Beacon probe and combination thereof, PCR amplification reagent and kit for detecting FLT3-ITD gene mutation

Abstract

The present invention relates to a beacon probe and a combination thereof, a PCR amplification reagent, a kit and a method for detecting FLT3-ITD gene mutations, wherein the beacon probe includes a first stem pairing sequence-a first anti-interference sequence-a target pairing sequence-a second anti-interference sequence-a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe. The present application adopts the above-mentioned beacon probe by design, and the beacon probe has an anti-interference sequence at both ends, and can be used in the process of fluorescence detection experiment, because of the presence of the anti-interference sequence, the beacon probe that is not paired with the template chain can be designed according to the temperature characteristics of DNA. The sequence at least partially paired with the anti-interference sequence can overcome the problem that the existing fluorescent label is limited and cannot be identified. Fluorescence quenching can be performed for the anti-interference sequence, so as to facilitate the detection of a specific fluorescence intensity or the fluorescence of the fluorescent label, so as to improve the detection sensitivity.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular to a PCR amplification reagent and a kit for detecting FLT3-ITD gene mutation. Background Art

[0002] The full name of FLT3 gene is FMS like tyrosine kinase 3, which encodes a membrane-bound receptor tyrosine kinase (RTK) and belongs to the RTK subclass III family together with KIT, CSF1R, PDGFRA, and PDGFRB. FLT3 protein consists of Ig-like extracellular domain, transmembrane domain (TMD), juxtamembrane domain (JMD), and tyrosine kinase domain (TKD). The human FLT3 gene is located on chromosome 13q12.2 and has 24 exons. It is a proto-oncogene that plays a key role in the proliferation, differentiation, and survival of hematopoietic cells. In recent years, FLT3 has become an important marker for different hematological malignancies, especially in acute myelogenous leukemia (AML). FLT3 mutations are associated with the clinical prognosis, treatment, and survival of patients.

[0003] AML (acute myelocytic leukemia) is a highly heterogeneous hematopoietic stem and progenitor cell tumor. At present, the main molecular markers associated with AML have been found to be FLT3, NPM1, CEBPA, etc. In 1996, the internal tandem duplication (FLT3-ITD) of the JM domain of the FLT3 gene was first discovered in AML cells. Subsequently, people discovered the D835 point mutation and the deletion and insertion mutations of other codons near D835 in the TK domain. In 2022, the NCCN guidelines emphasized that the FLT3 gene can be used as a molecular marker to clarify the prognosis classification of AML, especially for patients with normal karyotype. FLT3 mutations account for about 30% of adult AML; mainly internal tandem duplication mutations (FLT3-ITD) occurring in the juxtamembrane domain (exons 14 and 15, separated by an intron), accounting for about 25%, and a small number of point mutations (FLT3-TKD) or deletions in the tyrosine kinase domain (exon 20), accounting for about 5%. FLT3-ITD mutation can cause FLT3 to dimerize and continuously self-phosphorylate in the absence of ligand binding, enhance the activation of tyrosine kinase activity, and continuously activate downstream signaling pathways (RAS / MAPK, PI3K / AKT, etc.), leading to dysregulated cell proliferation and promoting the recurrence of AML disease. Compared with patients without FLT3 mutations, AML patients with FLT3-ITD mutations have a short CR duration, a high recurrence rate, and a short OS. FLT3-ITD means an increased risk of disease and a poor prognosis. At present, FLT3-ITD mutations have been used as an important indicator for routine detection of AML in clinical practice. Among patients with newly diagnosed AML, about 30% of patients have FLT3 mutations. Compared with patients without FLT3 mutations, AML patients with FLT3-ITD mutations have a short CR duration, a high recurrence rate, and a short OS. Regardless of the cytogenetic classification, the appearance of FLT3-ITD indicates a significantly increased risk of disease recurrence and a poor overall prognosis for patients. Therefore, FLT3-ITD mutations have become an important indicator for routine detection of AML. Methods that can be used to detect FLT3 gene mutations include PCR capillary electrophoresis, second-generation sequencing, whole genome sequencing, whole exome sequencing, etc. Among them, the PCR-gene scanning method has the advantages of being fast, simple, and low-cost. It is a basically recognized detection method. NGS is also one of the most widely used detection methods.

[0004] The insertion sites and sequences of FLT3-ITD mutations vary, and the length generally varies from 3 to 400 bp. It always appears in multiples of 3, retaining the reading frame (ORF) of the transcript. This diversity of tandem repeat mutations increases the difficulty of its detection. At present, the main methods for detecting FLT3-ITD mutations in AML include direct sequencing, fluorescence quantitative PCR, capillary electrophoresis, flow cytometry, etc. Direct sequencing has the disadvantages of long detection time and high cost. There are also many reports that if the primer specificity is poor, it will cause a high background peak in the sequencing peak graph, affecting the judgment of the mutation. Fluorescence quantitative PCR can only design primer probes for site-directed mutations, which may cause fluorescence signal interference in the case of multiple probes. Capillary electrophoresis has the disadvantages of complex operation, low detection flux, and sensitivity of 0.5%-10%. Flow cytometry has the disadvantages of very strict sample requirements and the need for fresh samples to be sent in time.

