Species-specific molecular targets of Bacteroides doreae and their rapid detection methods
Through molecular target mining and PCR amplification technology based on whole genome sequencing, the rapid, accurate and quantitative problems of Bacteroides dormant detection are solved, and a simple and efficient detection method is achieved, which is suitable for Bacteroides dormant identification and quantification of food and feces samples.
Patent Information
- Application Number
- CN202311640225.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2043-12-04
AI Technical Summary
The prior art is difficult to detect and quantify Bacteroides dorsi quickly and accurately, and the operation is cumbersome and costly, and cannot meet the needs of probiotic product development.
Based on the whole genome sequencing information of Bacteroides dorsi, strain-specific molecular targets were excavated, and specific primers were designed, and detection was performed using PCR amplification technology, including PCR and qPCR methods, to achieve rapid and sensitive qualitative and quantitative analysis.
It realizes rapid and accurate detection and quantification of Bacteroides dorsi, simplifies the operation process, reduces costs, is suitable for a variety of complex samples, with high sensitivity and wide application.
Smart Images
Figure CN117701742B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbial testing, and in particular relates to a species-specific molecular target of Bacteroides dornoni and a rapid detection method thereof. Background Art
[0002] Bacteroides are a group of rod-shaped, non-spore-forming, bile-tolerant, Gram-negative, strictly anaerobic bacteria. The primary byproducts of their anaerobic respiration are acetic acid, isovaleric acid, and succinic acid. As a keystone genus in the human gut, Bacteroides comprise approximately 25% of the human gut microbiome. They form a stable symbiotic relationship with humans, fermenting carbohydrates to produce short-chain fatty acids that are beneficial to human health, helping to regulate the intestinal microenvironment and maintain intestinal physiological function. Bacteroides participate in many important metabolic activities in the human colon. In addition to fermenting carbohydrates, they also utilize nitrogenous substances and carry out the biotransformation of bile acids and other steroids. Bacteroides are closely linked to human health, playing important roles in regulating the human immune system, increasing bone mineral density, and producing the inhibitory neurotransmitter gamma-aminobutyric acid. Their reduction is associated with a variety of diseases, including coronary artery disease and inflammatory bowel disease. Notably, some Bacteroides may carry toxin-encoding genes, producing toxins that can cause symptoms such as diarrhea in the host. Furthermore, when Bacteroides reach other parts of the body beyond the intestine, they can cause infections in the central nervous system, skin, and soft tissues. Bacteroides dorei was originally isolated from human feces by Bakir et al. and was later reported to effectively convert cholesterol into coprostanol, thereby preventing cardiovascular disease caused by a high-fat diet. Studies have shown that the abundance of Bacteroides dorei is significantly reduced in patients with coronary artery disease. Furthermore, Bacteroides dorei has been shown to exert anti-influenza effects by promoting early interferon expression and downregulating local and systemic inflammatory responses, highlighting the significant benefits of Bacteroides dorei for human health. In recent years, the field of probiotic research has experienced unprecedented growth, with first-generation probiotics such as Bifidobacteria and Lactobacilli widely used in the prevention and adjuvant treatment of human diseases. Bacteroides species, represented by Bacteroides fragilis and Bacteroides dorei, which are beneficial to human health, have the potential to become the mainstay of second-generation probiotics due to their unique physiological activities and the advantage of originating from the human gut, thereby playing a role in preventing and alleviating disease. Therefore, accurate and sensitive detection of Bacteroides dorei and quantitative analysis of Bacteroides dorei are of great significance for the development of probiotic products.
