Saccharomyces cerevisiae KU2, selenium-enriched Saccharomyces cerevisiae and their applications

Abstract

The present invention provides Kazachstania unispora KU2, selenium-enriched Kazachstania unispora and their applications, relating to the technical field of functional microbial fermentation. The present invention provides a strain of Kazachstania unispora KU2 with a preservation number of CCTCC NO: M2023410. The Kazachstania unispora provided by the present invention has good selenium enrichment ability, especially high organic selenium enrichment ability. The selenium-enriched Kazachstania unispora provided by the present invention comprises the Kazachstania unispora KU2 and selenium. The selenium-enriched Kazachstania unispora provided by the present invention has a high selenium content and a high organic selenium content, and has a significant alleviating effect on colitis, especially colitis induced by dextran sulfate sodium and / or patulin, providing a reference for the development and mechanism research of anti-colitis drugs; moreover, it can also meet the requirements of organic environmental-friendly foods and feeds.

Description

Technical Field

[0001] The present invention relates to the technical field of functional microbial fermentation, and particularly relates to Kazachstania unispora KU2, selenium-enriched Kazachstania unispora, and their applications. Background Art

[0002] Selenium (Se) is an essential trace element for the human body, which plays a beneficial role in human health and has antioxidant and immune-enhancing functions. In addition, supplementing selenium in the human body can also reduce the risk of diseases such as diabetes and cardiovascular diseases. Research shows that a variety of diseases such as Keshan disease and Kashin-Beck disease are related to selenium deficiency. China is a large country lacking selenium, and 72% of its land area belongs to low-selenium zones, among which 30% belongs to severely selenium-deficient areas. Moreover, the selenium intake of the Chinese population is still far lower than the standard of 40 μg per day stipulated by the World Health Organization. At present, the main ways to supplement selenium are the intake of inorganic selenium and organic selenium. Compared with inorganic selenium, organic selenium has lower toxicity, higher bioavailability, and is more easily absorbed by the human body.

[0003] Yeast is a safe and selenium-carrier microorganism with rich nutritional components and is one of the important sources for the human body to supplement organic selenium. At present, the most widely used selenium-enriched yeasts are Saccharomyces cerevisiae and Candida utilis, and little research has been done on the potential selenium-enriching ability of other yeasts, resulting in a single type of selenium-enriched yeast at present. Research has found that some non-Saccharomyces yeasts have good physiological functions, such as reducing the risk of cardiovascular diseases and preventing colorectal cancer, etc., as well as good organic selenium enrichment ability. Therefore, it is of great significance to develop new yeasts with good selenium enrichment effect. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide Kazachstania unispora KU2, selenium-enriched Kazachstania unispora, and their applications. The Kazachstania unispora KU2 provided by the present invention has excellent selenium enrichment effect.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a strain of Kazachstania unispora KU2, with the preservation number of CCTCC NO: M2023410.

[0007] The present invention provides the application of the Kazachstania unispora KU2 described in the above technical solution in selenium enrichment.

[0008] The present invention provides selenium-enriched Kazachstania unispora, including the Kazachstania unispora KU2 described in the above technical solution and selenium; the selenium includes organic selenium and inorganic selenium; the total selenium content in the selenium-enriched Kazachstania unispora is > 350 mg / kg, and the content of organic selenium accounts for more than 95% of the total selenium content.

[0009] Preferably, the total selenium content in the selenium-enriched Saccharomyces cerevisiae single cell is 800-2000 mg / kg.

[0010] The present invention provides a method for preparing the selenium-enriched Saccharomyces cerevisiae single cell described in the above technical solution, comprising the following steps:

[0011] Inoculate Saccharomyces cerevisiae single cell KU2 into the first YPD liquid medium for activation culture to obtain a culture seed solution;

[0012] Inoculate the culture seed solution into the second YPD liquid medium for selenium-enriched culture in the presence of inorganic selenium to obtain selenium-enriched Saccharomyces cerevisiae single cell.

[0013] Preferably, the first YPD liquid medium and the second YPD liquid medium independently comprise: glucose 1.8-2.2 g / L, peptone 1.8-2.2 g / L, yeast extract powder 0.8-1.2 g / L, and the solvent is water;

[0014] The temperature of the activation culture is 25-32 °C, and the time is 20-60 h.

[0015] Preferably, the conditions for the selenium-enriched culture include: the inoculation amount of the culture seed solution is 1-20 wt / v%, the initial pH value is 5-7, calculated as selenium element, the addition amount of inorganic selenium is 4.5-27.5 mg / L, the addition time of inorganic selenium is from the start of the culture to the logarithmic phase of the culture, and the culture time is 30-48 h.

[0016] The present invention provides the application of the Saccharomyces cerevisiae single cell KU2 described in the above technical solution, the selenium-enriched Saccharomyces cerevisiae single cell described in the above technical solution, or the selenium-enriched Saccharomyces cerevisiae single cell prepared by the preparation method described in the above technical solution in food, feed or the preparation of anti-colitis drugs.

[0017] Preferably, the colitis includes colitis induced by dextran sulfate sodium and / or patulin.

[0018] The present invention provides an anti-colitis drug, comprising an active ingredient and an adjuvant; the active ingredient includes yeast and / or its metabolites; the yeast is Saccharomyces cerevisiae single cell KU2 and / or selenium-enriched Saccharomyces cerevisiae single cell described in the above technical solution; the selenium-enriched Saccharomyces cerevisiae single cell is the selenium-enriched Saccharomyces cerevisiae single cell described in the above technical solution or the selenium-enriched Saccharomyces cerevisiae single cell prepared by the preparation method described in the above technical solution.

