departing from the spirit and scope of the application. Such modifications are intended to fall within the scope of the application as described herein and set forth in the claims appended hereto.
Claims
1. A real-time fluorescent PCR precise quantitative detection method for sheep, pig, chicken, duck-derived components in meat products, characterized in that, It comprises the following steps: (1) Designing the upstream primer, downstream primer and probe of sheep, pig, chicken and duck marker genes; (2) Extracting the DNA of standard materials and test samples of sheep, pig, chicken and duck respectively; (3) Diluting the DNA of standard materials of sheep, pig, chicken and duck extracted in step (2) by gradient, respectively preparing a series of standard solutions with gradient copy number concentration, taking the standard solution as a template to perform real-time fluorescent PCR amplification, measuring the Ct value of each group of standard solutions, and drawing the standard curve of sheep, pig, chicken and duck y = ax + b, wherein y is the Ct value of the test sample, a is the slope of the standard curve, x is the logarithm of the template copy number with 10 as the base, and b is the intercept of the standard curve; (4) Taking the DNA of the test sample extracted in step (2) as a template to perform real-time fluorescent PCR amplification; obtaining the Ct value of the test sample, and calculating the copy number of the sheep, pig, chicken and duck marker genes in the test sample according to the standard curve drawn in step (3); (5) According to the formula The percentage content of animal-derived components in the test sample is calculated, wherein C is the percentage content of the animal components to be tested in the test sample, Nd is the copy number of the animal marker gene to be tested in the test sample, and Nz is the sum of the copy numbers of all animal marker genes in the test sample. In steps (3) and (4), the amplification primer and probe of real-time fluorescent PCR are as follows: The upstream primer of sheep Ovi-F: ATGCTTGCTGTGGTCATTGCT; The downstream primer of sheep Ovi-R: TGTAACGCAAGGCCTGCTACA; The probe of sheep Ovi-P: VIC-TTCTCGCAGTCGCATCA-BHQ1; The upstream primer of pig Sus-F: GCAAGGCCAGGGATCGA; The downstream primer of pig Sus-R: AGCAGAAACCAGCCATGGATT; The probe of pig Sus-P: FAM-CCGCGTCCTCATGG-BHQ1; The upstream primer of chicken Gal-F: CGTCCCTCACTTCCATATTGATG; The downstream primer of chicken Gal-R: ATCTTCACTGTCAATGCCTTCACA; The probe of chicken Gal-P: Cy5-CCTCTTTGTGGATCCTGT-BHQ3; The upstream primer of duck Ana-F: CAGTCCCCCCTGCCTAGGA; The downstream primer of duck Ana-R: TCAGTGTACAGGTAGCCCCTCTCT; The probe of duck Ana-P: Texas-AAGTGCCAGTATGCGGG-BHQ2.
2. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescent PCR reaction system of sheep is as follows: qPCRTaqMan Probe Master Mix 12.5 µL, Ovi-F and Ovi-R primers each 1.0 µL, Ovi-P probe 0.6 µL, DNA template 2 µL, and ddH2O 25 µL.
3. The method of claim 1, wherein In steps (3) and (4), the real-time fluorescent PCR reaction system of the pig is as follows: qPCR TaqMan Probe Master Mix 12.5 µL, Sus-F and Sus-R primers each 1.0 µL, Sus-P probe 0.6 µL, DNA template 2 µL, and ddH2O 25 µL.
4. The method of claim 1, wherein, In steps (3) and (4), the real-time fluorescent PCR reaction system of the chicken is as follows: qPCR TaqMan Probe Master Mix 12.5 µL, Gal-F and Gal-R primers each 1.0 µL, Gal-P probe 0.6 µL, DNA template 2 µL, and ddH2O 25 µL.
5. The method of claim 1, wherein, In steps (3) and (4), the real-time fluorescent PCR reaction system of the duck is as follows: qPCR TaqMan Probe Master Mix 12.5 µL, Ana-F and Ana-R primers each 1.0 µL, Ana-P probe 0.6 µL, DNA template 2 µL, and ddH2O 25 µL.
6. The method of claim 1, wherein In steps (3) and (4), the real-time fluorescent PCR reaction conditions are as follows: first stage 95℃, 5 min; second stage 95℃, 10 s, 62℃, 30 s, cycle number 40; and the fluorescence signal is collected during the annealing and extension period of the second stage.
7. The method of any one of claims 1-6 for use in the real-time fluorescent PCR quantitative detection of sheep, pig, chicken, and duck-derived components in meat food.
8. A kit characterized in that, The kit comprises the primers and probes of any one of claims 1-6.
9. Use of the primers and probes of any one of claims 1-6 in the preparation of a kit for the real-time fluorescent PCR quantitative detection of sheep, pig, chicken, and duck-derived components in meat food.
Citation Information
Patent Citations
Method for identifying animal-derived ingredients in meat or meat product
CN104673900A
Specific primer, probe, kit and method for detecting duck-origin components in meat products
CN105316418A