Rapid amplification test kit based on isothermal nucleic acid amplification technology

Abstract

The application discloses a rapid amplification detection kit based on isothermal nucleic acid amplification technology and belongs to the field of biological detection. The product provided by the application can obtain the same purpose effect as traditional PCR within 10 minutes at the fastest speed. The product is not only short in detection time and high in sensitivity, but also is free from the restraint of instruments, can be used in non-laboratory environment and achieves the purpose of on-site detection. In addition, the method is convenient to operate and has low requirement on personnel, and is suitable for scientific research work and can be used by related personnel of primary units with relatively poor equipment conditions.

Description

TECHNICAL FIELD

[0001] The present application relates to a rapid amplification detection kit based on isothermal nucleic acid amplification technology, belonging to the field of biological detection. BACKGROUND

[0002] Molecular detection is represented by PCR technology, which mainly identifies pathogens by detecting DNA or RNA of pathogens, has high accuracy, and greatly shortens the time compared with traditional detection, and only needs a few hours to get the result, and has been more and more used in the detection of pathogens. The outbreak of African swine fever in 2019 and the detection of the new coronavirus, the state has included nucleic acid detection into the detection standard. It is predicted that molecular detection will be the development direction in the future.

[0003] Although PCR technology has been applied in various fields of molecular biology, the technology needs to change the temperature continuously to realize nucleic acid amplification, therefore, a thermal cycler is an indispensable device. However, due to the large size and high price of the thermal cycler, its promotion and on-site detection at the grassroots level have been greatly limited. Therefore, different isothermal amplification technologies have appeared one after another, which have single reaction temperature and are not restricted by thermal cyclers, and are gradually becoming the best alternative method of PCR.

[0004] The progress of PCR is repeated by three basic reaction steps of denaturation, annealing and extension, generally the denaturation temperature is 93-96℃, the annealing temperature is 50-55℃, the extension temperature is 60-75℃, the amplification detection time is 60-120 minutes, and the requirement for the operator is high.

[0005] The core technology of the rapid nucleic acid detection platform is the isothermal nucleic acid amplification technology, which can be regarded as a special DNA replication in vitro. The amplification process mainly uses four enzymes: recombinase, auxiliary protein, single-strand binding protein and DNA polymerase. The whole amplification process can be divided into three processes, ① the recombinase and the primer form a recombinase-primer complex, find and pair with the primer region on the DNA double strand, and open the double-stranded DNA; ② the opened single-stranded DNA is combined with the single-strand binding protein to prevent the double-stranded DNA from being recombined; ③ under the action of DNA polymerase, the chain is catalyzed to extend to generate new DNA chains. After dozens of cycles, the number of new DNA chains increases exponentially. The biggest feature is also to amplify trace amounts of DNA under isothermal conditions (generally 37℃), which can reach the detectable level within 10 minutes at the fastest. SUMMARY

[0006] The goal of this project is to establish a rapid nucleic acid detection platform and realize mass production, and to provide a rapid nucleic acid detection kit for the rapid detection of feline coronavirus and parvovirus, namely RAPID kit.

[0007] The present application provides a primer set for detecting feline coronavirus and feline parvovirus, comprising (A) and (B):

[0008] (A) an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 3, a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 6, and a probe with a nucleotide sequence as shown in SEQ ID NO. 13;

[0009] (B) an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 7, a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 10, and a probe with a nucleotide sequence as shown in SEQ ID NO. 14.

[0010] In one embodiment, the middle position of the sequence of the probe is connected with a fluorescent group and a quenching group, and the 3' end is connected with a C3Spacer modification.

[0011] In one embodiment, the sequence of the probe is Gttatagtgcaccatattattcttttgaagcg / dT-FAM / dSpacer / dT-BHQ1 / acacaagggccatta / C3 Spacer and cgtgtaataggaggtacaagcaaccctat / dT-FAM / dSpacer / CA / dT-BHQ1 / attaggaagtttaga / C3 Spacer.

[0012] The present application provides the use of the primer set in the preparation of a reagent for detecting feline coronavirus and feline parvovirus.

[0013] In one embodiment, the reagent comprises a qPCR detection kit, a qPCR detection kit, or a lateral flow test strip.

[0014] The present application provides a detection kit for detecting feline coronavirus and feline parvovirus, which contains the primer set.

[0015] In one embodiment, the kit further contains magnesium acetate, RPAID lyophilized powder, and a positive control plasmid.

[0016] In one embodiment, the positive control plasmid is a pUC57 plasmid carrying a fragment with a nucleotide sequence as shown in SEQ ID NO. 15.

[0017] In one embodiment, when detecting feline coronavirus and feline parvovirus, the reaction system is as follows: 25 muL of buffer, 2 muL of 10 muM upstream primer, 2 muL of 10 muM downstream primer, 0.6 muL of 10 muM probe, 1 muL of DNA template, 16.7 muL of ddH2O and 2.5 muL of magnesium acetate;

[0018] In one embodiment, the reaction is carried out in a fluorescence detector with a temperature setting of 37-40 DEG C, and the reaction time is 10-40 min.

