Molecular markers for identification and differentiation of three Aquilaria odorifera source plants and their application

Abstract

The present invention relates to the technical field of molecular markers, and in particular to a DNA combination barcode for identifying wood of three woody vines of the genus Dalbergia and its application. The molecular marker of the present invention can be amplified by a primer pair such as the primer pair P1, P3, and P7. The molecular marker of the present invention can be used to effectively identify and distinguish three woody vines of the genus Dalbergia.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to DNA combination bar codes of three Dalbergia woody vine plant woods and an identification method and application thereof. background

[0002] Dalbergia Lf is a genus of the Fabaceae (formerly Papilionaceae), which includes trees, shrubs or woody vines. There are about 269 species in the world, widely distributed in tropical and subtropical regions, of which my country has 29 species, produced in the southwest, south and central China. The wood of most species of Dalbergia Lf is well-known worldwide. It is famous for its exquisite color, texture, excellent hardness, strength and other characteristics, as well as its analgesic, angiogenic, antidiarrheal, antioxidant and diuretic effects, and its application in high-quality products (such as high-end furniture, artworks, musical instruments) and medicinal materials around the world.

[0003] For a long time, Dalbergia arborescens has attracted wide attention for its ability to produce high-quality wood products, while woody vines or climbing shrubs have received less attention. However, its resin-containing wood has been recorded as being used for medicine and incense in ancient China. In recent years, as the market has gradually become active, the term "agarwood" has also been re-examined. The mainstream view on the source plants of agarwood can be defined as woody vines or climbing shrubs of the genus Dalbergia, among which the following three are widely recognized and are given popular names in the industry, such as large-leaf agarwood (Dalbergia benthamii), small-leaf agarwood (Dalbergia pinnata) and ten-acre agarwood (Dalbergia tsoi). The Guangxi Zhuang Autonomous Region local standard "Agarwood Identification Method" (DB 45 / T 1914-2018) uniformly classifies the above three as the source plants of agarwood, and stipulates and describes the macroscopic and microstructural characteristics and thin-layer chromatography characteristics of their resin-containing wood, but it is impossible to accurately identify the species. There are great differences in the performance of agarwood blocks (color, density, texture, etc.), fragrance changes (medicinal fragrance, floral and fruity fragrance, honey fragrance, etc.), and fragrance state (solid, hollow, size, etc.) from different sources of agarwood. Therefore, there are great differences in market recognition, user experience and price in the industry market. Therefore, it is necessary to accurately identify the source plants in order to better regulate and serve the trading market and safeguard the rights and interests of consumers.

[0004] Wood identification technology is of great significance for the rational use and production of wood, combating illegal logging, protecting rare and endangered wood species, regulating market order, and safeguarding consumer rights. Traditional morphological and anatomical identification methods are usually unable to accurately identify wood to the species level, and require the appraiser to have rich knowledge of wood morphology and anatomy and identification experience. In recent years, with the development of molecular genetics, molecular markers and DNA barcode technology have gradually become a tool for species-assisted identification. Some researchers have begun to try to use these molecular biological methods for wood species identification. The identification of several wood species has been achieved using molecular marker technology, proving the feasibility of molecular genetics technology in the field of wood species identification.

[0005] However, since most precious wood samples are dried and stored, or even stored for a long time, the integrity of their DNA is difficult to guarantee. It has been reported that the structure of chromatin, endogenous nucleases, microbial infection, and chemical modification can cause DNA degradation or modification at specific sites, thereby hindering PCR reactions (Paul Brotherton and others, Novel high-resolution characterization of ancient DNA reveals C>U-type base modification events as the sole cause of post mortem miscoding lesions, Nucleic Acids Research, Volume 35, Issue 17, 1 September 2007, Pages 5717–5728; Zhu Yuxian and Li Yi. Modern Molecular Biology [M], 1997). Therefore, it is very important to develop specific molecular markers that can be amplified in wood samples, especially samples that have been dried and stored for a long time, for the identification of precious wood samples. Summary of the invention

[0006] In order to solve the above problems, the present invention develops specific molecular markers that can be amplified in wood samples, especially dry samples that are stored or even stored for a long time.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a molecular marker for identifying and distinguishing Dalbergia benthanmii, Dalbergia pinnata, and Dalbergia tsoi, wherein the molecular marker comprises any one of SEQ ID NO: 19 to SEQ ID NO: 27 or its reverse complementary sequence:

[0009] Dalbergia chinensis SEQ ID NO: 19

[0010] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAATATATATATATTT-----------------------------------------------------------------TTCCTTAATAATTATTTTTATATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTA GAATATTTATAGAAGACTGATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATTCTTTTTATTCTATTTTATTCTTTAAATTATCTTATTTTTTATTCTATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0011] Dalbergia obliquus SEQ ID NO: 20

[0012] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAATATATATATATATGAAATAATATATATCTTTCTATATATAT--CCTTTTTTTCTATAAATATATATATTTTATTCCTTAATAATTATTTTTCTATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTAGAATATTTATAGAAGACTTATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATT-------------------CTTTAAATTATCTTATTTTTATTCTATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0013] Dalbergia tsoi Merr. SEQ ID NO:21

[0014] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAAAATATATATATATGAAATAATATATATCTTTATATATATATATCCTTTTTTTCTATAAATATATATATTTTATTCCTTAATAATTATTTTTCTATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTATAATATTTGTAGAAGACTTATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATT--------------TTATTCTTTAAATTATCTTATTTTTATTCAATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0015] Dalbergia benthami Prain SEQ ID NO:22