[0005] In summary, there is an urgent need to explore a highly sensitive, rapid, easy-to-operate, and widely covered detection method for the detection of FLT3-ITD in clinical AML patients. Summary of the invention

[0006] Based on this, it is necessary to provide a beacon probe and its combination with high sensitivity and relatively simple operation, a PCR amplification reagent, a kit and a method for detecting FLT3-ITD gene mutation. Of course, the beacon probe and its combination, PCR amplification reagent, kit and method of the present application are not limited to the FLT3 gene, but can also be used for the detection of deletion or insertion of other genes.

[0007] The first purpose of the present invention is to provide a beacon probe that is not limited to detecting FLT3-ITD gene mutations, which can overcome the problem of limited existing fluorescent labels and interference of fluorescent signals during detection, thereby achieving high sensitivity and simple operation.

[0008] In a first aspect, the present application provides a beacon probe, comprising a first stem pairing sequence—a first anti-interference sequence—a target pairing sequence—a second anti-interference sequence—a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe.

[0009] The present application adopts the above-mentioned beacon probe by design, and the beacon probe has anti-interference sequences at both ends, and can be in the process of fluorescence detection experiment, because the beacon probe that is not paired with the template strand exists anti-interference sequences, the sequence that can be designed at least partially paired with the anti-interference sequences can be based on the temperature characteristics of DNA to overcome the problem of limited existing fluorescent labels and fluorescent labels. When the target sequence has no mutation, the target pairing sequence is paired with the target sequence, but under the action of 5`-3` exonuclease, at least one sequence in the stem pairing sequence-anti-interference sequence after cutting is paired and combined with each other, and the fluorescent label and quenching mark of each beacon probe pairing side are close to each other and make fluorescence quenching. When there is a mutation in the target sequence, the target pairing sequence cannot be paired with the target sequence, and the beacon probe cannot be hydrolyzed, and the joint sequence that is hydrolyzed as the template strand and other beacon probes is paired and combined. Under the action of DNA polymerase and 5`-3` exonuclease, DNA is extended, thereby degrading the anti-interference sequence bound to the 5` end of the template strand beacon probe, emitting fluorescence during detection, and then facilitating the detection of specific fluorescence intensity or fluorescence labeled fluorescence, so as to improve the detection sensitivity.

[0010] In one embodiment, the 5' end of each probe is connected to a fluorescent labeling group, and the 3' end is connected to a fluorescent quenching group.

[0011] In one embodiment, the length of the first anti-interference sequence and / or the second anti-interference sequence is 4-10 bp.

[0012] In one embodiment, the length of the first anti-interference sequence and / or the second anti-interference sequence is 6 bp, and the first anti-interference sequence and / or the second anti-interference sequence comprises at least one of the following sequences:

[0013] CTAGCT, AGTTCC, CACGAT, TCGAAG, GTAGAG, GTTTCG, TGACAC, AGTCAA, AGCTAG, GGAACT, ATCGTG, CTTCGA, CTCTAC, CGAAAC, TTGACT, GTGTCA, etc. Of course, the first anti-interference sequence and / or the second anti-interference sequence include but are not limited to the above-mentioned lengths and specific sequences. According to the concept of the present invention, other similar sequences that can play an anti-interference function can also be used.

[0014] In a second aspect, the present application provides a beacon probe combination, comprising a plurality of beacon probes, at least some of which comprise a first stem pairing sequence—a first anti-interference sequence—a target pairing sequence—a second anti-interference sequence—a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe, wherein at least one sequence in the first anti-interference sequence—first stem pairing sequence of one of the beacon probes and at least one sequence in the second anti-interference sequence—second stem pairing sequence of another of the beacon probes are at least partially paired, so that the beacon probe cannot be restored to the stem-loop structure during renaturation.

[0015] The present application adopts the above-mentioned beacon probe combination by design, wherein at least one sequence in the first anti-interference sequence of one of the beacon probes - the first stem pairing sequence and at least one sequence in the second anti-interference sequence of another beacon probe - the second stem pairing sequence are at least partially paired, so that the beacon probe cannot be restored to the stem-loop structure during renaturation, so that after the target sequence is paired with the corresponding template sequence, based on the corresponding operation method of 5`-3` exonuclease and DNA polymerase, the anti-interference sequence is fluorescently quenched, thereby facilitating the detection of a specific fluorescence intensity or fluorescence of a fluorescent marker, thereby improving the detection sensitivity. Specifically, for example:

[0016] When there is an insertion mutation in the template, at 60 degrees, during the PCR process, the beacon probe (such as one labeled with a red fluorescent group) cannot pair with the template, while other beacon probes (such as one labeled with a green fluorescent group) can bind to the template, thereby undergoing hydrolysis, cutting the linker sequences at the 5' and 3' ends, and emitting fluorescence (such as green fluorescence).