[0019] The present invention provides a strain of Saccharomyces cerevisiae (Kazachstania unispora) KU2, with the preservation number of CCTCC NO: M2023410. The Saccharomyces cerevisiae provided by the present invention has good selenium-enriching ability, especially high organic selenium enrichment ability.

[0020] The present invention provides selenium-enriched Saccharomyces cerevisiae single spores (Se-KU2), which includes the Saccharomyces cerevisiae single spores KU2 and selenium described in the above technical solution; the selenium includes organic selenium and inorganic selenium; the total selenium content in the selenium-enriched Saccharomyces cerevisiae single spores > 350 mg / kg, and the content of organic selenium accounts for more than 95% of the total selenium content. The selenium-enriched Saccharomyces cerevisiae single spores provided by the present invention have a high selenium content, a high organic selenium content, and stable selenium enrichment. It can significantly relieve colitis, especially colitis induced by dextran sulfate sodium (DSS) and / or patulin (PAT) through the function of supplementing selenium, providing a reference for the development and mechanism research of anti-colitis drugs and diets. Moreover, the selenium-enriched Saccharomyces cerevisiae single spores provided by the present invention can be applied to foods and feeds, improving the absorption and utilization rate of selenium by organisms and meeting the requirements of organic and environmentally friendly foods and feeds.

[0021] The present invention provides a preparation method of the selenium-enriched Saccharomyces cerevisiae single spores described in the above technical solution. The preparation method provided by the present invention has a simple process, is easy to operate, uses simple raw materials, and has a low cost.

[0022] Furthermore, the selenium-enriched Saccharomyces cerevisiae single spores provided by the present invention have a short culture period and simple culture conditions.

[0023] Biological deposit description

[0024] The Saccharomyces cerevisiae single spores KU2, with the Latin name Kazachstania unispora, was deposited at the China Center for Type Culture Collection (CCTCC) on March 27, 2023. The deposit address is the China Center for Type Culture Collection, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC No: M2023410. Description of the drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0026] Figure 1 It is a result graph of the total selenium content of selenium-enriched Saccharomyces cerevisiae single spores under different inoculation amounts;

[0027] Figure 2 It is a graph showing the change of the total selenium content of selenium-enriched Saccharomyces cerevisiae single spores under different selenium addition concentrations;

[0028] Figure 3 It is a graph showing the influence of different selenium addition times on the total selenium content of selenium-enriched Saccharomyces cerevisiae single spores;

[0029] Figure 4 It is a graph showing the influence of different initial culture pH values on the total selenium content of selenium-enriched Saccharomyces cerevisiae single spores;

[0030] Figure 5 It is a graph showing the change in the total selenium content of selenium-rich Kazachstania unispora at different culture times;

[0031] Figure 6 It is a therapeutic effect diagram of selenium-rich Kazachstania unispora on DSS-induced colitis in mice. Among them, A is the change in the total selenium content of the mouse colon, and B is the HE staining result of the mouse colon;

[0032] Figure 7 It is a therapeutic effect diagram of selenium-rich Kazachstania unispora on PAT-induced colitis in mice. Among them, A is the change in the total selenium content of the mouse colon, and B is the HE staining result of the mouse colon. Detailed implementation manners

[0033] The present invention provides a strain of Kazachstania unispora KU2 with a preservation number of CCTCC NO: M2023410.

[0034] In the present invention, the Kazachstania unispora KU2 is an active strain isolated, purified and screened from natural Tibetan snow lotus bacteria. After purification, it is observed with the naked eye that its colony morphology is a smooth white dot on the surface. Through ITS sequence identification, this strain is determined to be Kazachstania unispora and is sent to the China Center for Type Culture Collection for preservation with a preservation number of CCTCC NO: M2023410. In the present invention, the natural Tibetan snow lotus bacteria are preferably collected from Nyingchi area, Tibet Autonomous Region.

[0035] In the present invention, the isolation and purification preferably include: inoculating natural Tibetan snow lotus bacteria into skim milk for activation culture to obtain activated snow lotus bacteria;

[0036] Washing the activated snow lotus bacteria with sterile water and then inoculating them into skim milk for fermentation and scale-up culture to obtain scale-up cultured snow lotus bacteria;

[0037] Washing the scale-up cultured snow lotus bacteria with sterile water and then performing gradient dilution with sterile physiological saline to obtain a gradient dilution solution;

[0038] Coating the gradient dilution solution on YPD solid medium for culture, and selecting yeast single colonies with a smooth white circular shape on the surface to obtain a crude product of Kazachstania unispora;

[0039] Streaking the crude product of Kazachstania unispora on a purification plate and then performing purification culture to obtain Kazachstania unispora KU2.

[0040] Unless otherwise specified, the materials and equipment used in the present invention are all commercially available products in the art.