[0003] Currently, the main methods for detecting Bacteroidetes include morphological testing, biochemical testing, or mass spectrometry after isolation and culture. These methods require anaerobic enrichment and selective culture of the sample to obtain a single colony, followed by microscopic observation, biochemical identification, or on-site testing. These experiments are cumbersome, time-consuming, and costly, and cannot perform quantitative analysis. With the rapid development of molecular biology in recent years, nucleic acid amplification-based detection methods have been established, offering significant advantages in detection time, specificity, and sensitivity. PCR-based molecular biology detection methods have gradually replaced traditional culture and biochemical detection methods, becoming one of the most promising new technologies in microbial detection. The key to nucleic acid detection methods lies in the selection of target genes or target sequences, that is, identifying nucleotide sequences unique to the target species for assay design. Thanks to the development of whole-genome sequencing technology for microorganisms, specific molecular detection targets can be obtained based on whole-genome sequence comparison and analysis, enabling the development of simple, rapid, economical, efficient, and highly sensitive PCR-based identification techniques. Summary of the Invention
[0004] In order to overcome the above-mentioned deficiencies in the prior art, the present invention aims to provide species-specific molecular targets for detecting and identifying Bacteroides dornoni and corresponding detection methods, which can distinguish Bacteroides dornoni from Bacteroides and other microorganisms.
[0005] To achieve the above object, the technical solution adopted by the present invention is:
[0006] A specific detection molecular target for detecting Bacteroides dornoni, wherein the Bacteroides dornoni molecular target has a nucleotide sequence as shown in SEQ ID NO.1.
[0007] The present invention also provides a set of primers for detecting Bacteroides doreae-specific molecular targets, wherein the primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.
[0008] The present invention also provides a kit for detecting Bacteroides dornoni, which comprises the above-mentioned primers for detecting specific molecular targets of Bacteroides dornoni.
[0009] The present invention also provides the use of the above-mentioned Bacteroides dornoni specific molecular target, primers for detecting Bacteroides dornoni or kit in detecting Bacteroides dornoni.
[0010] The present invention also provides a method for detecting Bacteroides dornoni for purposes other than disease diagnosis and treatment, comprising the following steps:
[0011] The DNA of the microorganism in the sample to be tested was extracted and PCR amplified using the primers for detecting Bacteroides dornoni. The amplified product was subjected to gel electrophoresis. If a band of 193 bp was obtained, it was determined that Bacteroides dornoni was detected in the sample. If no band of 193 bp was obtained, it was determined that Bacteroides dornoni was not detected in the sample.
[0012] Preferably, the PCR amplification system is 25 μL, which includes: 12.5 μL of 2×Dream Taq Green PCR MasterMix, 0.5 μL each of 10 μmol / L forward primer and reverse primer, 1 μL of DNA template, and 10.5 μL of sterile double-distilled water.
[0013] Preferably, the PCR reaction procedure is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s, for a total of 34 cycles; and extension at 72°C for 5 min.
[0014] The present invention also provides a qPCR detection method for quantitatively detecting Bacteroides dornoni for non-disease diagnosis and treatment purposes, comprising the following steps:
[0015] (1) using the primers for detecting Bacteroides dornonisi to draw a standard curve;
[0016] (2) The sample was amplified by qPCR using the primers for detecting Bacteroides dornoni. The Ct value of the sample was obtained, and the content of Bacteroides dornoni in the sample was calculated according to the standard curve.
[0017] Preferably, the qPCR amplification system is 20 μL, which includes: 10 μL of 2×TB Green Premix EX TaqⅡ, 0.2 μL each of 10 μmol / L forward primer and reverse primer, 7.6 μL of sterile double-distilled water, and 2 μL of the DNA solution to be tested.
[0018] Preferably, the qPCR reaction procedure is a two-step PCR reaction procedure: preheating at 95°C for 30s; denaturation at 95°C for 5s, and annealing at 68°C for 30s, for a total of 45 cycles.
[0019] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0020] (1) Based on the whole genome sequencing information of Bacteroides dornoni, the present invention mines the species-specific molecular targets of Bacteroides dornoni through pan-genome analysis and verifies them using PCR amplification technology. The results are accurate and reliable.