[0017] At 55 degrees, the beacon probe that is not bound to the template can be paired with the sequence of other beacon probes hydrolyzed. When the temperature is further lowered, the stem-loop structure of the beacon probe can also remain open and emit fluorescence (such as red fluorescence).

[0018] At 30 degrees, the two end adapter sequences that were previously cut by hydrolysis are combined again, thus achieving fluorescence quenching. At this time, only the red fluorescence of the beacon probe is retained, thereby identifying the insertion mutation.

[0019] In one embodiment, after at least one sequence in the first anti-interference sequence-first stem pairing sequence of one of the beacon probes is at least partially paired with at least one sequence in the second anti-interference sequence-second stem pairing sequence of another beacon probe, the fluorescent label and the quenching label on the paired side of each beacon probe are brought close to quench the fluorescence.

[0020] In one embodiment, the first anti-interference sequence of one of the beacon probes and the second anti-interference sequence of another beacon probe are at least partially paired, and the two beacon probes are labeled with different fluorescent labels.

[0021] In one embodiment, after the target pairing sequence in the beacon probe is paired with the template strand, the target pairing sequence in the middle of the beacon probe is hydrolyzed under the activity of 5'-3' exonuclease to release the stem pairing sequence-anti-interference sequence at the two opposite ends of the target pairing sequence. At least one of the released stem pairing sequence-anti-interference sequence is paired and bound to each other, and the fluorescent marker and quenching marker on the paired side of each beacon probe are brought close to quench the fluorescence.

[0022] In one embodiment, when the target pairing sequence in the beacon probe cannot be paired with the target sequence due to a genetic mutation in the template chain, the beacon probe cannot be hydrolyzed, and acts as a template chain to pair with the linker sequence hydrolyzed from other beacon probes; under the action of DNA polymerase and 5'-3' exonuclease, DNA extension is initiated, thereby degrading the anti-interference sequence bound to the 5' end of the template chain beacon probe, and emitting fluorescence during detection.

[0023] In one embodiment, at least one of the first anti-interference sequence and the first stem pairing sequence of each beacon probe can be paired with at least a portion of at least one of the second anti-interference sequence and the second stem pairing sequence of another beacon probe, so as to bring the fluorescent label and the quenching label on the pairing side closer to quench the fluorescence.

[0024] In one embodiment, the molar concentrations of the paired beacon probes are equal.

[0025] In the third aspect, the present application provides a beacon probe combination, including a beacon probe and an anti-interference sequence reagent, the beacon probe including a first stem pairing sequence-a first anti-interference sequence-a target pairing sequence-a second anti-interference sequence-a second stem pairing sequence, and at least one of the stem pairing sequence and the first anti-interference sequence is at least partially paired with the anti-interference sequence reagent so that the beacon probe cannot be restored to the stem-loop structure during renaturation.

[0026] In this embodiment, what is different from the second aspect is that the second aspect uses other probe sequences to quench the fluorescence of the anti-interference sequence, while this embodiment uses other anti-interference sequence reagents to complete the fluorescence quenching. Of course, it is also necessary to combine the corresponding operation methods of 5`-3` exonuclease and DNA polymerase to quench the fluorescence of the anti-interference sequence, thereby facilitating the detection of specific fluorescence intensity or fluorescence of fluorescent markers, thereby improving the detection sensitivity.

[0027] In a fourth aspect, the present application provides a PCR amplification reagent, comprising a beacon probe as described in any of the above embodiments or a combination of beacon probes as described in any of the above embodiments.

[0028] In a fifth aspect, the present application provides a kit for detecting gene mutations, characterized in that it comprises a beacon probe as described in any of the above embodiments or a combination of beacon probes as described in any of the above embodiments.

[0029] In the sixth aspect, the present application provides a PCR amplification reagent for detecting FLT3-ITD gene mutations, comprising: a forward primer, a reverse primer and a plurality of beacon probes as described in any of the above embodiments, wherein the sequences of the plurality of beacon probes are different, and the forward primer, the reverse primer and the plurality of beacon probe sequences are used for droplet digital PCR amplification using the FLT3-ITD gene as a template, and each of the probe sequences is marked with a different fluorescent marker.

[0030] In the present application, the beacon probe is used in the detection of FLT3-ITD gene mutation, which has the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver samples in time when fresh samples are required in the flow cytometry detection method; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect FLT3-ITD site-specific mutations, and can detect diverse non-site-specific mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability when using multiple probes compared to fluorescent quantitative PCR detection. Since each probe uses a different fluorescent marker and a probe with a stem-loop structure, the fluorescence interference between the probes is relatively small and the sensitivity is relatively high.

[0031] In one embodiment, the sequence of the forward primer is: 5`-tgcagaactgcctattccta-3`;

[0032] The sequence of the reverse primer is: 5`-ctggattgagactcctgtt-3`.