[0016] GACAATGGACGCTTTTCTTCTTTTCTTTTTAACTAACTTTTTAACTA------------AAAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATATAATTCTCTATATAATAATTATCTATCTATATAATAATAGATATAATTTTTTCTATATAATATTCTAATAATCCATAGAATATATATATATATATTAATATATATATAGAATTATAGAATATATATAGAATTATAGAATAATCTAATATATTCTAGAAAAATATATATAGATTTCTATAATATAGATTTAAATAAGAATATATTAGATTCAAATAAGAATATATTAATAATCAAATTCAAATTGAATTAAATATTAATAAAATCACTAAAACAAAATACAGAAATTCAAATGAATAATTTTAAAAATTGACTAAATAATTTGTATTCATTCTGAAAAAGAATGATTCGAGTGGAATATAGAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0017] Dalbergia pinnata SEQ ID NO:23

[0018] GACAATGGACGCTTTTCTTCTTTTCTTTTTAACTAACTTTTTAACTAAAAAAGTTAGTTAAAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATATAATTCTCTATATAATAATTATATATCTATATAATAATAGATATCATTTTTTCTATATAATATTCTAATAATCCATAGAAAATATATATATATATTAATATATATATAGAATTCTAGAATATAT----------------------------------------------------------TAGATTAAAATAAGAATATATT--ATTCAAATAAGAATATATTAATAATCAAATTCAAATTGAATTAAATATTAATAAAATCACTAAAACAAAATACAGAAATTCAAATGAATAATTTTAAAAATTGACTAAATAATTTGTATTCATTCTGAAAAAGAATGATTCGAGTGGAATATAGAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0019] Dalbergia tsoi SEQ ID NO:24

[0020] GACAATGGACGCTTTTCTTCTTTTCTTTAACTAACTTTTTAACTAAAAAAGTTAGTTAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATAATCTCTTATAATAATTATTATCT ATATAATAGATATATTTTCTCTATAATAATTCTAATAATCCATAGAAA------------------------------------------------------------------------------------------ -------------------------TAGTTTAAATAAATATATATATATAAATAAATAAATAAAATTAATTAATTAATTAAATTGAATTAAAATTAAAATCACTAACAAAATTAGAAATT CAAATGAATAATTTGAAAAATTGACTAAATTTGTATTCATTCTGAAAAAGAATTCGAGTGGAATATAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0021] SEQ ID NO:25

[0022] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTAAAAAAAAAACGAGAGCAAATTACTAAAAGAATTAATACAAAAAATAAAAAAAATAAGATATATGAAGAAATTCGTCCACCCCCCACATATTTTATAACCTCTCCCATAAAAAAACTTGTAATACCAACTCCATTTGGAATTCCATCAATTACTTGTCTATCAAAAAAATAATTTAGTTTGGCTAATTTTTTTACACTTGCAATTACAGATATTCCATAAAAAGCGTCTATGTAACCACGATTATATGACCAATCATATATGATATTGATTATTTTATCTACAACTTTTTTTTTAGGAACATTTTTTTCAAATAAATTAAGTAAGTTTAAATTTTGTAAAGCAGAATAAACAGGCTTATAGAAAAAAGACGCTATAAATATTCCGAAAAAAGCAAGACCCACCGAAAAAG

[0023] Dalbergia pinnata SEQ ID NO:26

[0024] TATCCTCGTTGTCACAGGCATATGTATTTTTTAAATTATCAGAAACCCAAGTTATTAACATATATAATTTAAGATCTGCTTTTGAAGATCATGGAAAATCCTTTTTTCTTAAGAATGAAATAAAGGATTTTTTTTTTGGAATACACAGACTATTTGATTCTAAATTAAGACAAAAGAAACCTCCCAATTCTGTAATGAATCAATGGAAAAATTGGTTGTTAAAGGGTCATTATCAATATGATTTATCTCAGAGGAGATGGTCTAGATTAGTGCCACAAAAATGGAGAAATAGAATCCATGAGCGTCGTGTCTTTCAAAAAAAATATTTTAAAAAGCGTGATTCATATGAGAAAACCCGATTAATTCTTTACAAAAATAAACAATTAGACTCATTAAAAAAAAAACGAGAGCAGATTACTAAAAGAATTAATACAAAAAATAACAAAAATAAGATATATGAAGAAATTCGTCCACCCCCCACATATTTTATAACCTCTCCCATAAAAAAACTTGTAATACCAACTCCATTTGGAATTCCATCAATTACTTGTCTATCAAAAAAATAATTTAGTTTGGCTAATTTTTTGACACTTGCAATTACAGATATTCCATAAAAAGTGTCTATGTAACCACGATTATATGACCAATCATATATGCTATTGATTATTTTATCGACAACTTTTTTTTTAGGAATATTTTTTTCAAATAAATTAAGTAAGTTTAAATTTTGTAAAGCAGAATAAACAGGCTTATAGAAAAAAGACGCTATAAATATTCCGAAAAAAGCAAGACCCACCGAAAAAG

[0025] Dalbergia tsoi SEQ ID NO:27

[0026] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTAAAAAAAA AACGAGAGCAAATTACTAAAAGAATTAATACAAAAAATAACAAAAATAAGATATATGAAGAAATTCGTCCACCCCCCACATATTTTATAACCTCTCCCATAAAAAAACTTGTAATACCAACTCCATTTGGAATTCCATCAATTACTTGTCTATCAAAAAAATAATTAAGTTTTGGCTAATTTTTTTACACTTGCAATTACAG ATATTCCATAAAAAGCGTCTATGTAACCACGATTATATGACCAATCATATATGATATTGATTATTTTATCTACAACTTTTTTTTTAGGAACATTTTTTTCAAATAAATTAAGTAAGTTTAAATTTTGTAAAGCAGAATAAACAGGCTTAGAAAAAAGACGCTATAAATATTCCGAAAAAAGAAAGACCCACCGAAAAAG

[0027] Note: The dash “-” indicates the gap position in the homologous sequence alignment of two species.

