DNA tetrahedron assembly and its application in the preparation of fluorescent probes for circular RNA imaging

Abstract

The present invention belongs to the field of nano-biosensing, and specifically relates to a DNA tetrahedron combination and its application in preparing a fluorescent probe for circular RNA imaging. The DNA tetrahedron combination consists of TDN1 and TDN2, wherein: the TDN1 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1‑7; the TDN2 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1‑4 and SEQ ID NO.8, the 3′ end of the SEQ ID NO.6 is modified with a fluorescent quenching group, and the 53rd base at the 5′ end of the SEQ ID NO.5 is modified with a fluorescent reporter group. The DNA tetrahedron combination of the present invention uses entropy increase to drive the catalytic cycle reaction to accumulate fluorescent signals, and as a fluorescent probe, it has the advantages of high sensitivity, high specificity and high stability in circular RNA imaging.

Description

Technical Field

[0001] The invention belongs to the field of nano-biosensing, and in particular relates to a DNA tetrahedron combination and an application thereof in preparing a fluorescent probe for circular RNA imaging. Background Art

[0002] Circular RNA (circRNA) is an endogenous non-coding RNA with a circular molecular structure. Circular RNA is produced by reverse splicing and cyclization of mRNA precursors. A large number of reports have shown that due to the stability and conservation of circRNA in mammalian cells, circRNA is more suitable as a potential biomarker for disease diagnosis than miRNA. Studies have found that the expression of some circular RNAs is significantly different between tumors and normal tissues, and circRNA participates in the proliferation, invasion and metastasis of tumor cells through various mechanisms. The abnormal expression of circRNA allows circRNA to be used as a biomarker for cancer diagnosis and prognosis. In addition, sensitive and specific detection of circRNA is of great significance for understanding the biological function of circRNA and tracking the progression of the disease.

[0003] The commonly used circRNA analysis method is reverse transcription-quantitative polymerase chain reaction (RT-qPCR), and its typical test process is as follows: first, extract all RNA (including mRNA and mircoRNA) from cells, use exonuclease R, nicotinic acid phosphatase, 5' end exonuclease, etc. to degrade linear RNA and retain circRNA, then reverse transcribe circRNA to obtain complementary DNA, and then perform quantitative analysis through the accumulation of fluorescent signals amplified by PCR. However, this method cannot be used for the detection and imaging of circRNA in cells, and is limited by the following shortcomings: linear RNA is difficult to be completely removed after enzyme degradation; during the reverse transcription process, rolling circle amplification with circRNA as a template will produce technical artifacts, and some literature shows that these artifacts account for 34-55% of the detected RNA. This inevitably causes false positive signals and cannot truly reflect the differences in circRNA expression levels between different cells.

[0004] The existing method for intracellular circular RNA imaging is fluorescence in situ hybridization for circRNA. This method has the following shortcomings. First, low sensitivity. Since the abundance of circRNA in cells is often low, there are fewer fluorescent probes binding to circRNA, and the emitted fluorescent signal is weak, so the detection sensitivity is limited. The lower sensitivity makes it difficult to detect circRNA with low expression levels. Secondly, the specificity is poor. Although specific probes can be designed in theory to identify specific circRNAs, in complex cellular environments, the probes will still non-specifically bind to other nucleic acids, thereby affecting the accuracy of circRNA imaging. In addition, the single-stranded DNA probes used in fluorescence in situ hybridization technology also face the problem of being easily degraded by enzymes in the cell, which leads to the failure of the fluorescent probes. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a DNA tetrahedron combination and its application in preparing a fluorescent probe for circular RNA imaging.

[0006] The present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a DNA tetrahedron assembly, consisting of TDN1 and TDN2, wherein:

[0008] The TDN1 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-7;

[0009] The TDN2 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-4 and SEQ ID NO.8.

[0010] The 3′ end of the SEQ ID NO.6 is modified with a fluorescent quenching group, and the 53rd base of the 5′ end of the SEQ ID NO.5 is modified with a fluorescent reporter group.