[0033] In one embodiment, the plurality of probe sequences include at least one of JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S, wherein:

[0034] The sequence of JMB-1 is:

[0035] 5`-cggcgcCTAGCTtctgaagCAATTTAGGTATGAAAGCCAAGTCAAgcgccg-3`;

[0036] The sequence of JMB-2 is:

[0037] 5`-cggcgcAGTTCCAGCCAGCTACAGATGGTACAGGTAGCTAGgcgccg-3`;

[0038] The sequence of JMs is:

[0039] 5`-cggcgcCACGATCAGGTGACCGGCTCCTCAGATACGAAACgcgccg-3`;

[0040] The sequence of JmZ is:

[0041] 5`-cggcgcTCGAAGAGATAATGAGTACTTCTACGTTGATGGAACTgcgccg-3`; The sequence of HR1 is:

[0042] 5`-cggcgcGTAGAGCAAATGGGAGTTTCCAAGAGAAAATcttcgagcgccg-3`;

[0043] The sequence of B1-S is:

[0044] 5`-cggcgcGTTTCGGAAAATTTAGAGTTTGgtaagaatgATCGTGgcgccg-3`;

[0045] The sequence of NBL is:

[0046] 5`-cggcgcTGACACgtctttgcagGGAAGGTACTAGGATCCTCTACgcgccg-3`;

[0047] The sequence of B2-S is:

[0048] 5`-cggcgcTTGACTAGGATCAGGTGCTTTTGGAAAAGGTGTCAgcgccg-3`.

[0049] In one embodiment, it includes a PCR amplification reagent as described in any of the above embodiments.

[0050] In one embodiment, the kit further includes controls, which include a positive control and a negative control, wherein the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard, wherein the fragmented plasmid standard includes at least one of the following: 7-3 (JMB1) plasmid, B2S plasmid, 6b-1 (JMB2) plasmid, 586 (JMs) plasmid, 3b (JmZ) plasmid, 612 (HR) plasmid, B1S plasmid, NBL1 plasmid.

[0051] In one embodiment, the sample of the kit is selected from a plasma sample or a paraffin sample, and the sample is not limited thereto.

[0052] In one embodiment, the PCR is an asymmetric PCR method.

[0053] In one embodiment, the kit further comprises Perfecta Multiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix comprises dNTPs, Taq enzyme and PCR buffer.

[0054] In a seventh aspect, the present application provides a method for detecting FLT3-ITD gene mutation by digital PCR for non-diagnostic purposes, characterized in that the method comprises:

[0055] A PCR reaction system of FLT3-ITD gene was prepared using the kit described in any of the above examples;

[0056] Loading the PCR reaction system into the digital PCR chip;

[0057] The digital PCR chip is placed in a digital PCR instrument to perform PCR amplification to obtain an amplification result;

[0058] The digital PCR chip having the amplification result is placed in a chip scanner for fluorescence signal scanning, and the mutation result is interpreted according to the fluorescence signal. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a scanning diagram of the fluorescence signal of the Blue-Red channel when the Blue probe of an embodiment is not bound; Figure 2 This is a scanning diagram of the fluorescence signal of the Blue-Green channel when the green probe of an embodiment is not bound; Figure 3 This is a scanning diagram of the fluorescence signal of the Blue-Red channel when the red probe of an embodiment is not bound; Figure 4a This is a fluorescence detection result diagram of the B1S plasmid in Example 1; Figure 4b This is a fluorescence detection result diagram of the fluorescence detection of the genomic DNA of the wild-type cell line in Example 1; Figure 5aThis is a fluorescence detection result diagram of the B1S plasmid in Example 2;

[0060] Figure 5b This is the fluorescence detection result of genomic DNA of wild-type cell line; Figure 6a This is a fluorescence detection result diagram of the 3b(JmZ) plasmid of Example 3; Figure 6b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 3; Figure 7a This is a fluorescence detection result diagram of the 3b(JmZ) plasmid of Example 4; Figure 7b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 4; Figure 8a This is a fluorescence detection result diagram of the B1S plasmid in Example 5; Figure 8b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 5; Figure 9a This is a fluorescence detection result diagram of the 3b(JmZ) plasmid in Example 6 in reaction procedure 1;

[0061] Figure 9b This is a fluorescence detection result diagram of the 3b(JmZ) plasmid in reaction procedure 2 of Example 6; Fig.10a This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in reaction procedure 1 of Example 6; Fig.10b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in reaction procedure 2 of Example 6; Fig.11a This is a graph showing the fluorescence detection result of 0.05% concentration in well A1 in Example 7; Fig.11b This is a graph showing the fluorescence detection result of 0.05% concentration in well B1 in Example 7; Fig.12a This is a graph showing the fluorescence detection result of 0.1% concentration in well C1 in Example 7; Figure 12b This is a graph showing the fluorescence detection result of 0.1% concentration in well D1 in Example 7; Fig.13a This is a graph showing the fluorescence detection result of 0.2% concentration in well A2 in Example 7; Fig.13b This is a graph showing the fluorescence detection result of 0.2% concentration in well B2 in Example 7; Fig.14a This is a graph showing the fluorescence detection result of 0.3% concentration in well C2 in Example 7; Fig.14b This is a graph showing the fluorescence detection result of 0.3% concentration in well D2 in Example 7; Fig.15a This is a graph showing the fluorescence detection result of 0.5% concentration in well A3 in Example 7;