[0028] The present invention uses a high-throughput sequencing method to assemble genome contigs from the whole genome sequences of the three Dalbergia plants, and compares the genome contigs of the three Dalbergia plants. There are multiple Indels with a length of more than 10 bp in the genomes of the three Dalbergia plants, which can be used as molecular markers to identify and distinguish the three Dalbergia plants through conventional PCR and agarose gel electrophoresis, or through first-generation sequencing.

[0029] Primers were further designed for the above Indel sequence so that the above Indel sequence was included in the primer amplification product.

[0030] Fresh wood, air-dried wood and ancient dried wood of the three species of Dalbergia were selected, and PCR was performed using the designed primers. The lengths of the three groups of PCR product fragments and the differences between the three species of Dalbergia were consistent with expectations.

[0031] In another embodiment, any DNA or RNA fragment containing the above molecular marker sequence can be used as an identification molecular marker to identify and distinguish Dalbergia chinensis, Dalbergia obliquus, and Dalbergia rubra.

[0032] In a second aspect, the present invention provides primers for amplifying the above-mentioned molecular markers, wherein the amplification product sequence of the primers contains the above-mentioned molecular marker sequence.

[0033] In a preferred embodiment, the primers of the present invention include primer pairs such as any combination of the following:

[0034] Primer pair P1: P1-F TTGTGCAGAGCTAGGTCTGA, P1-R AGGGAGGGGTCAAACTTATTCT;

[0035] Primer pair P3: P3-F GACAATGGACGCTTTTCTTCTT, P3-R CTTCCAAGCTAACGATGCGG;

[0036] Primer pair P7: P7-F TATCCTCGTTGTCACAGGCA, P7-R CTTTTTCGGTGGGTCTTGCTT;

[0037] In a third aspect, the present invention provides a reagent or a kit containing the above-mentioned primers.

[0038] In a fourth aspect, the present invention provides a method for identifying and distinguishing Dalbergia chinensis, Dalbergia elliottii and Dalbergia rubra, characterized by comprising the following steps:

[0039] 1) Extracting total DNA from samples to be tested;

[0040] 2) sequencing the total DNA to obtain a sequencing sequence;

[0041] 3) aligning the above sequencing sequence to a DNA barcode, wherein the DNA barcode is any one of SEQ ID NO.19 to SEQ ID NO:27 or its reverse complementary sequence;

[0042] 4) Determine the species of the sample based on the coverage of the sequencing reads on the DNA barcode,

[0043] 5) When the sequencing reads can completely match the mismatch or the gap covers any of the aforementioned DNA barcodes, the species to be tested is determined to be the corresponding species.

[0044] In a fifth aspect, the present invention provides another method for identifying and distinguishing Dalbergia chinensis, Dalbergia clitoria and Dalbergia rubra, characterized by comprising the following steps:

[0045] 1) Extracting total DNA from samples to be tested;

[0046] 2) performing PCR on the total DNA of the above samples using the primers described in claim 3 or claim 4;

[0047] 3) performing electrophoresis detection or sequencing on the PCR product and the standard, and determining the species information of the sample to be detected according to the electrophoresis or sequencing results, wherein the standard is a nucleic acid sample comprising any sequence shown in SEQ ID NO: 19 to SEQ ID NO: 27 or its reverse complementary sequence,

[0048] 4) When the length of the PCR product or its sequencing result is consistent with the corresponding species of the aforementioned SEQ ID NO: 19 to SEQ ID NO: 27, the sample to be detected is determined to be the corresponding species.

[0049] In a sixth aspect, the present invention provides any of the following applications of the above-mentioned molecular markers, primers, reagents or kits:

[0050] (1) Application in identifying and distinguishing Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra;

[0051] (2) Application in identification, improvement or molecular marker-assisted breeding of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra germplasm resources in Guangdong and Guangdong;

[0052] (3) Application in screening or creating different varieties of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra;

[0053] (4) Application in the construction of DNA fingerprint databases of Dalbergia edulis, Dalbergia obliquus and Dalbergia rubra;

[0054] (5) Application in the seedling quality inspection of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra.

[0055] In a preferred embodiment, the aforementioned Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra samples are fresh wood.

[0056] In another preferred embodiment, the aforementioned Dalbergia serrata, Dalbergia obliquus and Dalbergia rubra samples are air-dried wood.

[0057] In another preferred embodiment, the aforementioned Dalbergia serrata, Dalbergia obliquus and Dalbergia rubra samples are ancient dried wood.

[0058] The present invention has the following technical effects

[0059] 1. Through multiple combinations of different samples, it was determined that the amplification effects of primer pairs 1, 3, and 7 on fresh, air-dried wood or ancient dried specimens are not random, but because the stability of the corresponding sites is better than other candidate sites, breaking through the excessive reliance on experience, and can use fresh, air-dried wood or ancient dried wood specimens of plants for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time, which is a powerful supplement to traditional species identification.