[0041] In the present invention, natural Tibet snow lotus bacteria are inoculated into skim milk for activation culture to obtain activated snow lotus bacteria. In the present invention, the inoculation amount of the natural Tibet snow lotus bacteria is preferably 2-5 wt / v%, more preferably 3-4 wt / v%. In the present invention, the temperature of the activation culture is preferably 25-32 °C, more preferably 28 °C; the number of times of the activation culture is preferably ≥6 times, more preferably 6-10 times. After one activation culture, it is preferred in the present invention to replace the skim milk first and then carry out the next activation culture; the time of a single activation culture is preferably 24-48 h, more preferably 24-30 h; the activation culture is preferably carried out in a constant temperature shaking incubator, and the shaking speed of the constant temperature shaking incubator is preferably 140-200 r / min, more preferably 150-160 r / min.

[0042] After the activated snow lotus bacteria are obtained, in the present invention, the activated snow lotus bacteria are washed with sterile water and then inoculated into skim milk for fermentation and scale-up culture to obtain scale-up cultured snow lotus bacteria. In the present invention, the number of times of the washing is preferably 2-8 times, more preferably 3-5 times. In the present invention, the temperature of the fermentation and scale-up culture is preferably 25-32 °C, more preferably 28 °C; the time of the fermentation and scale-up culture is preferably 48-72 h, more preferably 48-60 h; the fermentation and scale-up culture is preferably carried out in a constant temperature shaking incubator, and the shaking speed of the constant temperature shaking incubator is preferably 140-200 r / min, more preferably 150-160 r / min.

[0043] After the scale-up cultured snow lotus bacteria are obtained, in the present invention, the scale-up cultured snow lotus bacteria are washed with sterile water and then gradient diluted with sterile physiological saline to obtain a gradient dilution solution. In the present invention, the inoculation amount of the scale-up cultured snow lotus bacteria is preferably 2-6 wt / v%, more preferably 2 wt / v%. In the present invention, the number of times of the washing is preferably 2-8 times, more preferably 3-5 times. In the present invention, the times of the gradient dilution are successively 10 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times and 10 6 times.

[0044] After obtaining the gradient dilution solution, the present invention coats the gradient dilution solution on a YPD solid medium for cultivation, and selects smooth white circular yeast single colonies on the surface to obtain a crude product of single-spore Saccharomyces cerevisiae. In the present invention, the YPD solid medium preferably comprises glucose, peptone and yeast extract powder, and the mass ratio of glucose, peptone and yeast extract powder is preferably 1.8-2.2:1.8-2.2:0.8-1.2, more preferably 1.9-2.1:1.9-2.1:0.9-1.1, and further preferably 2:2:1. In the present invention, the inoculation amount of the gradient dilution solution is preferably 1-20 wt / v%, more preferably 10 wt / v%. In the present invention, the cultivation temperature is preferably 25-32 °C, more preferably 28 °C; the cultivation time is preferably 48-72 h, more preferably 48-60 h; the cultivation is preferably carried out in a constant temperature shaking incubator, and the shaking speed of the constant temperature shaking incubator is preferably 140-180 r / min, more preferably 160 r / min.

[0045] After obtaining the crude product of single-spore Saccharomyces cerevisiae, the present invention streaks and purifies the crude product of single-spore Saccharomyces cerevisiae on a purification plate to obtain single-spore Saccharomyces cerevisiae KU2. In the present invention, the inoculation method of the crude product of single-spore Saccharomyces cerevisiae is preferably the three-step streaking method. In the present invention, the purification culture temperature is preferably 25-32 °C, more preferably 28 °C; the purification culture time is preferably 48-72 h, more preferably 48-60 h; the purification culture is preferably carried out in a constant temperature shaking incubator, and the shaking speed of the constant temperature shaking incubator is preferably 140-180 r / min, more preferably 150-160 r / min; the number of purification cultures is preferably 3-6 times, more preferably 3-4 times.

[0046] The present invention provides the application of the single-spore Saccharomyces cerevisiae KU2 described in the above technical solution in selenium enrichment.

[0047] The present invention provides selenium-enriched single-spore Saccharomyces cerevisiae, which comprises the single-spore Saccharomyces cerevisiae KU2 and selenium described in the above technical solution; the selenium comprises organic selenium and inorganic selenium, and the total selenium content in the selenium-enriched single-spore Saccharomyces cerevisiae > 350 mg / kg, preferably 450-2000 mg / kg, more preferably 600-1800 mg / kg, further preferably 700-1500 mg / kg, and most preferably 800-1300 mg / kg; the organic selenium content preferably accounts for more than 95% of the total selenium content. In the present invention, the organic selenium preferably comprises selenomethionine, and the content of selenomethionine accounts for more than 85% of the total selenium content.

[0048] The present invention provides a preparation method of the selenium-enriched single-spore Saccharomyces cerevisiae described in the above technical solution, comprising the following steps:

[0049] Inoculate Saccharomyces cerevisiae KU2 into the first YPD liquid medium for activation culture to obtain a culture seed solution;

[0050] Inoculate the obtained culture seed solution into the second YPD liquid medium for selenium-enriched culture in the presence of inorganic selenium to obtain selenium-enriched Saccharomyces cerevisiae KU2.

[0051] Inoculate Saccharomyces cerevisiae KU2 into the YPD liquid medium for selenium-enriched culture in the presence of inorganic selenium to obtain selenium-enriched Saccharomyces cerevisiae KU2.

[0052] In the present invention, Saccharomyces cerevisiae KU2 is inoculated into the first YPD liquid medium for activation culture to obtain a culture seed solution.

[0053] In the present invention, the first YPD liquid medium preferably comprises: glucose 1.8 - 2.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; peptone 1.8 - 2.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; yeast extract powder 0.8 - 1.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; and the solvent is water.