[0019] In one embodiment, the channel of the fluorescence detector is set to 492-520 nm.

[0020] The isothermal nucleic acid amplification technology of the project has the following characteristics:

[0021] (1) Isothermal amplification: amplification is carried out at isothermal temperature, so that on-site detection is possible;

[0022] (2) Rapid detection: the same effect as PCR can be obtained within 10 minutes, and the accuracy is not lower than that of PCR;

[0023] (3) High sensitivity: the detection limit can reach a single copy, and the sensitivity is not lower than that of PCR;

[0024] (4) Simple design: the primer design form is similar to that of PCR;

[0025] (5) Multiple detection methods: all detection methods available for PCR can be used;

[0026] (6) Seamless integration with PCR: methods and means for studying PCR technology can be used.

[0027] Beneficial effects:

[0028] The product provided by the application can obtain the same purpose effect as traditional PCR within 10 minutes. Not only is the detection time short and the sensitivity high, but also the instrument is not bound, and on-site detection can be carried out in a non-laboratory environment. In addition, the method is easy to operate, and the personnel requirement is not high. Not only is it suitable for scientific research work, but also it can be used by related personnel in basic units with relatively poor equipment conditions. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Fluorescence detection diagram; left: FC, right: FP.

[0030] Figure 2 Sensitivity detection; FP (left) and FC (right).

[0031] Figure 3Reproducibility detection; FP (left) and FC (right).

[0032] Figure 4 Specificity detection; FP (left) and FC (right). DETAILED DESCRIPTION

[0033] Positive plasmid: the fragment of nucleotide sequence as SEQ ID NO. 15 is connected to the commercial pUC57 vector to construct.

[0034] Example 1 RAPID primer design

[0035] (I) Primer design

[0036] The RPA primer is designed for the target of the VP2 gene of feline parvovirus (GenBank: AF015223.1) and the genome of feline coronavirus (GenBank: DQ010921.1), and the designed primer is sent to Shanghai Shengong or General Biological for synthesis. The primer design is as follows:

[0037] Table 1 RPA primer design

[0038]

[0039] (II) Primer screening

[0040] (1) According to the instructions of the basic RT-RAPID freeze-dried powder (purchased from Leshan Biological), the primers designed in step (1) are dissolved, and the components in the kit (except freeze-dried powder) are taken out, room temperature, and the temperature is balanced to room temperature, mixed and centrifuged briefly, standby; 10 7 , 10 6 , 10 5 copies of two.

[0041] (2) Prepare the reaction solution of several reactions according to the following formula (Table 2) (50ul reaction system) in 1.5ml EP tube, mix and centrifuge:

[0042] Table 2 Reaction system

[0043] Component Volume (μl) Double distilled water 17.5 Buffer 25 Primer F (10 uM) 2 Primer R (10 uM) 2 MgAc 2.5 Template DNA 1 Total volume (μl) 50

[0044] (3) Add 1ul template to each reaction tube, and add 1ul water to the negative control (two templates are parallel);

[0045] (4) Mix well and centrifuge;

[0046] (5) Put into 37℃ water bath, 37℃ constant temperature reaction for 40min;

[0047] (6) After the reaction is completed, 50 μl of 1:1 phenol / chloroform treatment solution is added to each reaction tube, and the mixture is manually mixed and centrifuged.

[0048] (7) 2% agarose gel electrophoresis is used to detect the results of the RPA amplification reaction.

[0049] The results show that the primer pair with better specificity is screened, and the target fragments of FC (left) and FP (right) are amplified. Figure 2 ).

[0050] Example 2 Construction of the fluorescence detection method

[0051] (I) Design and optimization of fluorescent probes

[0052] According to the primers F3 / R3 (feline parvovirus) and F1 / R1 (feline coronavirus) screened in Example 1, the fluorescent probes are designed according to the primer interval:

[0053] Table 3 Probe sequence

[0054]

[0055] (II) Construction of the fluorescence detection method

[0056] 1) Dissolve the primers designed in Example 1 and the probes in Table 5 according to the instructions of RAPID lyophilized powder (purchased from Leshan Biological), take out the components in the kit (except lyophilized powder), and place it at room temperature until the temperature is balanced to room temperature, mix briefly and centrifuge at low speed, and prepare for use; dilute the positive plasmid to 10 4 , 10 3 , 10 2 copies and distilled water (valid for one month), as a template to detect the fluorescence amplification signal of the product.

[0057] 2) Start the fluorescence detector in advance, and set the program: reaction temperature 39℃, equilibrium 10s, hot cover temperature 45℃, reaction time 30min, channel (492-520nm, best 492nm), and preheat.

[0058] 3) Prepare the reaction solution according to the following formula (Table 4) in 1.5mL EP tubes (50μL reaction system), mix and centrifuge.