[0060] 2. The single molecular marker of the present invention can simply and effectively identify and distinguish the species of Dalbergia brevicaulis, Dalbergia clinophylla and Dalbergia rubra through simple electrophoresis detection or first-generation sequencing, providing a guarantee for the identification, planting, resource utilization and breeding of Dalbergia brevicaulis, Dalbergia clinophylla and Dalbergia rubra. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Morphological identification of Dalbergia from Guangdong, Dalbergia oblique-leaf and Dalbergia rubra; AC are the fresh woods of Dalbergia from Guangdong, Dalbergia oblique-leaf and Dalbergia rubra, DF are the air-dried woods of Dalbergia from Guangdong, Dalbergia oblique-leaf and Dalbergia rubra, and GI are the ancient dried woods of Dalbergia from Guangdong, Dalbergia oblique-leaf and Dalbergia rubra.

[0062] Figure 2 This is an electrophoresis image of the PCR products of Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra amplified using three sets of primer pairs; Figure A is the amplification result of primer pair 1, Figure B is the amplification result of primer pair 3, and Figure C is the amplification result of primer pair 7; where M is mark, lanes AC: PCR results of fresh wood, air-dried wood and ancient dried wood of Dalbergia chinensis; lanes DF: PCR results of fresh wood, air-dried wood and ancient dried wood of Dalbergia obliquus; lanes GI are PCR results of fresh wood, air-dried wood and ancient dried wood of Dalbergia rubra amplified.

[0063] Figure 3The amplification results using primer sets P2, P4, P5, P6, P8, and P9 showed no amplified bands. A to C are P2, D to F are P4, G to I are P5, J to L are P6, M to O are P8, and P to R are P9. From left to right, the order is Dalbergia chinensis, Dalbergia obliquus, and Dalbergia rubra.

[0064] Figure 4 It is the comparison result of the first-generation sequencing of the PCR product of primer set P1 with the assembled contigs sequence, where LYHT, XYHT and HGHT represent Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra respectively, contig1 represents the sequence of genome assembly, XX, QG, KG and represent the PCR sequencing results of fresh, air-dried and old wood respectively.

[0065] Figure 5 It is the comparison result of the first-generation sequencing of the PCR product of primer set P3 with the assembled contigs sequence, where LYHT, XYHT and HGHT represent Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, contig2 represents the genome assembled sequence, XX, QG, KG and respectively.

[0066] Figure 6 It is the comparison result of the first-generation sequencing of the PCR product of primer set P7 with the assembled contigs sequence, where LYHT, XYHT and HGHT represent Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, contig3 represents the genome assembled sequence, XX, QG, KG and respectively. DETAILED DESCRIPTION

[0067] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following examples are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0068] The three Dalbergia plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0069] Example 1 Development of three Dalbergia plant-specific molecular markers

[0070] The specific molecular markers for identifying and distinguishing the three Dalbergia species were obtained by the following steps:

[0071] 1) Collect three species of Dalbergia plant materials, Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, fresh materials collected from Jianfengling area of ​​Hainan Province;

[0072] 2) Extraction of total DNA from three species of Dalbergia plants;

[0073] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0074] 4) The genomes of three Dalbergia species were assembled separately to obtain genome contigs sequences.

[0075] 5) The genomic contigs of the three Dalbergia species were compared, and Indels longer than 10 bp were selected as candidate molecular markers for identifying and distinguishing the three Dalbergia species.

[0076] Example 2 Primer design of three Dalbergia plant-specific molecular markers

[0077] According to the comparison results in Example 2, combined with the corresponding contigs sequences, multiple pairs of PCR primers for identifying three species of Dalbergia plants were designed using Geneious software. The primer sequences are as follows:

[0078]

[0079]

[0080] Example 3 DNA Identification of Fresh Wood Samples of Dalbergia edulis, Dalbergia obliquus and Dalbergia rubrum

[0081] 1) Dalbergia dasyphylla, Dalbergia obliquus and Dalbergia rubra were collected from fresh wood from Jianfengling, Hainan Province and identified by plant morphology experts (see Figure 1 A, B, C);

[0082] 2) Randomly select some wood samples and cut off the outer surface of the wood samples using a scalpel blade disinfected with 70% alcohol to avoid exogenous contamination;

[0083] 3) Cut the wood sample into several wood chips, place them on ice, put them into a low-temperature grinder and grind them for 5 minutes at a frequency of 10 cps; after grinding, pass them through a 200-mesh sieve, and dispense 0.5 g of fine wood powder into several 50 ml centrifuge tubes. The excess is stored in a -80°C low-temperature refrigerator for later use.

[0084] 4) Extract the total DNA of the sample to be tested:

[0085] 4.1 Add 10 ml of CTAB extraction buffer, 0.2 g of PVP, 200 μl of 2% β-mercaptoethanol, 20 μl of proteinase K, and 350 μl of 20% SDS to the centrifuge tube, mix well, and place in a water bath at 60°C for 2 h;

[0086] 4.2 Remove the sample and cool it to room temperature, add equal amounts of chloroform:isoamyl alcohol (24:1), mix for 5 minutes, and centrifuge at 14000 rpm for 15 minutes;

[0087] 4.3 Take the supernatant, add 10% CTAB 1400μl and 5M NaCl 2800μl, mix well, add chloroform:isoamyl alcohol (24:1) 6000μl, mix well for 5 minutes, and centrifuge at 14000rpm for 15 minutes;

[0088] 4.4 Take the supernatant and add an equal volume of pre-cooled isopropanol to precipitate DNA at -20°C overnight. Centrifuge for 10 minutes and discard the supernatant. Elute the precipitate 2-3 times with 75% ethanol; dry it and dissolve it with 20μl TE solution to obtain the template DNA.