[0062] Fig.15b This is a graph showing the fluorescence detection result of 0.5% concentration in well B3 in Example 7; Fig.16 This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in well C3 in Example 7. DETAILED DESCRIPTION

[0063] In order to facilitate the understanding of the present application, in order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth so as to fully understand the present application, and the preferred embodiments of the present application are given in the accompanying drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thoroughly understood. The present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited to the specific embodiments disclosed below. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art belonging to the technical field of the present application. The terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.

[0064] This application is explained by taking the detection of FLT3-ITD gene mutation as an example. Of course, it should be understood that the beacon probe design concept of this application is not limited to the detection of FLT3-ITD gene mutation, but can also be used to detect other gene variations or gene expressions, or is suitable for gene detection using traditional beacon probes.

[0065] Specifically, a variety of tiling probe sequences were designed for FLT3-ITD gene mutations, including JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S.

[0066] The sequence of JMB-1 is:

[0067] 5`-cggcgcCTAGCTtctgaagcaatttaggtatgaaagccaAGTCAAgcgccg-3`;

[0068] The sequence of JMB-2 is:

[0069] 5`-cggcgcAGTTCCagccagctacagatggtacaggtAGCTAGgcgccg-3`;

[0070] The sequence of JMs is:

[0071] 5`-cggcgcCACGATcaggtgaccggctcctcagataCGAAACgcgccg-3`;

[0072] The sequence of JmZ is:

[0073] 5`-cggcgcTCGAAGagataatgagtacttctacgttgatGGAACTgcgccg-3`;

[0074] The sequence of HR1 is:

[0075] 5`-cggcgcGTAGAGcaaatgggagtttccaagagaaaatCTTCGAgcgccg-3`;

[0076] The sequence of B1-S is:

[0077] 5`-cggcgcGTTTCGgaaaatttagagtttggtaagaatgATCGTGgcgccg-3`;

[0078] The sequence of NBL is:

[0079] 5`-cggcgcTGACACgtctttgcagggaaggtactaggatcCTCTACgcgccg-3`;

[0080] The sequence of B2-S is:

[0081] 5`-cggcgcTTGACTaggatcaggtgcttttggaaaagGTGTCAgcgccg-3`.

[0082] It should be noted that the above sequence capitalization is to better illustrate the example of the first stem paired sequence-first anti-interference sequence-target paired sequence-second anti-interference sequence-second stem paired sequence of the present embodiment, taking the JMB-1 sequence as an example, the first stem paired sequence is cggcgc, the first anti-interference sequence is CTAGCT, the target paired sequence is tctgaagcaatttaggtatgaaagcca, the second anti-interference sequence is AGTCAA, and the second stem paired sequence is gcgccg. Subsequent other sequences are by analogy.

[0083] Furthermore, the fluorescent marker of JMB-1 is FAM-BHQ1; the fluorescent marker of JMB-2 is VIC-BHQ1; the fluorescent marker of JMs is CY5-BHQ3; the fluorescent marker of JmZ is FAM-BHQ1; the fluorescent marker of HR1 is VIC-BHQ1; the fluorescent marker of B1-S is CY5-BHQ3; the fluorescent marker of NBL is FAM-BHQ1; and the fluorescent marker of B2-S is VIC-BHQ1.

[0084] Specifically, the sequence of the forward primer is: 5`-tgcagaactgcctattccta-3`; the sequence of the reverse primer is: 5`-ctggattgagactcctgtt-3`.

[0085] In this embodiment, fluorescent groups with different reporting light intensities are used in the fluorescent labeling, and different probes generate different intensities of fluorescent signals when excited in the droplet, so different fluorescent signal clusters are shown in the 2D result graph. During analysis, the insertion mutation can be judged based on different signal clusters, thereby further reducing the possibility of missed detection.

[0086] The negative control in this example is nuclease-free water, and the positive control is a fragmented plasmid standard, which includes at least one of the following: 7-3 (JMB1) plasmid, B2S plasmid, 6b-1 (JMB2) plasmid, 586 (JMs) plasmid, 3b (JmZ) plasmid, 612 (HR) plasmid, B1S plasmid, and NBL1 plasmid.