[0021] (2) The detection method of Bacteroides multiflorus provided by the present invention does not require steps such as microbial culture, and has the characteristics of simple operation, rapid economy, high efficiency and sensitivity, and can be applied to a variety of complex samples.
[0022] (3) The detection method of Bacteroides dornoni provided by the present invention can be both qualitative and quantitative, and has a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This figure shows the rapid detection of Bacteroides dornoni and 24 other microbial strains using the Bacteroides dornoni species-specific molecular target of the present invention. When specific primers are used to detect Bacteroides dornoni (strain number 1), a bright band appears at 193 bp. However, when specific primers are used to detect 24 non-Bacteroides dornoni strains, no band at 193 bp is detected. The lane marked M in the figure is the DL2000 DNA Marker lane, and the lane marked C is the blank control.
[0024] Figure 2 This figure shows the rapid detection of Bacteroides donovani in a food-based detection model using the Bacteroides donovani species-specific molecular target of the present invention. A, B, and C correspond to three food systems: mineral water, milk, and a 10% okara suspension. The results indicate that the amplification products in the positive groups all exhibited a bright band at 193 bp, while the negative groups did not exhibit this band.
[0025] Figure 3 For the quantitative detection of samples containing Bacteroides dornoni, the qPCR detection method provided by the present invention is used to quantitatively detect samples containing Bacteroides dornoni: the numbers 1, 2, 3, 4, 5, 6, 7, and 8 in the legend of Figure A represent the concentrations of 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The amplification curve of qPCR detection was performed after DNA was extracted from the bacterial solution with a bacterial DNA extraction kit. Result A indicated that when the concentration of Bacteroides multilocus in the sample was ≥1×10 1 CFU / mL, a stable fluorescence signal can be detected in the sample; B results indicate that the present invention has a good effect on the quantitative detection of bacterial liquid samples containing different concentrations of Bacteroides dobromites, and the fitting degree of the standard curve is high. DETAILED DESCRIPTION
[0026] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0027] Example 1. Mining of species-specific molecular targets of Bacteroides doreae
[0028] The whole-genome sequences used for screening Bacteroides dorei-specific molecular targets were obtained from strain genome sequences in the public database (https: / / www.ncbi.nlm.nih.gov / ). Whole-genome data from 10 Bacteroides dorei strains and 20 other Bacteroides strains were selected for pan-genome analysis using Roary v3.11.2. A 99% threshold was used for the core genome of each strain, and a BLASTP homology threshold was set at 95%. Genes that were 100% present in all Bacteroides dorei and related Bacterium strains were selected, meaning they belonged to the core genome but could be separated at the 95% homology threshold. The selected core genes were further aligned using local BLAST to identify conserved genes containing specific molecular targets. These genes were then verified using NCBI database BLAST. After PCR amplification and verification, the nucleotide sequence of the Bacteroides dorei species-specific molecular target was obtained as shown in SEQ ID NO. 1.
[0029] The nucleotide sequence of the Bacteroides doreae species-specific molecular target is shown in SEQ ID NO. 1, and the specific sequence is as follows: CGGCTGCGCGAAATGGGATTCATCCTGACTCTCAATACGAACGGCACACTCATCGACAACGAAATGGTACGCA TCTTGCAGACCCACAAGCCGCGGCGGATAAACGTCACCCTGTATGGAGACAGCAGAGAAACTTACGGACGCTTGTG CCACAATCCGCAAGGATACACCCTGTGCATGGAAGCCCTGAA AC.
[0030] Example 2. Establishment of a rapid detection method for Bacteroides doreae species-specific molecular targets
[0031] (1) This embodiment provides a method for detecting Bacteroides doxorubicin, and the specific operation is as follows:
[0032] A pair of specific amplification primers were designed based on the sequence SEQ ID NO.1. The primer sequences are as follows:
[0033] Forward primer F30: 5′-CGGCTGCGCGAAATGGGATTCATCCTGACT-3′ (SEQ ID NO. 2);
[0034] Forward primer R30: 5′-GTTTCAGGGCTTCCATGCACAGGGTGTATC-3′ (SEQ ID NO. 3).