[0089] 5) using the primers designed in Example 2, PCR was performed on the total DNA of the above samples respectively;

[0090] 6) Use P1, P3, and P7 primer pairs for PCR amplification. The PCR reaction conditions are: 1 cycle of DNA pre-denaturation (94°C, 3 min), 35 cycles of amplification (94°C, 30 s; 56.5°C, 30 s; 72°C, 1 min) and 1 cycle of extension (72°C, 5 min) to obtain the amplified DNA target fragment.

[0091] 7) Electrophoresis detection of PCR amplification products:

[0092] The PCR products were detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under a gel imaging system, and the main bands were clear.

[0093] From the electropherogram ( Figure 2 ) It can be seen that the length of the PCR product fragments of primer pairs 1, 3, and 7 and the differences between the three species of Dalbergia are consistent with expectations, and other primers cannot amplify bands ( Figure 3 ).

[0094] 8) First-generation sequencing of PCR amplification products:

[0095] The PCR products were subjected to first-generation Sanger sequencing, and the sequencing results were compared with the assembled contigs for multiple sequence alignment. Figure 4-Figure 6 .

[0096] The comparison results show that the sequences of the amplified products of the three pairs of primers in the three species are consistent with expectations, and any pair of primers can distinguish the three species of Dalbergia.

[0097] It can be seen that the aforementioned molecular markers and corresponding primers can be used for conventional PCR gel electrophoresis or first-generation sequencing to achieve simple and effective identification and differentiation of the three Dalbergia species.

[0098] The PCR sequencing results of primer set P1 are as follows:

[0099] Dalbergia chinensis SEQ ID NO: 19

[0100] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAATATATATATATTT-----------------------------------------------------------------TTCCTTAATAATTATTTTTATATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTA GAATATTTATAGAAGACTGATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATTCTTTTTATTCTATTTTATTCTTTAAATTATCTTATTTTTTATTCTATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0101] Dalbergia obliquus SEQ ID NO: 20

[0102] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAATATATATATATATGAAATAATATATATCTTTCTATATATAT--CCTTTTTTTCTATAAATATATATATTTTATTCCTTAATAATTATTTTTCTATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTAGAATATTTATAGAAGACTTATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATT-------------------CTTTAAATTATCTTATTTTTATTCTATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0103] Dalbergia tsoi SEQ ID NO:21

[0104] TTGTGCAGAGCTAGGTCTGATACTCTGTTAGGCGTAATTCGAAAGAAAGTCAAAATATATCAAAATATATATATATGAAATAATATATATCTTTATATATATATATCCTTTTTTTCTATAAATATATATATTTTATTCCTTAATAATTATTTTTCTATTAATCTAGTAATAGTTCCATTAATACTTCCATAAGTATTAATGGAATAGTATTTTATAATATTTGTAGAAGACTTATTAGAATAGATTACTCAGTATTGAATATTCAAATTATTCTATTTTATT--------------TTATTCTTTAAATTATCTTATTTTTATTCAATTTTTAGATTGTTTTTTTTAGTTTTACAATATACCATAACAATATACCATATAAGTATAAGATAGAAGATATTTCCAATAGAATAAGTTTGACCCCTCCCT

[0105] The PCR sequencing results of primer set P3 are as follows:

[0106] Dalbergia benthami Hance SEQ ID NO:22

[0107] GACAATGGACGCTTTTCTTCTTTTCTTTTTAACTAACTTTTTAACTA------------AAAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATATAATTCTCTATATAATAATTATCTATCTATATAATAATAGATATAATTTTTTCTATATAATATTCTAATAATCCATAGAATATATATATATATATTAATATATATATAGAATTATAGAATATATATAGAATTATAGAATAATCTAATATATTCTAGAAAAATATATATAGATTTCTATAATATAGATTTAAATAAGAATATATTAGATTCAAATAAGAATATATTAATAATCAAATTCAAATTGAATTAAATATTAATAAAATCACTAAAACAAAATACAGAAATTCAAATGAATAATTTTAAAAATTGACTAAATAATTTGTATTCATTCTGAAAAAGAATGATTCGAGTGGAATATAGAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0108] Dalbergia pinnata (Lour.) Prain SEQ ID NO:23

[0109] GACAATGGACGCTTTTCTTCTTTTCTTTTTAACTAACTTTTTAACTAAAAAAGTTAGTTAAAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATATAATTCTCTATATAATAATTATATATCTATATAATAATAGATATCATTTTTTCTATATAATATTCTAATAATCCATAGAAAATATATATATATATTAATATATATATAGAATTCTAGAATATAT----------------------------------------------------------TAGATTAAAATAAGAATATATT--ATTCAAATAAGAATATATTAATAATCAAATTCAAATTGAATTAAATATTAATAAAATCACTAAAACAAAATACAGAAATTCAAATGAATAATTTTAAAAATTGACTAAATAATTTGTATTCATTCTGAAAAAGAATGATTCGAGTGGAATATAGAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0110] Dalbergia tsoi SEQ ID NO:24