[0087] To further illustrate the above plasmid:

[0088] Among them, the 7-3 (JMB1) plasmid sequence is:

[0089] TGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAGGGTGGGGAGAAAACGTATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。

[0090] Among them, the plasmid sequence of 6b-1 (JMB2) is as follows:

[0091] GGGGAGTAGAGTATATGTAGAGTGGTTGTTAGGACTGAAAATGATTATTACTGAAACAGGATGTGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGGGAGAGAGAGAGATAATGATAATGAGTACTTCTACGTTGATATGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。

[0092] Among them, the plasmid sequence of 586 (JMs) is as follows:

[0093] TAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCTGCCATGTCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTACAGTATAGTGGAAGGACAGCAACAAAGATGCACAAAAATGGGAGGCACAGTTTCCCACCCATGCCTTCTTCTCTTTTCCATCCTTTTAATGGTTAC。

[0094] Among them, the plasmid sequence of 3b(JmZ) is as follows:

[0095] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTCTCAAATGGGAGTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。

[0096] Among them, the 612 (HR) plasmid sequence is:

[0097] CACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGAGCCTCTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTA。

[0098] Among them, the B1S plasmid sequence is:

[0099] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATGTACAGCATGTTTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。

[0100] Among them, the NBL1 plasmid sequence is:

[0101] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGTTCTAATGGACAATCCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。

[0102] Among them, the B2S plasmid sequence is:

[0103] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAG TTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAATTCTCGATACTAGACGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG.

[0104] Specifically, the sample of the kit is selected from plasma specimens or paraffin specimens. Preferably, it can only target DNA sequences. Specifically, the PCR is an asymmetric PCR method.

[0105] Specifically, the kit also includes Perfecta Multiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix includes dNTPs, Taq enzyme and PCR buffer.

[0106] In specific applications, the forward primer, reverse primer and probe are first diluted to 100 μM. The forward primer, reverse primer and probe are mixed separately and diluted to a final concentration of 5 μM, 10 μM and 5 μM respectively. The PCR reaction system is as follows:

[0107] Table 1 PCR reaction system

[0108] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 Total volume 25

[0109] The balance of the system is nuclease-free water.

[0110] Specifically, PCR adopts asymmetric PCR method, and the reaction procedure is as follows:

[0111] Table 2 PCR reaction procedure

[0112]

[0113]

[0114] Specific:

[0115] Loading the PCR reaction system into the digital PCR chip;

[0116] The digital PCR chip is placed in a digital PCR instrument to perform PCR amplification to obtain an amplification result;

[0117] The digital PCR chip having the amplification result is placed in a chip scanner for fluorescence signal scanning, and the mutation result is interpreted according to the fluorescence signal.

[0118] Specific experimental process:

[0119] Primer and probe dilution: Forward primer, reverse primer and probe are first diluted to 100 μM. Forward primer, reverse primer and probe are mixed and diluted to final concentrations of 5 μM, 10 μM and 5 μM respectively. According to Table 3:

[0120] Table 3 PCR reaction system

[0121] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 Total volume 25

[0122] The balance of the system is nuclease-free water.

[0123] Plasmid dilution: Plasmid powder was first diluted to 40 ng / μL using ddH 2 O dilute the gradient to 10-6.

[0124] Digital PCR was performed using the Naica Crystal Digital PCR System (Stilla).

[0125] PCR adopts asymmetric PCR method, and the reaction procedure is as follows:

[0126] Table 4 PCR reaction program

[0127]

[0128]

[0129] The yin and yang quality control products are wild-type cell line genomic DNA, which is cultured and extracted by our company. Of course, commercially available products can also be used or purchased from a genetic company based on the sequence provided in this application.

[0130] In the specific experimental example, when the Blue probe does not bind, the result is as follows Figure 1 When the green probe does not bind, the result is as follows Figure 2 When the red probe does not bind, the result is as follows Figure 3 As shown. Figures 1 to 3 It can be seen that the PCR amplification reagent, kit and method for detecting FLT3-ITD gene mutation of the present application can better distinguish FLT3-ITD gene mutation.

[0131] The present application has at least the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver fresh samples in time in the flow cytometry detection method; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect known site-specific mutations of FLT3-ITD, and can detect diverse unknown non-site-specific gene mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability when using multiple probes compared to fluorescent quantitative PCR detection. Since each probe uses a different fluorescent marker and a probe with a stem-loop structure, the fluorescence interference between the probes is relatively small and the sensitivity is relatively high.

[0132] The present application is described below in conjunction with specific embodiments.

[0133] Example 1

[0134] The B1S plasmid was detected using the B1-S probe (red) in singleplex, while the wild-type cell line genomic DNA was detected as a control.

[0135] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0136] The system settings are as follows:

[0137]

[0138]

[0139] The sample layout is as follows:

[0140] chip sample A hole B1S Plasmid B hole Wild-type cell line genomic DNA

[0141] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set as shown in the following table:

[0142]

[0143] Test results: The B1-S probe is a wild-type sequence designed for the B1S site of the FLT3 gene. The result should be that the B1S plasmid cannot be detected, while the wild-type cell line genomic DNA can be hydrolyzed and emit fluorescence in the PCR reaction because the beacon probe can bind to the template. However, during the pressure release process, the previously hydrolyzed probes are recombined to cause fluorescence quenching. Therefore, the result is that the B1S plasmid and the wild-type cell line genomic DNA have no signal in the CY5 channel, which is in line with expectations. The test results are as follows:

[0144] Copy number concentration test results

[0145]

[0146] Figure 4a This is the fluorescence detection result of B1S plasmid. Figure 4b This is the fluorescence detection result of genomic DNA of wild-type cell line.