[0011] As a preferred embodiment of the DNA tetrahedron combination of the present invention, the fluorescent reporter group is Cy5.5, and the fluorescent quencher group is BHQ3.

[0012] In a second aspect, the present invention provides the use of the DNA tetrahedron combination in preparing a fluorescent probe.

[0013] Furthermore, the fluorescent probe is used for diagnosis and / or prognosis of cancer.

[0014] Furthermore, circular RNA hsa_circ_0000700 is highly expressed in the cancer tissues and / or cancer cells.

[0015] Furthermore, the cancer includes human esophageal cancer.

[0016] Furthermore, the fluorescent probe is used for imaging circular RNA hsa_circ_0000700 in human esophageal cancer cells.

[0017] In a specific embodiment of the present invention, the

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) High sensitivity: To ensure the sensitivity of circRNA imaging, the present invention uses entropy increase to drive the catalytic cycle reaction to accumulate fluorescent signals. Specifically, the cell internalizes the DNA tetrahedron probe to allow it to enter the tumor cell, and the reverse splicing fragment on the intracellular hsa_circ_0000700 dissociates the DNA tetrahedron with the Cy5.5 fluorescent reporter group from the LinkerDNA (i.e., SEQ ID NO.7) through chain displacement to emit a fluorescent signal. After one reaction, the circRNA can be displaced to trigger the next reaction, achieving signal accumulation, and finally achieving high-sensitivity imaging of circRNA in tumor cells. Due to the signal amplification effect during the reaction process, the system can accurately detect low-abundance circRNA.

[0020] (2) High specificity: There are linear RNAs with the same sequence as circRNA in cells, so when designing probes, it is necessary to consider that the probes can only recognize circRNAs and cannot bind to linear RNAs. The present invention carefully designs the DNA sequence in the cyclic catalytic amplification system. Figure 2 d. Only hsa_circ_0000700 can trigger a strand displacement reaction and emit fluorescence, while the linear RNA corresponding to hsa_circ_0000700 cannot trigger a strand displacement reaction. In summary, the present invention designs a specific binding sequence for the target circRNA to ensure the specificity of the detection.

[0021] (3) Probe stability: All DNA chains involved in the entropy increase-driven catalytic cycle reaction (including the DNA chain that recognizes circRNA) are carried on the DNA tetrahedron. Since the DNA tetrahedron is resistant to nucleases, the stability of the probe in the present invention is improved, and the DNA tetrahedron can exist stably in the cell for more than 24 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Middle: Schematic diagrams and sequence numbers of two DNA tetrahedrons. The direction of the arrows in each DNA sequence indicates the 5′ to 3′ direction of the DNA.

[0023] Figure 2Middle: (a) Schematic diagram of DNA tetrahedral probes for detecting intracellular circRNA; (b) Detailed schematic diagram of the circular catalytic reaction triggered by circRNA; (c) DNA sequences involved in the circular catalytic reaction and the sequence containing the reverse splicing part on hsa_circ_0000700; (d) Design of probe sequence to ensure the specificity of detection. Only hsa_circ_0000700 can activate fluorescence, while its linear RNA analogs cannot.

[0024] Figure 3 Middle: (a, b) Polyacrylamide gel electrophoresis demonstrated the successful synthesis of the two tetrahedral structures; (c, d) The two tetrahedral structures were observed using a particle size analyzer and atomic force scanning electron microscopy.

[0025] Figure 4 To observe the stability of (a) double-stranded DNA and (b) tetrahedral DNA probes in the presence of 10% fetal bovine serum (FBS). The fluorescence intensity increases when the DNA structure is destroyed by the enzyme in the serum. The sample without FBS was used as a control in the experiment.

[0026] Figure 5 Middle: (a) Schematic diagram of circRNA activation of fluorescence; (b) Fluorescence emission spectra after adding different concentrations of circRNA to the PBS solution of DNA tetrahedron probe (0.1uM); (c) Relationship between fluorescence intensity at 710nm and circRNA concentration. In the concentration range of 0-250nM, the fluorescence intensity is linearly related to the circRNA concentration; (d) Linear RNA analogs of circRNA cannot activate the fluorescence of DNA tetrahedron probe; (e) When 5nM, 10nM, and 20nM linear RNA were added to the PBS solution of DNA tetrahedron probe (0.1uM), the fluorescence spectrum did not change significantly, indicating that linear RNA could not activate fluorescence. In contrast, the fluorescence intensity increased significantly after adding 20nM circRNA; (f) Normalized bar graph of fluorescence intensity at 710nm in figure e.