[0111] GACAATGGACGCTTTTCTTCTTCTTTTTAACTAACTTTTTAACTAAAAAAGTTAGTTAAAAAGTTAGTTAAAAAGACGAATTCTACTATATCATAATATAATTCTCTATAATAATAATTATATCTATATAATAATAGATATAATTTTTTCTATATAATATTCTAATAATCCATAGAAA---------------------------------ATATATATAGATTTCTATAATA------------------------------------------------ -------------------TAGATTTAAATAAGAATATATTAGATTAAAATAAGAATATATTAATAATCAAATTCAAATTGAATTAAATATTAATAAAATCACTAAAACAAAATACAGAAATTCAAATGAATAATTTGAAAAATTGACTAAATAATTTGTATTCATTCTGAAAAAGAATGATTCGAGTGGAATATAGAGATAGGAAAAAAGAGCGGGTAGCGGGAATCGAACCCGCATCGTTAGCTTGGAAG

[0112] The PCR sequencing results of primer set P7 are as follows:

[0113] Dalbergia chinensis SEQ ID NO: 25 (genome assembly sequence)

[0114] --------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------AATTAAAAAAAA AACGAGAGCAAATTACTAAGAATTAATACAAAAAATAAAAAATAAGATATGAAAATTCGTCCACCCCCACATATTTTATAACCTCTCCCCATAAAAAACTTGTAATACCATCCATTTGGAATTCCAATTATCTTGTCTATCAAAAAATATTTAGTTTGGCTAATTTTTCATTCATTCATTCATTCATT ATTATTCCATAAAAAGCGTCTATGTAACCACGATTATGACCAATCATATGATATTGATTTTTATCTACAACTTTTTTTAGGAACATTTTTTCAAATAAAATTAAGTTTAAATTTTGTAAAGCAGAATAACAGGCTTATAGAAAAAAGACGCTATAATTATTGAAAAAAGCAAGCAAGCCAAAG

[0115] SEQ ID NO:26(PCR)

[0116] TATCCTCGTTGTCACAGGCATATGTATTTTTTAAATTATCAGAAACCCAAGTTATTAACATATATAATTTAAGATCTGCTTTTGAAGATCATGGAAAATCCTTTTTTCTTAAGAATGAAATAAAGGATTTTTTTTTTGGAATACACAGACTATTTGATTCTAAATTAAGACAAAAGAAACCTCCCAATTCTGTAATGAATCAATGGAAAAATTGGTTGTTAAAGGGTCATTATCAATATGATTTATCTCAGAGGAGATGGTCTAGATTAGTGCCACAAAAATGGAGAAATAGAATCCATGAGCGTCGTGTCTTTCAAAAAAAATATTTTAAAAAGCGTGATTCATATGAGAAAACCCGATTAATTCTTTACAAAAATAAACAATTAGACTCATTAAAAAAAAAACGAGAGCAGATTACTAAAAGAATTAATACAAAAAATAACAAAAATAAGATATATGAAGAAATTCGTCCACCCCCCACATATTTTATAACCTCTCCCATAAAAAAACTTGTAATACCAACTCCATTTGGAATTCCATCAATTACTTGTCTATCAAAAAAATAATTTAGTTTGGCTAATTTTTTGACACTTGCAATTACAGATATTCCATAAAAAGTGTCTATGTAACCACGATTATATGACCAATCATATATGCTATTGATTATTTTATCGACAACTTTTTTTTTAGGAATATTTTTTTCAAATAAATTAAGTAAGTTTAAATTTTGTAAAGCAGAATAAACAGGCTTATAGAAAAAAGACGCTATAAATATTCCGAAAAAAGCAAGACCCACCGAAAAAG

[0117] Dalbergia tsoi SEQ ID NO:27 (Genomic assembly sequence)

[0118] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ AACGAGAGCAAATTACTAAAAGAATTAATACAAAAAATAACAAAAATAAGATATATGAAGAAATTCGTCCACCCCCCACATATTTTATAACCTCTCCCATAAAAAAACTTGTAATACCAACTCCATTTGGAATTCCATCAATTACTTGTCTATCAAAAAAATAATTAAGTTTTGGCTAATTTTTTTACACTTGCAATTACAG ATATTCCATAAAAAGCGTCTATGTAACCACGATTATATGACCAATCATATATGATATTGATTATTTTATCTACAACTTTTTTTTTAGGAACATTTTTTTCAAATAAATTAAGTAAGTTTAAATTTTGTAAAGCAGAATAAACAGGCTTAGAAAAAAGACGCTATAAATATTCCGAAAAAAGAAAGACCCACCGAAAAAG

[0119] Note: The dash “-” indicates the gap position in the homologous sequence alignment of two species.

[0120] Example 4 DNA Identification of Dalbergia odorifera, Dalbergia obliquus and Dalbergia rubra Dalbergia rubra Dalbergia rubra

[0121] 1) Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra were derived from air-dried wood from Hainan Province and other places; they were identified by plant morphology experts (see Figure 1D, E, F);

[0122] 2) Randomly select some wood samples and cut off the outer surface of the wood samples using a scalpel blade disinfected with 70% alcohol to avoid exogenous contamination;

[0123] 2) Cut the wood sample into several wood chips, place them on ice, put them into a low-temperature grinder and grind them for 5 minutes at a frequency of 10 cps; after grinding, pass them through a 200-mesh sieve, and dispense 0.5 g of fine wood powder into several 50 ml centrifuge tubes. The excess is stored in a -80°C low-temperature refrigerator for later use.