[0054] In the present invention, the temperature of the activation culture is preferably 25 - 32 °C, more preferably 28 °C; the time of the activation culture is preferably 48 - 60 h, more preferably 48 - 55 h; the activation culture is preferably carried out in a constant temperature shaking incubator, and the shaking speed of the constant temperature shaking incubator is preferably 140 - 180 r / min, more preferably 150 - 160 r / min.

[0055] After obtaining the culture seed solution, in the present invention, the culture seed solution is inoculated into the second YPD liquid medium for selenium-enriched culture in the presence of inorganic selenium to obtain selenium-enriched Saccharomyces cerevisiae KU2.

[0056] In the present invention, the second YPD liquid medium preferably comprises: glucose 1.8 - 2.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; peptone 1.8 - 2.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; yeast extract powder 0.8 - 1.2 g / L, more preferably 1.9 - 2.1 g / L, still more preferably 2 g / L; and the solvent is water.

[0057] In the present invention, the conditions for selenium-enriched culture preferably include: the inoculation amount of the seed culture solution is 1-20 wt / v%, more preferably 5-15 wt / v%, and further preferably 10 wt / v%; the initial pH value (pH value of YPD liquid medium) is 5-7, more preferably 5.5-6.5, and further preferably 6; the addition amount of inorganic selenium (calculated as selenium element) is 4.5-27.5 mg / L, preferably 9-23 mg / L, and further preferably 13.5-18.5 mg / L; when the inorganic selenium is sodium selenite, the addition amount of the sodium selenite is 10-60 mg / L, more preferably 20-50 mg / L, and further preferably 30-40 mg / L; the addition time of the inorganic selenium is from the start of the culture to the logarithmic phase of the culture, more preferably added at the start of the culture, and the inorganic selenium is preferably added in batches; the culture time is 30-48 h, preferably 35-45 h, and further preferably 44 h; the culture temperature is preferably 25-32 °C, more preferably 28 °C. In the present invention, the inorganic selenium preferably includes one or more of sodium selenite, sodium selenate, potassium selenite and potassium selenate.

[0058] After the selenium-enriched culture, the present invention preferably further includes: centrifuging the obtained selenium-enriched culture broth, washing, redissolving in sterile physiological saline and freeze-drying the obtained cell precipitate to obtain selenium-enriched Saccharomyces cerevisiae single cells. In the present invention, the washing is preferably performed with sterile physiological saline, and the number of washing times is preferably 2-8 times, more preferably 3-5 times. In the present invention, the temperature for freeze-drying is preferably -40 to -80 °C, more preferably -60 °C; the time for freeze-drying is preferably 24-72 h, more preferably 48 h.

[0059] The present invention provides the application of the Saccharomyces cerevisiae single cells KU2 of the above technical solution, the selenium-enriched Saccharomyces cerevisiae single cells of the above technical solution or the selenium-enriched Saccharomyces cerevisiae single cells prepared by the preparation method of the above technical solution in food, feed or the preparation of anti-colitis drugs. In the present invention, the colitis includes colitis induced by dextran sulfate sodium and / or patulin.

[0060] The present invention provides an anti-colitis drug, which includes an active ingredient and an excipient; the active ingredient includes yeast and / or its metabolites; the yeast is the Saccharomyces cerevisiae single cells KU2 and / or selenium-enriched Saccharomyces cerevisiae single cells of the above technical solution; the selenium-enriched Saccharomyces cerevisiae single cells are the selenium-enriched Saccharomyces cerevisiae single cells of the above technical solution or the selenium-enriched Saccharomyces cerevisiae single cells prepared by the preparation method of the above technical solution. The present invention has no special limitation on the excipient, and pharmaceutically acceptable excipients well-known to those skilled in the art can be used.

[0061] In the present invention, the anti-colitis drug preferably comprises enzymatically treated yeast and excipients. In the present invention, the enzyme used for the enzymatic treatment preferably comprises alkaline protease. The present invention has no special limitation on the conditions of the enzymatic treatment, and the well-known enzymatic treatment conditions in the art can be adopted. In the present invention, the excipient preferably comprises xylo-oligosaccharide. The present invention has no special limitation on the dosage ratio of the enzymatically treated yeast and the excipient, and it can be determined according to the actual situation.

[0062] To further illustrate the present invention, the isolation, purification, preservation and identification of Saccharomyces cerevisiae KU2, selenium-enriched Saccharomyces cerevisiae and their applications will be described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0063] In the following examples, YPD liquid culture medium: glucose 20 g / L, peptone 20 g / L, yeast extract powder 10 g / L, and the solvent is water. YPD solid medium: the mass ratio of glucose, peptone and yeast extract powder is 2:2:1.

[0064] Example 1

[0065] Isolation, purification, preservation and identification of Saccharomyces cerevisiae KU2

[0066] 1. Isolation and purification

[0067] In July 2020, a natural Tibetan snow lotus bacteria sample was collected from Nyingchi area, Tibet Autonomous Region. The collected snow lotus bacteria were collected into a sterile bag containing skim milk and transported to the laboratory by dry ice.