[0027] Figure 6 Confocal fluorescence imaging of HET-1A cells (human esophageal epithelial cells) and ECA-109 cells (human esophageal cancer cells) after incubation with DNA tetrahedrons for different periods of time. DETAILED DESCRIPTION

[0028] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0029] In order to solve the problems of low sensitivity, poor specificity, and easy degradation of probes in the prior art, the present invention designs a DNA tetrahedron combination based on the entropy increase catalytic cycle reaction combined with DNA tetrahedron, such as Figure 1 As shown, the DNA tetrahedron combination consists of TDN1 and TDN2, wherein:

[0030] The TDN1 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-7;

[0031] The TDN2 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-4 and SEQ ID NO.8.

[0032] SEQ ID NO.1(5′-3′):

[0033]

[0034] SEQ ID NO.2(5′-3′):

[0035]

[0036] (The italic part is complementary to the italic part of SEQ ID NO.1);

[0037] SEQ ID NO.3(5′-3′):

[0038]

[0039] (The double underlined part is complementary to the double underlined part of SEQ ID NO.1, and the dotted underlined part is complementary to the dotted underlined part of SEQ ID NO.2);

[0040] SEQ ID NO.4(5′-3′):

[0041] (The dotted underlined portion is complementary to the dotted underlined portion of SEQ ID NO.3, and the bold line portion is complementary to the bold line portion of SEQ ID NO.2);

[0042] SEQ ID NO.5(5′-3′):

[0043]

[0044] (The lowercase letters are complementary to the lowercase letters of SEQ ID NO.1, the dashed underlined part is complementary to the dashed underlined part of SEQ ID NO.3, and the underlined part is complementary to SEQ ID NO.7);

[0045] SEQ ID NO.6(5′-3′):

[0046] CTCCACTAACTTACGG-BHQ3;

[0047] SEQ ID NO.7(5′-3′):

[0048] CTTAGAGTATCCAAGGGATATGTTGGTGACCGTAAGTTAGTGGAG;

[0049] SEQ ID NO.8(5′-3′):

[0050]

[0051] (The lowercase letter part is complementary to the lowercase letter part of SEQ ID NO.1, the dotted underline part is complementary to the dotted underline part of SEQ ID NO.3, and the wavy line part is the fuel chain).

[0052] Working principle of detecting circular RNA using the DNA tetrahedron combination:

[0053] The entropy increase is used to drive the catalytic cycle reaction system. In this reaction system, three DNA chains are pre-hybridized to form an assembly, which is carried on the first tetrahedron (TDN1). The fuel chain (Fuel chain) is carried on the second tetrahedron (TDN2). SEQ ID NO.8 contains the sequence of the Fuel chain. Since there is no attack site for the Fuel chain on TDN1, TDN1 can coexist with the Fuel chain. The sequence at the end of the three-chain assembly on TDN1 (composed of the underlined sequence of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.5) can be complementary to the sequence of the reverse splicing position on the circular RNA. When circular RNA is present, the circular RNA can replace TDN1 on the Linker chain (i.e., SEQ ID NO.7) as a catalytic chain, and the intermediate formed at this time will have a vacant sequence, i.e., Tolehold 2. Afterwards, the Fuel chain complementarily pairs with Tolehold 2 and extends, releasing the circular RNA, which can then participate in the next cycle, thus achieving the effect of catalytic cycle amplification ( Figure 2 ).

[0054] The following are specific examples. Unless otherwise specified, the raw materials used in the examples are all commercially available products.