[0124] 3) Add 10 ml of CTAB extraction buffer, 0.2 g of PVP, 200 μl of 2% β-mercaptoethanol, 20 μl of proteinase K, and 350 μl of 20% SDS to the centrifuge tube, mix well, and place in a water bath at 60°C for 2 h;

[0125] 4) Extract the total DNA of the sample to be tested:

[0126] 4.1 Add 10 ml of CTAB extraction buffer, 0.2 g of PVP, 200 μl of 2% β-mercaptoethanol, 20 μl of proteinase K, and 350 μl of 20% SDS to the centrifuge tube, mix well, and place in a water bath at 60°C for 2 h;

[0127] 4.2 Remove the sample and cool it to room temperature, add equal amounts of chloroform:isoamyl alcohol (24:1), mix for 5 minutes, and centrifuge at 14000 rpm for 15 minutes;

[0128] 4.3 Take the supernatant, add 10% CTAB 1400μl and 5M NaCl 2800μl, mix well, add chloroform:isoamyl alcohol (24:1) 6000μl, mix well for 5 minutes, and centrifuge at 14000rpm for 15 minutes;

[0129] 4.4 Take the supernatant and add an equal volume of pre-cooled isopropanol to precipitate DNA at -20°C overnight. Centrifuge for 10 minutes and discard the supernatant. Elute the precipitate 2-3 times with 75% ethanol; dry it and dissolve it with 20μl TE solution to obtain the template DNA.

[0130] 5) using the primers designed in Example 2, PCR was performed on the total DNA of the above samples respectively;

[0131] 6) Use P1, P3, and P7 primer pairs for PCR amplification. The PCR reaction conditions are: 1 cycle of DNA pre-denaturation (94°C, 3 min), 35 cycles of amplification (94°C, 30 s; 56.5°C, 30 s; 72°C, 1 min) and 1 cycle of extension (72°C, 5 min) to obtain the amplified DNA target fragment.

[0132] 7) Electrophoresis detection of PCR amplification products:

[0133] The PCR products were detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under a gel imaging system, and the main bands were clear.

[0134] From the electropherogram ( Figure 2 ) It can be seen that the length of the PCR product fragments of primer pairs 1, 3, and 7 and the differences between the three species of Dalbergia are consistent with expectations, and other primers cannot amplify bands ( Figure 3 ).

[0135] 8) First-generation sequencing of PCR amplification products:

[0136] The PCR products were subjected to first-generation Sanger sequencing, and the sequencing results were compared with the assembled contigs for multiple sequence alignment. Figure 4-Figure 6 .

[0137] The comparison results show that the sequences of the amplified products of the three pairs of primers in the three species are consistent with expectations, and any pair of primers can distinguish the three species of Dalbergia.

[0138] It can be seen that the aforementioned molecular markers and corresponding primers can be used for conventional PCR gel electrophoresis or first-generation sequencing to achieve simple and effective identification and differentiation of the three types of Dalbergia.

[0139] Example 4 DNA Identification of Ancient Wood Samples of Dalbergia odoratum, Dalbergia obliquus and Dalbergia rubra

[0140] 1) Dalbergia dasyphylla, Dalbergia obliquus and Dalbergia rubra were derived from ancient dry wood (preserved at least 10 years ago) from Hainan Province and other places; they were identified by plant morphology experts (see Figure 1 D, E, F);

[0141] 2) Randomly select some wood samples and cut off the outer surface of the wood samples using a scalpel blade disinfected with 70% alcohol to avoid exogenous contamination;

[0142] 2) Cut the wood sample into several wood chips, place them on ice, put them into a low-temperature grinder and grind them for 5 minutes at a frequency of 10 cps; after grinding, pass them through a 200-mesh sieve, and dispense 0.5 g of fine wood powder into several 50 ml centrifuge tubes. The excess is stored in a -80°C low-temperature refrigerator for later use.

[0143] 3) Add 10 ml of CTAB extraction buffer, 0.2 g of PVP, 200 μl of 2% β-mercaptoethanol, 20 μl of proteinase K, and 350 μl of 20% SDS to the centrifuge tube, mix well, and place in a water bath at 60°C for 2 h;

[0144] 4) Extract the total DNA of the sample to be tested:

[0145] 4.1 Add 10 ml of CTAB extraction buffer, 0.2 g of PVP, 200 μl of 2% β-mercaptoethanol, 20 μl of proteinase K, and 350 μl of 20% SDS to the centrifuge tube, mix well, and place in a water bath at 60°C for 2 h;

[0146] 4.2 Remove the sample and cool it to room temperature, add equal amounts of chloroform:isoamyl alcohol (24:1), mix for 5 minutes, and centrifuge at 14000 rpm for 15 minutes;

[0147] 4.3 Take the supernatant, add 10% CTAB 1400μl and 5M NaCl 2800μl, mix well, add chloroform:isoamyl alcohol (24:1) 6000μl, mix well for 5 minutes, and centrifuge at 14000rpm for 15 minutes;

[0148] 4.4 Take the supernatant and add an equal volume of pre-cooled isopropanol to precipitate DNA at -20°C overnight. Centrifuge for 10 minutes and discard the supernatant. Elute the precipitate 2-3 times with 75% ethanol; dry it and dissolve it with 20μl TE solution to obtain the template DNA.