[0035] PCR validation was performed using genomic DNA of Bacteroides dorei isolated from human fecal samples in our laboratory as a template. (This Bacteroides dorei strain has been fully sequenced and has an average nucleotide identity of >99% with the standard strain of Bacteroides dorei, UHGG_MGYG-HGUT-02478.) Genomic DNA of the microorganism to be tested was extracted using a bacterial DNA extraction kit (Maibo, China) and added to the PCR reaction system.
[0036] The PCR reaction system was 25 μL and was configured as follows: 12.5 μL of Dream Taq Green PCR Master Mix (2×), 0.5 μL each of 10 μmol / L forward primer and reverse primer, 1 μL of DNA solution, and 10.5 μL of sterile double-distilled water.
[0037] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s, for a total of 34 cycles; and extension at 72°C for 5 min.
[0038] After PCR, 6 μL of the PCR reaction solution was collected and tested for PCR products by agarose gel electrophoresis (2% agarose concentration). The gel electrophoresis results were used to determine whether an amplified band at 193 bp was detected in the amplified product. If so, Bacteroides dornoni was detected in the sample; if no corresponding amplified band was detected, Bacteroides dornoni was not detected in the sample. In the present invention, the target band size for detecting Bacteroides dornoni was 193 bp, and Sanger sequencing was performed to obtain the nucleotide sequence shown in the underlined sequence of SEQ ID NO. 1.
[0039] (2) Specificity evaluation of the rapid detection method for Bacteroides dornoniae species-specific molecular targets
[0040] 24 common non-Bacteroides dorninae strains were selected, specifically covering: Bacteroides and Parabacteroides strains that are more common in the human intestine, probiotic strains such as Bifidobacterium and Lactobacillus or strains that have been reported to be beneficial to human health, normal inhabitants of animal intestines such as Escherichia coli and Enterococcus faecalis, common intestinal conditional pathogens, Gram-negative bacteria and Gram-positive bacteria, which were used for comparison with the same genus and non-species in the detection of Bacteroides dorninae. The above steps were used to detect Bacteroides dorninae isolates and 24 common non-Bacteroides dorninae strains, and the electrophoresis results were as follows: Figure 1 The results are shown in Table 1.
[0041] Table 1: Detection results of Bacteroides species-specific molecular targets
[0042]
[0043]
[0044] (3) Application of rapid detection methods of Bacteroides doreae-specific molecular targets in food systems
[0045] Using one strain of Bacteroides dorsalis and 11 other species of microorganisms listed in Table 2, a detection model with solutions, turbid liquids, and complex food systems with various dispersion systems was constructed. The combination of microorganisms in the detection model is shown in Table 3. The strains in Table 2 were cultured under their applicable culture conditions, centrifuged at 12000g for 1 minute, and the cells were collected, resuspended in physiological saline, and diluted to about 10 7 Then, according to the combinations in Table 3 (combination numbers AF), the above bacterial suspensions were mixed in equal proportions, centrifuged to obtain bacterial cells, and added to three food systems (mineral water, milk, and 10% soybean dregs suspension) and resuspended to make the final concentration of each bacteria in the food system 10 6 CFU / mL, and obtain a detection model with the food system as the matrix.
[0046] Table 2: Information of strains used to construct detection models
[0047]
[0048]
[0049] Note: Classification I in the table is Bacteroides dornoni, classification II is strains of Bacteroides or Parabacteroides other than Bacteroides dornoni, and classification III is strains that do not belong to Bacteroides or Parabacteroides.
[0050] Table 3: Microbial combinations in the test model
[0051]
[0052] The microbial genomic DNA of the sample to be tested was extracted by the boiling method and then added into the PCR detection reaction system to detect Bacteroides multilocus.