[0055] Example 1: Synthesis of target circular RNA

[0056] Circular RNA-hsa_circ_0000700 was selected as the model detection target. hsa_circ_0000700 is a recently discovered circRNA that is highly expressed in cancer cells. It has been reported that the expression of hsa_circ_0000700 in esophageal phosphocarcinoma cells is 5-9 times that in normal esophageal cells, and its high expression is positively correlated with the proliferation and metastasis of cancer cells; here we use a very simple circular RNA synthesis method developed by Professor Liang Xingguo of Ocean University of China in 2020 (refer to the Chinese patent with application publication number CN 111321143A). This method does not require the use of splint chains or auxiliary chains in traditional methods, and there are few macromolecular polymerization byproducts after the ring is formed, and the yield of the target circular RNA can reach more than 90%. The specific synthesis process includes, for the linear RNA sequence to be connected into a ring, first use Mfold software to simulate the secondary structure after the ring is formed, and design the disconnection site according to the secondary structure of the circular RNA; use the designed linear RNA as the raw material and use T4RNA ligase 2 to directly connect.

[0057] The synthesized hsa_circ_0000700 sequence is shown as SEQ ID NO.9.

[0058] SEQ ID NO. 9 (5'-3'): ACTCTAAGACCTGACCCTGATTAAGTGGGCCT ACAAGTGAGAATCTGAAGAACAGCTCTCTGGCTGAACATATCCCTTGGAT.

[0059] Example 2: Synthesis of two DNA tetrahedrons

[0060] Dissolve the DNA single strands in ultrapure water, and accurately quantify the concentration of each DNA single strand that makes up the tetrahedron to 100 μmol / L. Then mix each DNA single strand solution in equal proportions in a buffer solution (10 mM Tris-HCl, 50 mM MgCl2, pH 8.0), and finally the concentration of each DNA single strand is 1 μmol / L. For the synthesis of TDN1, mix SEQ ID NO.1-7 in equal proportions. For the synthesis of TDN2, mix SEQ ID NO.1-4 and SEQ ID NO.8 in equal proportions. After mixing evenly, place in a PCR instrument, keep at 95°C for 5 minutes according to the set program, then quickly cool down and keep at 4°C for 25 minutes to obtain a tetrahedral DNA with a concentration of 1 μmol / L.

[0061] Example 3: Verification of the synthesis of tetrahedral structure using polyacrylamide gel electrophoresis, particle size analyzer and atomic force scanning electron microscope

[0062] In order to determine the design of the tetrahedral structure (TDN), polyacrylamide gel electrophoresis, particle size analyzer and atomic force microscopy were used for characterization. First, the synthesized DNA tetrahedral nanostructure was characterized by polyacrylamide gel electrophoresis. Use TBE buffer to prepare 8% polyacrylamide gel, absorb 5μL of DNA tetrahedron and its control group DNA self-assembly product, add 1μL 6×DNA loading buffer respectively, mix well and load. Electrophoresis was carried out at a constant voltage of 85V for 150min at room temperature, and then the gel imaging system was used to take pictures. Figure 3 As can be seen from a and 3b, as the number of DNA chains constituting the DNA tetrahedron increases, the migration speed becomes slower and slower, indicating the successful folding of the DNA tetrahedron. The preparation method of the control group DNA self-assembly product is similar to the method of preparing the DNA tetrahedron, which can be prepared by mixing equimolar amounts of different sequences and annealing. The control group DNA self-assembly products of TDN1 include ( Figure 3 a): The first is to mix SEQ ID NO.1 and SEQ ID NO.2. The second is to mix SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The third is to mix SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7. The control group DNA self-assembly products of TDN2 include ( Figure 3 b): The first is to mix SEQ ID NO.1 and SEQ ID NO.3. The second is to mix SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. The third is to mix SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.8.

[0063] On the other hand, we used a particle size analyzer and atomic force microscopy (AFM) to characterize the particle size distribution, morphology and monodispersity of TDN1 and TDN2. The particle size analyzer showed that the hydrated diameters of the two tetrahedral structures were both about 13 nm ( Figure 3c and 3d); characterization by atomic force microscopy: DNA tetrahedron (0.1 μM, 2 μL) was taken and dropped onto the surface of a freshly uncovered clean mica sheet. After adsorption for 5 minutes, the surface of the mica sheet was rinsed three times with deionized water and gently dried under nitrogen conditions. Then, a biological fast atomic force microscope was used to scan and image in tapping mode under atmospheric conditions. Both tetrahedral structures were observed and found to be tetrahedral structures with a diameter of about 15 nm.