[0068] The natural Tibetan snow lotus bacteria were placed in skim milk at a ratio of 2 wt / v%, pre-cultured at 28 °C and 140 r / min for 6 days, and the skim milk was changed every 1 day during the pre-culture process for re-culture to obtain activated snow lotus bacteria. The activated snow lotus bacteria were repeatedly rinsed 3 times with sterile water, re-inoculated into fresh skim milk, and fermented and cultured in a constant temperature shaking incubator at 28 °C and 140 r / min for 48 h to obtain expanded culture snow lotus bacteria. Under sterile conditions, the expanded culture snow lotus bacteria were repeatedly rinsed 3 times with sterile water and then placed in sterile physiological saline and mixed evenly to obtain a snow lotus bacteria suspension. Take 100 μL of the snow lotus bacteria suspension for serial dilution (the dilution multiples are 10 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times and 10 6Multiply (by a factor) to obtain a gradient dilution. Pipette 100 μL of each gradient dilution and evenly spread them onto a sterilized YPD solid medium. Incubate in a constant temperature incubator for 72 h. Select smooth white circular yeast single colonies on the surface, and inoculate them onto a purification plate using the three-step streaking method. Incubate in a 28 °C constant temperature incubator for 48 h. Repeat the inoculation and purification operations on the purification plate 3 - 6 times to obtain the single-spore Saccharomyces cerevisiae KU2.

[0069] 2. Preservation of single-spore Saccharomyces cerevisiae KU2:

[0070] Use a sterile inoculation loop to pick and inoculate the single-spore Saccharomyces cerevisiae KU2 on the purification plate into a 2 mL glycerol tube (the glycerol tube contains 30% glycerol and 70% YPD liquid medium). Store the glycerol tube in a -80 °C refrigerator.

[0071] 3. Identification process of single-spore Saccharomyces cerevisiae KU2:

[0072] Use a sterile bamboo stick to inoculate the single-spore Saccharomyces cerevisiae KU2 on the purification plate into YPD liquid medium. Incubate in a 28 °C constant temperature incubator for 24 - 48 h. Take 2 mL of the cultured bacterial liquid, centrifuge at 6000 r / min for 10 min. Wash the obtained precipitate 3 times with sterile normal saline and send it to a sequencing company for sequencing.

[0073] DNA extraction and ITS sequencing of colonies were performed: The DNA of fungi was extracted using a kit (universal for fungi), and its DNA was amplified by designing ITS primers (ITS1: TCCGTAGGTGAACCTGCGG, SEQ ID NO.1; ITS4: TCCTCCGCTTATTGATATGC, SEQ ID NO.2). Each PCR mixture included 2 μL of DNA template, 17.5 μL of premixed Taq enzyme, 1 μL of forward primer, and 1 μL of reverse primer. After DNA amplification, the PCR products were detected using 0.8% agarose gel electrophoresis. Finally, the amplified products were sequenced.The obtained sequence was uploaded to the NCBI database. Through Blast alignment, it was determined that the purified yeast was Kazachstania unispora, numbered KU2. The ITS sequence was as shown in SEQ ID NO.3, specifically: TACCTGCGGAAGGATCATTATAGAAATATAATTATTCGTTGCTTTGCTTGGAGACACATACTGCCGAACCAGCGCTTAATTGCGCGGTTTGGTGGGTCTCTGTAGCTCAGTAGCACTATTACACACTGTGGAGATTTTATAATTCTTTGCATGCTTCTTTGGGCAGCTTCGGCAGCCCAGAGGTAACAAACACAAACAACTTTGTAATATTTTTAACCCAGTCAAAACCAGAATTCCAGAAAGATTTATCTTTTTGTAATATTATAACAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAGCAATGTTTGGTTGTGAGTGATACTCATTCGAGTTAGCTTGAAATTGCTGGCCGATGGCTGTTGTGGCTGAGTGTCTCCCTCGGGAGAGCACTTGCTGCGTTAGGGACGTCCTGCTGGACATCTTCGTACTAGGTTTTACCAATTCGAGGACGGTTAGCGAGGCGGCCTGCAGTGAGTGTAGTGCTTGACTACGTTGCACCATGGCGAACAGTGTTCTTTTAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAGG。

[0074] Example 2

[0075] Effect of the inoculum amount of Kazachstania unispora KU2 on the total selenium content

[0076] The Kazachstania unispora KU2 obtained in Example 1 was inoculated into a sterilized YPD liquid medium for activation and cultured at a constant temperature of 28 °C in a shaker at a rotation speed of 180 r / min for 24 h to obtain a culture seed solution.

[0077] The cultured seed liquid was inoculated into YPD liquid medium, and an aqueous solution of sodium selenite was added to the medium at the beginning of the culture. The addition amount of sodium selenite was 40 mg / L. The initial pH value of the YPD liquid medium was adjusted to 6, and it was placed at 28 °C and incubated at a constant temperature of 180 r / min for 44 h. The obtained bacterial liquid was centrifuged to obtain a cell precipitate, and the precipitate was washed with sterile 0.9% normal saline three times. After that, the obtained precipitate was redissolved with sterile normal saline and freeze-dried under vacuum at -80 °C for 48 h to obtain selenium-enriched Saccharomyces cerevisiae single cells (Se-KU2). Among them, the inoculation amounts of the seed liquid were 1 wt / v%, 5 wt / v%, 10 wt / v%, and 15 wt / v% respectively.

[0078] The total selenium content of the obtained selenium-enriched Saccharomyces cerevisiae single cells was determined using an atomic fluorescence spectrometer.

[0079] Figure 1 The results of the total selenium content of selenium-enriched Saccharomyces cerevisiae single cells at different inoculation amounts. The results showed that when the inoculation amount was 10%, the total selenium content of Saccharomyces cerevisiae single cell KU2 was the highest. The optimal inoculation amount was 10%.