[0059] Table 4 Reaction system

[0060] Component Volume (uL) Double distilled water 16.7 Buffer 25 Primer F (10 uM) 2.1 Primer R (10 uM) 2.1 Probe (10 uM) 0.6 MgAc 2.5 Template DNA 1 Total volume (uL) 50

[0061] 4) Divide the above mixture into each reaction dry powder tube 46.5μL, mix and centrifuge.

[0062] 5) Add 2.5 μL magnesium acetate to the cover of each reaction tube, and then quickly add 1 μL of the diluted template of step 1) to each reaction tube, and add 1 μL of water to the negative control.

[0063] 6) Mix well and centrifuge.

[0064] 7) Place the reaction tube into a fluorescence detector, click "Run", and then set the experiment number and sample number, etc., react for 30 min, and observe the fluorescence curve in real time.

[0065] 8) Save the atlas and analyze the results.

[0066] The results are shown in Figure 1 , and the fluorescence curves of the positive plasmids of different concentrations are normally amplified, which shows that the designed primers can successfully detect feline coronavirus and feline parvovirus.

[0067] Example 3: Determination of sensitivity, repeatability, specificity and stability

[0068] Detect 10 copies, repeat more than 3 times, and the negative control has no reaction. Store at 4 degrees Celsius for 3-6 months.

[0069] (I) Sensitivity

[0070] The experimental steps are the same as above (fluorescence detection method)

[0071] Dilute the positive plasmid, and select 10, 100, 1000 copies and a negative control for amplification, and the fluorescence curve results are shown in Figure 2 : The reactions of 10, 100 and 1000 copies all amplify the fluorescence curve, and the negative control has no curve; the sensitivity can reach to detect 10 copies of the sample.

[0072] (II) Repeatability

[0073] The experimental steps are the same as above (fluorescence detection method)

[0074] Select the plasmid with a copy number of 100 for 3 amplifications, and the fluorescence curve results are shown in Figure 3 : The 3 curves are basically the same, which shows that the fluorescence detection method provided by the present application has good repeatability.

[0075] (III) Specificity

[0076] The experimental steps are the same as above (fluorescence detection method)

[0077] Select FP and its similar virus, FC and its similar virus for amplification, and the fluorescence curve results are shown in Figure 4 : FP and FC both amplify the fluorescence curve, and the similar virus has no curve; which shows good specificity.

[0078] Assembly of kit of embodiment 4

[0079] After synthesizing the primer probe confirmed by screening of embodiments 1 and 2, freeze-drying together with RPAID freeze-dried powder, and packaging into a kit (containing nucleic acid lysis solution, freeze-dried powder, dissolving agent, initiator, control).

[0080] Wherein the lysis solution is SDS alkaline lysis method, configured later.

[0081] The freeze-dried powder is freeze-dried by the RT-RAPID manufacturer free of charge in the early stage, and can be freeze-dried by oneself in the later stage.

[0082] The dissolving agent is mainly buffer (RT-RAPID kit matching buffer).

[0083] The initiator is mainly Mg 2+ .

[0084] The control is mainly plasmid positive control and ultrapure water negative control.

[0085] Case: The blood samples of pet cats were provided by Professor Song of Taihu College, and all the samples were identified by QPCR detection.

[0086] Table 5 Actual sample detection

[0087]

[0088] Although the present application has been disclosed with the above preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be limited by the claims.

Claims

1. A primer set for isothermal nucleic acid amplification detection of feline coronavirus and feline parvovirus, characterized in that: The primer set includes (A) and (B): (A) an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 3, a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 6, and a probe having a nucleotide sequence as shown in SEQ ID NO. 13; (B) an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 7, a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 10, and a probe having a nucleotide sequence as shown in SEQ ID NO. 14; The sequences of the probes are Gttatagtgcaccatattattcttttgaagcg / dT-FAM / dSpacer / dT-BHQ1 / acacaagggccatta / C3 Spacer and cgtgtaataggaggtacaagcaaccctat / dT-FAM / dSpacer / CA / dT-BHQ1 / attaggaagtttaga / C3 Spacer.

2. Use of the primer set according to claim 1 in preparing a reagent for detecting feline coronavirus and feline parvovirus.

3. The use according to claim 2, characterized in that The reagents include a qPCR detection kit, a qPCR detection kit or a lateral flow test strip.

4. A detection kit for detecting feline coronavirus and feline parvovirus, characterized in that, The kit contains the primer set according to claim 1.

5. The detection kit according to claim 4, characterized in that The kit also contains magnesium acetate, RPAID lyophilized powder and a positive control plasmid.

6. The detection kit according to claim 5, characterized in that The positive control plasmid is a pUC57 plasmid carrying a fragment of the nucleotide sequence shown in SEQ ID NO.

15.

7. The detection kit according to any one of claims 4 to 6, characterized in that For the detection of feline coronavirus and feline parvovirus, the reaction system is as follows: 25 μL of buffer, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 1 μL of DNA template, 16.7 μL of ddH2O, and 2.5 μL of magnesium acetate.

8. The detection kit according to claim 7, characterized in that The reaction is carried out in a fluorescence detector set at 37-40°C, and the reaction time is 10 to 40 minutes.

Images