[0053] The method for extracting microbial genomic DNA by the boiling method is as follows: the sample to be tested is centrifuged at 12000g for 3 minutes, washed twice with an equal volume of physiological saline, and centrifuged at 12000g for 3 minutes. The precipitate is then resuspended in an equal volume of sterile water, placed in a boiling water bath for 15 minutes, cooled to room temperature, and refrigerated at -20℃ for 5 minutes. Finally, it is centrifuged at 12000g for 3 minutes. The supernatant is the DNA solution.
[0054] The PCR reaction system and PCR reaction procedure are as in step (1). After the PCR is completed, 6 μL of the PCR reaction solution is taken and the PCR product is detected by agarose gel electrophoresis (agarose concentration is 2%). The gel electrophoresis results are judged to see whether the amplified product shows an amplification band at 193 bp. If the band appears in the positive group and the negative group does not, it means that the food system does not interfere with the detection of Bacteroides multicornis. The PCR electrophoresis product detection results of the detection model are as follows: Figure 2The results are shown in Table 4.
[0055] Table 4: Detection results of Bacteroides doxorubicin in different detection models
[0056]
[0057] Example 3. Quantitative detection method of Bacteroides doreae species-specific molecular targets
[0058] (1) This example provides a method for quantitatively detecting Bacteroides dorsalis in a sample. The qPCR amplification primers used are F30: 5'-CGGCTGCGCGAAATGGGATTCATCCTGACT-3' and R30: 5'-GTTTCAGGGCTTCCATGCACAGGGTGTATC-3'. The specific operation is as follows:
[0059] ① Template DNA preparation: Use a bacterial DNA extraction kit to extract the microbial DNA in the sample to be tested to obtain a DNA solution sample to be tested.
[0060] ②qPCR detection system and amplification procedure:
[0061] The qPCR amplification system was 20 μL, including: 10 μL of TB Green Premix EX TaqⅡ (2×), 0.2 μL each of 10 μmol / L forward primer and reverse primer, 7.6 μL of sterile double-distilled water, and 2 μL of the DNA solution to be tested.
[0062] Using Roche The system was amplified and detected using a 96 real-time fluorescence quantitative PCR instrument. The qPCR reaction procedure was a two-step PCR reaction procedure: preheating at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, and annealing at 68°C for 30 seconds, for a total of 45 cycles.
[0063] ③qPCR result analysis:
[0064] use 96Software 1.1 software reads and analyzes the amplification test results. When a fluorescent signal is generated, if the melting curve is a single peak and T m The value is between 86-87℃, indicating that Bacteroides doxorubicin is detected in the sample; if no fluorescent signal is generated, or T m If the value is not within the above range, Bacteroides domitilis was not detected in the sample.
[0065] (2) Evaluation of the sensitivity of quantitative detection methods for Bacteroides doreae
[0066] The concentration of 1×10 8CFU / mL of Bacteroides multiforme was diluted in 10-fold gradient to obtain a concentration of 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 CFU / mL of bacterial solution, after extracting the strain DNA using a bacterial DNA extraction kit, quantitative detection of Bacteroides dorsalis was performed according to the above-mentioned qPCR protocol, and three parallel experiments were performed for each concentration sample.
[0067] Drawing of the standard curve: The logarithm of the concentration of Bacteroides dornoni in the sample is used as the horizontal axis, and the corresponding qPCR average Ct value is used as the vertical axis. The fitting curve is the standard curve for the quantitative detection of Bacteroides dornoni. Figure 3 As shown in the figure, the detection limit of the primers for Bacteroides dorsalis in the sample was 1×10 1 CFU / mL, the fitting standard curve of the Bacteroides multilocus detection is y=-3.0671x+35.027, and the correlation coefficient R 2 It is 0.9817.