[0080] Example 3

[0081] Effect of Selenium Addition Concentration on the Total Selenium Content of Selenium-Enriched Saccharomyces cerevisiae Single Cells

[0082] Selenium-enriched Saccharomyces cerevisiae single cells were prepared according to the method of Example 2, where the inoculation amount was 10 wt / v%, and the addition concentrations of sodium selenite in the medium were set to 10, 20, 30, 40, and 50 mg / L respectively.

[0083] Figure 2 The changes in the total selenium content of selenium-enriched Saccharomyces cerevisiae single cells at different selenium addition concentrations. The results showed that when the selenium addition concentration (calculated as sodium selenite) was 40 mg / L, the total selenium content of selenium-enriched Saccharomyces cerevisiae single cells was the highest.

[0084] Example 4

[0085] Effect of Selenium Addition Time on the Total Selenium Content of Selenium-Enriched Saccharomyces cerevisiae Single Cells

[0086] Selenium-enriched Saccharomyces cerevisiae single cells were prepared according to the method of Example 2, where the inoculation amount was 10 wt / v%, and the addition times of sodium selenite were set as follows: adding selenium at the beginning of the culture, adding selenium at the initial stage of the logarithmic phase, adding selenium at the middle stage of the logarithmic phase, 30% at the initial stage of the logarithmic phase + 70% at the middle stage of the logarithmic phase.

[0087] Figure 3 The effects of different selenium addition times on the total selenium content of selenium-enriched Saccharomyces cerevisiae single cells. The results showed that when adding selenium at the beginning of the culture, the total selenium content of selenium-enriched Saccharomyces cerevisiae single cells was the highest.

[0088] Example 5

[0089] Effect of initial culture pH on total selenium content of Saccharomyces cerevisiae KU2

[0090] Prepare selenium-enriched Saccharomyces cerevisiae according to the method of Example 2, wherein the inoculation amount is 10 wt / v%, and the initial pH values of the YPD liquid medium are 5, 5.5, 6, and 6.5 respectively.

[0091] Figure 4 For the effect of different initial culture pH on the total selenium content of Saccharomyces cerevisiae KU2. The results show that when the initial pH value of the YPD liquid medium is 6, the total selenium content of the selenium-enriched Saccharomyces cerevisiae is the highest.

[0092] Example 6

[0093] Effect of culture time on total selenium content of Saccharomyces cerevisiae KU2

[0094] Prepare selenium-enriched Saccharomyces cerevisiae according to the method of Example 2, wherein the inoculation amount is 10 wt / v%, and the culture times are set to 32 h, 36 h, 40 h, 44 h, and 48 h respectively.

[0095] Figure 5 For the change of total selenium content of selenium-enriched Saccharomyces cerevisiae at different culture times. The results show that the total selenium content of Saccharomyces cerevisiae KU2 cultured for 44 h is the highest.

[0096] Example 7

[0097] Obtain selenium-enriched culture process conditions by single-factor optimization and orthogonal optimization

[0098] According to the results recorded in Examples 2-6, the selenium addition concentration (C, in column C, 1 represents the selenium (sodium selenite) addition concentration of 30 mg / L, 2 represents the selenium (sodium selenite) addition concentration of 40 mg / L), the selenium addition time (B, in column B, 1 represents adding selenium at the beginning of the culture, 2 represents adding selenium at the beginning of the logarithmic phase), and the culture pH (A, in column A, 1 represents the initial pH = 6, 2 represents the initial pH = 6.5) have a greater impact on the total selenium content of the strain. Therefore, different levels are set according to these three factors for the orthogonal design of selenium-enriched culture conditions. The orthogonal test design and results are shown in Table 1.

[0099] Table 1 Orthogonal test design and total selenium content in selenium-enriched Saccharomyces cerevisiae (n = 3)

[0100] Test number A B C Blank Total selenium content (mg / kg) 1 1(6) 1 (At the start of cultivation) 1(30) 0 794.6±24.8b 2 1 1 2(40) 0 1237.3±78.2a 3 1 2 (At the start of the logarithmic phase) 1 0 363.9±8.2g 4 1 2 2 0 451.5±35.8f 5 2(6.5) 1 1 0 732.9±43.7c 6 2 1 2 0 811.5±19.7b 7 2 2 1 0 601.8±10.2e 8 2 2 2 0 639.6±20.2d

[0101] Each value in Table 1 represents the mean ± standard deviation of three parallel samples; different letters marked in the column of total selenium content indicate significant differences between the values (P<0.05).

[0102] The results in Table 1 show that the optimal selenium-enriched culture conditions for the Saccharomyces cerevisiae single spore strain are as follows: the inoculum amount of the strain is 10 wt / v%, the selenium addition concentration is 40 mg / L, selenium is added at the beginning of the culture, the initial pH of the culture is 6, and the culture time is 44 h. The measured value of the total selenium content of the selenium-enriched Saccharomyces cerevisiae single spore obtained under these conditions is relatively high, indicating that the Saccharomyces cerevisiae single spore KU2 provided by the present invention has good selenium-enriching ability.