[0064] Example 4: Investigation of the stability of DNA tetrahedral probes in serum

[0065] First, a double-stranded DNA assembly modified with Cy5.5 and BHQ3 was prepared as a control. The preparation method is to mix SEQ ID NO.6, SEQ ID NO.7 and the underlined sequence of SEQ ID NO.5 in equal proportions in a buffer (10mM Tris-HCl, 50mM MgCl2, pH 8.0), and the final concentration of each DNA single strand is 1μmol / L. After mixing evenly, put it in a PCR instrument, keep it at 95℃ for 5 minutes according to the set program, then quickly cool it down and keep it at 4℃ for 25min, and then obtain a double-stranded DNA assembly with a concentration of 1μmol / L.

[0066] The DNA double-stranded assembly and DNA tetrahedron TDN1 were added to a PBS solution containing 10% fetal bovine serum and incubated at 37°C. The fluorescence intensity of Cy5.5 was collected at different time points. As time went on, the DNA double-stranded was gradually destroyed by the enzymes in the serum, resulting in a continuous increase in the fluorescence intensity. In contrast, the DNA tetrahedron was hardly affected by the serum, and its fluorescence intensity did not change significantly ( Figure 4 ).

[0067] Example 5: Verification of sensitivity and specificity of circRNA detection in PBS

[0068] like Figure 5 As shown in a, hsa_circ_0000700 at different concentrations was added to the mixed solution of TDN1 (100 nM) and TDN2 (100 nM), and the fluorescence spectra were collected after incubation at 37°C for 1 h. We observed that as the concentration of hsa_circ_0000700 added increased, the fluorescence intensity gradually increased ( Figure 5 b, 5c), and the fluorescence intensity was linearly related to the concentration in the range of 0-250pM, Normalized FI = 0.00166 + 0.09466 [circRNA] (R2 = 0.9986). The detection limit was 5pM. When different concentrations of linear RNA were added, the fluorescence intensity hardly changed ( Figure 5 e,5f), indicating that the detection system has good specificity.

[0069] Example 6: Verification that DNA tetrahedron probes can specifically image circRNA in cancer cells

[0070] HET-1A cells (human esophageal epithelial cells) and ECA-109 cells (human esophageal cancer cells) were incubated with DNA tetrahedron probes, and confocal fluorescence imaging was performed after different time periods. As time went on, the fluorescence of the Cy5.5 fluorescence channel of ECA-109 cells gradually increased, indicating that the highly expressed hsa_circ_0000700 in the cells activated the fluorescence of the DNA tetrahedron probe. In contrast, there was no obvious fluorescence in the Cy5.5 fluorescence channel of HET-1A cells, indicating that the DNA tetrahedron probe can specifically image circRNA in cancer cells ( Figure 6 ).

[0071] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0072] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0073] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A DNA tetrahedron assembly, characterized in that: It consists of TDN1 and TDN2, where: The TDN1 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-7; The TDN2 is formed by base complementary pairing of the DNA single strands shown in SEQ ID NO.1-4 and SEQ ID NO.8; The 3′ end of the SEQ ID NO.6 is modified with a fluorescent quenching group, and the 53rd base of the 5′ end of the SEQ ID NO.5 is modified with a fluorescent reporter group.

2. The DNA tetrahedron assembly according to claim 1, characterized in that: The fluorescent reporter group is Cy5.

5.

3. The DNA tetrahedron assembly according to claim 2, characterized in that: The fluorescence quenching group is BHQ3.

4. Use of the DNA tetrahedron combination according to claim 3 in preparing a fluorescent probe, characterized in that: The fluorescent probe is used for diagnosis and / or prognosis of human esophageal cancer.

5. The use according to claim 4, characterized in that: The fluorescent probe was used to image circular RNA hsa_circ_0000700 in human esophageal cancer cells.

Images