[0068] (3) qPCR quantitative detection of Bacteroides domitilis in actual samples
[0069] ① Add fresh bacterial liquids of Bacteroides domitilis, Bifidobacterium and Lactobacillus plantarum in equal proportions to the milk and suspend them thoroughly to make the final concentration of each bacterium in the milk about 10 6 CFU / mL (the concentration of Bacteroides multilocus was 9.1×10 5 CFU / mL). The milk sample was centrifuged at 12000g for 3 min, washed twice with an equal volume of physiological saline, and centrifuged at 12000g for 3 min. Then, the microbial DNA was extracted using a bacterial DNA extraction kit. qPCR detection was performed according to Example 3(1). The results showed that the Ct value of the test sample was 16.70±0.07. According to the standard curve, the amount of Bacteroides multiforme in the milk sample was 1×10 5.98 CFU / mL (i.e. 9.5×10 5 CFU / mL milk), it can be seen that the quantitative detection of Bacteroides doxetii using this method is close to the results of the classic plate count method;
[0070] ② 7 g of human fecal sample was collected and suspended in 5 times the mass of normal saline. After centrifugation at 450 g for 5 min, 1 mL of the supernatant was collected. The microbial DNA in the feces was extracted using a bacterial DNA extraction kit. qPCR detection was performed according to Example 3 (1). The results showed that the Ct value of the test sample was 19.38 ± 0.22. According to the standard curve, the amount of Bacteroides multiforme in the sample was 1 × 10 5.10 CFU / mL (i.e. 6.29×10 5 CFU / g feces).
[0071] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A set of primers for detecting specific molecular targets of Bacteroides doreae, characterized in that: The Bacteroides doreae molecular target has a nucleotide sequence as shown in SEQ ID NO.1, and the primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
3.
2. A kit for detecting Bacteroides doreae, characterized in that: Comprising the primer according to claim 1.
3. Use of the primers according to claim 1 or the kit according to claim 2 in detecting Bacteroides dornoni for purposes other than disease diagnosis and treatment.
4. A method for detecting Bacteroides dornoni for purposes other than disease diagnosis and treatment, characterized in that: The following steps are involved: Extract DNA from the microorganism of the sample to be tested, perform PCR amplification on it using the primers described in claim 1, and perform gel electrophoresis on the amplified product. If a band of 193 bp is obtained, it is determined that Bacteroides dornoni is detected in the sample; if no band of 193 bp is obtained, it is determined that Bacteroides dornoni is not detected in the sample.
5. The method according to claim 4, characterized in that The PCR amplification system is 25 μL, which includes: 2×Dream Taq Green PCR Master Mix 12.5 μL, 10 μmol / L forward primer and reverse primer 0.5 μL each, 1 μL DNA template, 10.5 μL sterile double-distilled water.
6. The method according to claim 4, characterized in that The PCR reaction procedure is as follows: pre-denaturation at 95°C for 3 min; Denaturation at 95°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s were performed for a total of 34 cycles; extension was performed at 72°C for 5 min.
7. A qPCR detection method for quantitative detection of Bacteroides dornoni for non-disease diagnosis and treatment purposes, characterized in that: The following steps are involved: (1) using the primers described in claim 1 to draw a standard curve; (2) Perform qPCR amplification on the sample using the primers described in claim 1 to obtain the Ct value of the sample, and calculate the content of Bacteroides dobrosus in the sample based on the standard curve.
8. The qPCR detection method according to claim 7, characterized in that The qPCR amplification system is 20 μL, which includes: 10 μL of 2×TB Green Premix EX TaqⅡ, 0.2 μL of 10 μmol / L forward primer and reverse primer, 7.6 μL of sterile double-distilled water, and 2 μL of the DNA solution to be tested.
9. The qPCR detection method according to claim 7, characterized in that The qPCR reaction procedure was a two-step PCR reaction procedure: preheating at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, and annealing at 68°C for 30 seconds, for a total of 45 cycles.