[0103] Example 8

[0104] And the therapeutic effect of selenium-enriched Saccharomyces cerevisiae single spore of Saccharomyces cerevisiae single spore KU2 on dextran sulfate sodium (DSS)-induced colitis in mice

[0105] The Saccharomyces cerevisiae single spore KU2 and the selenium-enriched Saccharomyces cerevisiae single spore obtained when the inoculum amount in Example 2 is 10 wt / v% are respectively reconstituted with sterilized 0.86% normal saline to prepare a Saccharomyces cerevisiae single spore KU2 suspension and a selenium-enriched Saccharomyces cerevisiae single spore suspension. Using dextran sulfate sodium (DSS)-induced colitis mice as an animal model, the above several materials are fed. The animal model is purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0106] A total of 32 male C57BL / 6J mice, specific pathogen-free (SPF) grade, are fed with standard feed and allowed to eat and drink freely. After the mice are acclimatized in the animal house for 7 days, they are randomly divided into 4 groups, with 8 mice in each group, namely (1) a control group intragastrically administered with normal saline for three weeks (CTL); (2) a model group, freely drinking DSS for one week (3-5%), establishing a colitis mouse model, and then dividing this model group into four groups, ① intragastrically administered with normal saline for one week after the end of the modeling, ② intragastrically administered with a suspension of non-selenium-enriched Saccharomyces cerevisiae single spore KU2 for one week after the end of the modeling (10 9 CFU / mL), ③ intragastrically administered with a selenium-enriched Saccharomyces cerevisiae single spore suspension for one week after the end of the modeling (0.4 ppm, Se-rich yeast group), ④ intragastrically administered with the common prostaglandin synthesis inhibitor mesalazine as a positive control group (30 mg / kg, Mesalazine group) after the end of the modeling. Each mouse is intragastrically administered 0.2 mL of the liquid once a day.

[0107] After the mice were sacrificed after mold removal, colonic tissue specimens were taken for histomorphological examination. The specimens were fixed with 4% paraformaldehyde, embedded in paraffin, and stained with HE. Another part of the colonic tissue was used for selenium content detection. The tissue was added to normal saline and ground with a tissue grinder to obtain a tissue homogenate. After overnight cold digestion with a digestive solution (concentrated nitric acid and perchloric acid), the solution was heated on a hot plate until it became colorless and transparent, and 6 moL / L hydrochloric acid solution was added to continue digestion until the sample became colorless droplets. The digested solution was collected, and the total selenium content of the colonic tissue was analyzed and determined using an atomic fluorescence spectrometer. The results are as Figure 6 shown, Figure 6 in the same column in ### the different symbols marked indicate significant differences (P<0.05), *P<0.05, **P<0.01,

[0108] Figure 6 in Figure 6 Figure A shows the change in the total selenium content of the mouse colon. It can be seen from the figure that the selenium content of the mice in the model group (DSS) is lower than that in the control group (CTL), and the selenium content of the mice in the group supplemented with selenium-rich Saccharomyces cerevisiae (Se-rich yeast) is higher than that in the mice in the model group (DSS).

[0109] In Figure B, the HE staining results of the mouse colon are shown. It can be seen from the figure that there is infiltration of inflammatory cells in the mice in the model group (DSS) compared with the control group (CTL), and there is no infiltration of inflammatory cells in the mice in the group supplemented with selenium-rich Saccharomyces cerevisiae (Se-rich yeast), and the therapeutic effect is close to that of the group intragastrically administered with mesalazine (Mesalazine).

[0110] Example 9

[0111] And the therapeutic effect of selenium-rich Saccharomyces cerevisiae and Saccharomyces cerevisiae KU2 on dextran sulfate sodium (DSS)-induced colitis in mice

[0112] The single-cell Saccharomyces cerevisiae KU2 and the selenium-enriched single-cell Saccharomyces cerevisiae obtained when the inoculation amount in Example 2 was 10 wt / v% were separately reconstituted with sterilized 0.86% normal saline to prepare a single-cell Saccharomyces cerevisiae KU2 suspension and a selenium-enriched single-cell Saccharomyces cerevisiae suspension. Colitis mice induced by patulin (PAT) were used as an animal model, and the above several materials were fed. The animal model was purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0113] A total of 32 male C57BL / 6J mice, specific pathogen-free (SPF) grade, were fed with standard feed and allowed free access to food and water. After the mice were acclimated in the animal house for 7 days, they were randomly divided into 4 groups, with 8 mice in each group, namely (1) a control group intragastrically administered with normal saline for three weeks; (2) a model group, intragastrically administered with patulin (PAT) for two weeks (0.8 mg / kg) to establish colitis model mice, and then the model mice were divided into four groups: ① intragastrically administered with normal saline for one week after the modeling was completed; ② intragastrically administered with a suspension of non-selenium-enriched yeast strain for one week (10 9 CFU / mL) after the modeling was completed; ③ intragastrically administered with a suspension of highly selenium-enriched yeast strain for one week (0.4 ppm, Se-rich yeast group) after the modeling was completed; ④ intragastrically administered with the commonly used prostaglandin synthesis inhibitor mesalazine as a positive control group (30 mg / kg) after the modeling was completed. Each mouse was intragastrically administered 0.2 mL of the liquid once a day.

[0114] According to the method of Example 8, the mice were sacrificed after the model was removed, and the colon tissues were taken for histological examination and selenium content detection respectively. The results are as Figure 7 shown, Figure 7 In the same column in, different symbols indicate significant differences (P < 0.05), *P < 0.05, **P < 0.01, ### P < 0.001, and ns indicates no significant difference..