[0149] 5) using the primers designed in Example 2, PCR was performed on the total DNA of the above samples respectively;

[0150] 6) Use P1, P3, and P7 primer pairs for PCR amplification. The PCR reaction conditions are: 1 cycle of DNA pre-denaturation (94°C, 3 min), 35 cycles of amplification (94°C, 30 s; 56.5°C, 30 s; 72°C, 1 min) and 1 cycle of extension (72°C, 5 min) to obtain the amplified DNA target fragment.

[0151] 7) Electrophoresis detection of PCR amplification products:

[0152] The PCR products were detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under a gel imaging system, and the main bands were clear.

[0153] From the electropherogram ( Figure 2 ) It can be seen that the length of the PCR product fragments of primer pairs 1, 3, and 7 and the differences between the three species of Dalbergia are consistent with expectations, and other primers cannot amplify bands ( Figure 3 ).

[0154] 8) First-generation sequencing of PCR amplification products:

[0155] The PCR products were subjected to first-generation Sanger sequencing, and the sequencing results were compared with the assembled contigs for multiple sequence alignment. Figure 4-Figure 6 .

[0156] The comparison results show that the sequences of the amplified products of the three pairs of primers in the three species are consistent with expectations, and any pair of primers can distinguish the three species of Dalbergia.

[0157] It can be seen that the aforementioned molecular markers and corresponding primers can be used for conventional PCR gel electrophoresis or first-generation sequencing to achieve simple and effective identification and differentiation of the three Dalbergia species.

[0158] In summary, the amplification effects of primer pairs P1, P3, and P7 determined by multiple primer combinations of different samples are not random, but are due to the stability of the corresponding sites being better than other candidate sites. Therefore, the sample identification process of the present invention is effective, can be automated and standardized, breaks through the excessive reliance on experience, and can use fresh, dried or archaeological specimens of plants for rapid and effective identification. It can establish an easy-to-use application system in a relatively short period of time, and is a powerful supplement to traditional species identification. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogenetic research of Dalbergia species, as well as the protection and utilization of Dalbergia resources.

[0159] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A method for identifying and distinguishing Dalbergia odorifera from Guangdong Dalbergia benthamii )、Dalbergia obliquus( Dalbergia pinnata ) and Dalbergia rubra ( Dalbergia tsoi ), characterized in that The molecular marker group is three nucleic acid fragments whose sequences are shown as SEQ ID NO:19 to SEQ ID NO:21, among which SEQ ID NO:19 is a genomic molecular marker of Dalbergia chinensis, SEQ ID NO:20 is a genomic molecular marker of Dalbergia obliquus, and SEQ ID NO:21 is a genomic molecular marker of Dalbergia rubra.

2. A kit for identifying and distinguishing Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, characterized in that: Containing the molecular marker group according to claim 1.

3. The kit of claim 2, further comprising a primer pair, which is a primer pair capable of amplifying the molecular marker group of claim 1 in the genomes of Dalbergia glutinosae, Dalbergia obliquus and Dalbergia rubra, and the primer pair comprises the following primers: P1-FTTGTGCAGAGCTAGGTCTGA, P1-R AGGGAGGGGTCAAACTTATTCT.

4. A method for identifying and distinguishing Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, characterized in that The following steps are involved: 1) Extract the total DNA of the sample to be tested; 2) Sequencing the above total DNA to obtain a sequencing sequence; 3) aligning the above sequencing sequence to the molecular marker set of claim 1; 4) Determine the species of the sample based on the coverage of the sequencing reads on the molecular marker group; 5) When the sequencing reads can completely cover any molecular marker in the molecular marker group of claim 1 without mismatch or gap, the species to be tested is determined to be the corresponding species.

5. A method for identifying and distinguishing Dalbergia chinensis, Dalbergia obliquus and Dalbergia rubra, characterized in that The following steps are involved: 1) Extract the total DNA of the sample to be tested; 2) performing PCR on the total DNA of the above samples using the primers described in claim 3; 3) Performing electrophoresis detection or sequencing on the PCR products and the standard substance, and determining the species information of the sample to be detected according to the electrophoresis or sequencing results, wherein the standard substance is the molecular marker set according to claim 1; 4) When the length of the PCR product or its sequencing result is consistent with the species corresponding to the molecular marker group according to claim 1, the sample to be detected is judged to be the species corresponding to the molecular marker.

6. Any of the following uses of the molecular marker panel according to claim 1 or the kit according to claim 2 or 3: (1) Application in identifying and distinguishing Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra; (2) Application in identification, improvement or molecular marker-assisted breeding of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra germplasm resources in Guangdong and Guangdong; (3) Application in the screening or creation of varieties of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra; (4) Application in the construction of DNA fingerprint databases of Dalbergia edulis, Dalbergia obliquus and Dalbergia rubra; (5) Application in the seedling quality inspection of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra.

7. Any of the following applications of the method according to any one of claims 4 to 5: (1) Application in identifying and distinguishing Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra; (2) Application in identification, improvement or molecular marker-assisted breeding of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra germplasm resources in Guangdong and Guangdong; (3) Application in the screening or creation of varieties of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra; (4) Application in the construction of DNA fingerprint databases of Dalbergia edulis, Dalbergia obliquus and Dalbergia rubra; (5) Application in the seedling quality inspection of Dalbergia ovata, Dalbergia obliquus and Dalbergia rubra.

Images