[0115] Figure 7 In, A is the graph of the total selenium content change in the mouse colon. The selenium content in the model group (PAT) mice was lower than that in the control group (CTL), and the selenium content in the mice in the selenium-enriched single-cell Saccharomyces cerevisiae group (Se-rich yeast) was higher than that in the model group (PAT) mice. Figure 7 In, B is the HE staining result graph of the mouse colon. In the model group (PAT) mice, there was infiltration of inflammatory cells compared with the control group (CTL), and there was no infiltration of inflammatory cells in the mice in the selenium-enriched single-cell Saccharomyces cerevisiae group (Se-rich yeast), and the effect was close to that of the mesalazine group (Mesalazine) intragastrically administered.

[0116] The selenium content in the mice of the model group (PAT) was lower than that in the control group (CTL), and the selenium content in the mice of the group supplemented with selenium-rich Saccharomyces cerevisiae (Se-richyeast) was higher than that in the mice of the model group (PAT), indicating that supplementing with selenium-rich Saccharomyces cerevisiae could improve the decrease in colonic selenium content caused by PAT. Moreover, there was no infiltration of inflammatory cells in the mice of the group supplemented with selenium-rich Saccharomyces cerevisiae (Se-rich yeast), indicating that supplementing with selenium-rich Saccharomyces cerevisiae could improve PAT-induced colitis, and the effect was close to that of the prostaglandin synthesis inhibitor mesalazine.

[0117] The above results prove that supplementing with selenium-rich Saccharomyces cerevisiae can increase the selenium content in the colon of mice, improve intestinal inflammation in mice, and the effect is close to that of the prostaglandin synthesis inhibitor mesalazine.

[0118] Example 10

[0119] Preparation of anti-colitis drug

[0120] In the batching tank, the selenium-rich Saccharomyces cerevisiae obtained when the inoculation amount in Example 2 was 10 wt / v% was formulated into an aqueous solution with a content of 50 wt% (content of yeast dry matter), heated to 80 °C and reacted for 1 h, cooled to 25 °C, the pH value was adjusted to 9.0, 2 wt‰ of alkaline protease was added, and the enzymatic hydrolysis reaction was carried out for 24 h. After heating to 90 °C, the enzyme was inactivated for 1 h. The cell wall was removed by centrifugation at 8000 rpm, the supernatant was collected, concentrated to a dry matter content of 80 wt%, homogenously mixed with 2 wt% of xylo-oligosaccharide, and then spray-dried to obtain an anti-colitis drug containing selenium-rich Saccharomyces cerevisiae.

[0121] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments according to the embodiments of the present invention without creative labor, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A single-spore Saccharomyces yeast (Kazachstania unispora) KU2, characterized in that, The preservation number is CCTCC NO: M2023410.

2. Use of the Saccharomyces cerevisiae KU2 of claim 1 in selenium enrichment.

3. Selenium-enriched Saccharomyces cerevisiae, comprising the Saccharomyces cerevisiae KU2 of claim 1 and selenium; the selenium includes organic selenium and inorganic selenium; the total selenium content in the selenium-enriched Saccharomyces cerevisiae is > 350 mg / kg, and the content of organic selenium accounts for more than 95% of the total selenium content.

4. The selenium-enriched Saccharomyces cerevisiae according to claim 3, characterized in that, The total selenium content in the selenium-enriched Saccharomyces cerevisiae is 800 - 2000 mg / kg.

5. Preparation method of the selenium-enriched Saccharomyces cerevisiae of claim 3 or 4, comprising the following steps: Inoculate Saccharomyces cerevisiae KU2 into the first YPD liquid medium for activation culture to obtain a culture seed liquid; Inoculate the culture seed liquid into the second YPD liquid medium for selenium enrichment culture in the presence of inorganic selenium to obtain selenium-enriched Saccharomyces cerevisiae.

6. The preparation method according to claim 5, characterized in that, The first YPD liquid medium and the second YPD liquid medium independently comprise: glucose 1.8 - 2.2 g / L, peptone 1.8 - 2.2 g / L, yeast extract powder 0.8 - 1.2 g / L, and the solvent is water; The temperature of the activation culture is 25 - 32 °C, and the time is 20 - 60 h.

7. The preparation method according to claim 5, characterized in that The conditions for the selenium enrichment culture include: the inoculation amount of the culture seed liquid is 1 - 20 wt / v%, the initial pH value is 5 - 7, calculated by selenium element, the addition amount of inorganic selenium is 4.5 - 27.5 mg / L, the addition time of inorganic selenium is from the start of the culture to the logarithmic phase of the culture, and the culture time is 30 - 48 h.

8. Use of the Saccharomyces cerevisiae KU2 of claim 1 and the selenium-enriched Saccharomyces cerevisiae of any one of claims 3 - 4 in food, feed or the preparation of anti-colitis drugs.

9. The application according to claim 8, characterized in that, The colitis includes colitis induced by dextran sulfate sodium and / or patulin.

10. An anti-colitis drug, characterized in that, It includes an active ingredient and excipients; the active ingredient includes yeast; the yeast is the Saccharomyces cerevisiae KU2 of claim 1 and / or selenium-enriched Saccharomyces cerevisiae; the selenium-enriched Saccharomyces cerevisiae is the selenium-enriched Saccharomyces cerevisiae of any one of claims 3 - 4 or the selenium-enriched Saccharomyces cerevisiae prepared by the preparation method of any one of claims 5 - 7.

Images