[0147] Example 2

[0148] HR1 probe (green) and B1-S probe (red) were used to detect B1S plasmid and wild-type cell line genomic DNA samples. The anti-interference sequence and stem sequence of HR1 and B1-S probes do not match.

[0149] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0150] The system is as follows:

[0151] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 BsrBI restriction enzyme 0.5 Total volume Total added up to 25

[0152] The sample layout is as follows:

[0153] chip sample A hole B1S Plasmid B hole Wild-type cell line genomic DNA

[0154] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. The settings are as follows:

[0155]

[0156] Test results: HR1 and B1-S probes are wild-type sequences designed for the 612 (HR) and B1S sites of the FLT3 gene, and the anti-interference sequences of the HR1 and B1-S probes are not paired. The result should be that the HR1 probe binds to the B1S plasmid in the early stage and hydrolyzes to emit light, but the hydrolyzed head and tail re-bind when the pressure is released and the fluorescence is quenched. For the wild-type cell line genomic DNA, both the HR1 and B1-S probes can bind to it and hydrolyze to emit light, and re-bind when the pressure is released and the fluorescence is quenched. Therefore, the result is that there is no signal for both the B1S plasmid and the wild-type cell line genomic DNA, which is in line with expectations. The test results are as follows:

[0157] Copy number concentration test results

[0158]

[0159] Figure 5a This is the fluorescence detection result of B1S plasmid. Figure 5b This is the fluorescence detection result of genomic DNA of wild-type cell line.

[0160] Example 3

[0161] The first stem pairing sequence of the JmZ probe (blue) - the first anti-interference sequence and the second anti-interference sequence of the HR1 probe (green) - the second stem pairing sequence. The JmZ and HR1 probes with equal molar concentrations were used to simultaneously detect 3b (JmZ) plasmid and wild-type cell line genomic DNA samples.

[0162] Sample information: 1 μL of 10-6 dilution of 3b (JmZ) plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0163] The system is as follows:

[0164] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 BsrBI restriction enzyme 0.5 Total volume Total added up to 25

[0165] The sample layout is as follows:

[0166]

[0167]

[0168] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set as shown in the following table:

[0169]

[0170] Test results: JmZ and HR1 probes are wild-type sequences designed for the 3b (JmZ) and 612 (HR) sites of the FLT3 gene, and the first stem pairing sequence of JmZ - the first anti-interference sequence and the second anti-interference sequence of the HR1 probe - the second stem pairing sequence are paired. The result should be that for the 3b (JmZ) plasmid, the HR1 probe can bind to it and hydrolyze to emit light, the second anti-interference sequence of the HR1 probe binds to the first anti-interference sequence of JmZ, and when the pressure is released, the first stem pairing sequence of HR1 binds to the second stem pairing sequence of JmZ, which quenches the hydrolyzed HR1 probe. The genomic DNA of the wild-type cell line can be hydrolyzed and emit light because both the JmZ and HR1 probes can bind to it, and when the pressure is released, they re-bind and the fluorescence is quenched. Therefore, the result is that there is no signal in the JmZ and HR1 channels for the 3b (JmZ) plasmid and the genomic DNA of the wild-type cell line, which is in line with expectations. The test results are as follows:

[0171] Copy number concentration test results

[0172]

[0173] Figure 6a This is the fluorescence detection result of 3b(JmZ) plasmid. Figure 6b This is the fluorescence detection result of genomic DNA of wild-type cell line.

[0174] Example 4

[0175] The first stem pairing sequence of the JMB-2 probe (green) - the first anti-interference sequence and the second anti-interference sequence of the JmZ probe (blue) - the second stem pairing sequence. The JmZ and JMB-2 probes with equal molar concentrations were used to simultaneously detect 3b (JmZ) plasmid and wild-type cell line genomic DNA samples.

[0176] Sample information: 1 μL of 10-6 dilution of 3b (JmZ) plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0177] The system is as follows:

[0178]

[0179] The sample layout is as follows:

[0180] chip sample A hole 3b(JmZ) Plasmid B hole Wild-type cell line genomic DNA

[0181] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set as follows:

[0182]

[0183] Detection results: JmZ and JMB-2 probes are wild-type sequences designed for the 3b (JmZ) and 6b-1 (JMB2) sites of the FLT3 gene, and the first stem pairing sequence of JMB-2 - the first anti-interference sequence and the second anti-interference sequence of the JmZ probe - the second stem pairing sequence are paired. The result should be that for the 3b (JmZ) plasmid, JMB-2 can bind to it and hydrolyze and emit light. When the temperature is lowered, the stem-loop structure of the JmZ probe opens, and the hydrolyzed head of the JMB-2 probe can bind to and extend with the second anti-interference sequence of the JmZ probe, making it impossible for the second stem pairing sequence of JMB-2 to bind to the second stem pairing sequence of the JmZ probe, and emit light in the FAM channel. The genomic DNA of the wild-type cell line can be hydrolyzed and emit light because both the JmZ and JMB-2 probes can bind to it, and they rebind when the pressure is released and the fluorescence is quenched. Therefore, the result is that the 3b (JmZ) plasmid has a signal in the JmZ channel but no signal in the JMB-2 channel, while the wild-type cell line genomic DNA has no signal in both the JmZ channel and the JMB-2 channel, which is in line with expectations. The test results are as follows:

[0184] Copy number concentration test results

[0185]

[0186] Figure 7a This is the fluorescence detection result of 3b(JmZ) plasmid. Figure 7b This is the fluorescence detection result of genomic DNA of wild-type cell line.

[0187] Example 5

[0188] The first stem pairing sequence of the B1-S probe (red) and the JMs probe (red) - the first anti-interference sequence and the second anti-interference sequence - the second stem pairing sequence are paired with each other. B1-S and JMs probes with equal molar concentrations were used to simultaneously detect B1S plasmid and wild-type cell line genomic DNA.

[0189] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0190] The system is as follows:

[0191]

[0192]

[0193] The sample layout is as follows:

[0194] chip sample A hole B1S Plasmid B hole Wild-type cell line genomic DNA

[0195] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set it according to the following table:

[0196]

[0197] Test results: B1-S and JMs beacon probes are wild-type sequences designed for the B1S and 586 (JMs) sites of the FLT3 gene, and the first stem pairing sequence - the first anti-interference sequence and the second anti-interference sequence - the second stem pairing sequence of the two beacon probes are paired with each other. The result should be that the B1S plasmid is detected in the B1-S channel but not in the wild-type cell line genomic DNA. Therefore, the result is that the B1S plasmid has a signal only in the CY5 channel, while the wild-type cell line genomic DNA has no signal in all channels, which is in line with expectations. The test results are as follows:

[0198] Copy number concentration test results

[0199]

[0200] Figure 8a This is the fluorescence detection result of B1S plasmid. Figure 8b This is the fluorescence detection result of genomic DNA of wild-type cell line.

[0201] Example 6

[0202] Different reaction procedures were used to detect the first stem pairing sequence of the JMB-2 probe (green) - the first anti-interference sequence and the second anti-interference sequence of the JmZ probe (blue) - the second stem pairing sequence. The JmZ and JMB-2 probes with equal molar concentrations were used to simultaneously detect 3b (JmZ) plasmid and wild-type cell line genomic DNA samples.

[0203] Sample information: 1 μL of 10-6 dilution of 3b (JmZ) plasmid and 1 μL of genomic DNA of wild-type cell line were loaded.

[0204] The system is as follows:

[0205] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 BsrBI restriction enzyme 0.5 Total volume Total added up to 25

[0206] The sample layout is set up according to the following table:

[0207] chip sample A1 hole 3b(JmZ) Plasmid B1 hole Wild-type cell line genomic DNA A2 hole 3b(JmZ) Plasmid B2 hole Wild-type cell line genomic DNA

[0208] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.

[0209] PCR reaction program 1 is set as follows:

[0210]

[0211]

[0212] PCR reaction program 2 is set as follows:

[0213]

[0214] Detection results: JmZ and JMB-2 probes are wild-type sequences designed for the 3b (JmZ) and 6b-1 (JMB2) sites of the FLT3 gene, and the first stem pairing sequence of the JMB-2 probe - the first anti-interference sequence and the second anti-interference sequence of the JmZ probe - the second stem pairing sequence are paired. The results are that when the 3b (JmZ) plasmid is amplified using reaction procedure 1, the JMB-2 probe can bind to it and hydrolyze to emit light. When the temperature is lowered, the stem-loop structure of the JmZ probe opens, and the hydrolyzed head of the JMB-2 probe can bind to and extend with the second anti-interference sequence of the JmZ probe, so that the second stem pairing sequence of JMB-2 and the second stem pairing sequence of the JmZ probe cannot bind to each other and emit light in the JmZ channel. The genomic DNA of the wild-type cell line can be hydrolyzed to emit light because both the JmZ and JMB-2 probes can bind to it, and they re-bind when the pressure is released and the fluorescence is quenched. When reaction procedure 2 is used, the hydrolyzed head of the JMB-2 probe does not fully bind to the second anti-interference sequence of the JmZ probe due to the lack of a binding procedure, resulting in a decrease in positive droplets in the FAM channel. Therefore, the result is that the 3b (JmZ) plasmid has a signal only in the JmZ channel, and the number of positive droplets in the FAM channel is reduced when using reaction program 2 compared to reaction program 1, while the genomic DNA of the wild-type cell line has no signal in both the JmZ channel and the JMB-2 channel, which is in line with expectations. The test results are as follows:

[0215] Copy number concentration test results

[0216]

[0217]

[0218] Figure 9a This is the fluorescence detection result of 3b(JmZ) plasmid in reaction procedure 1. Figure 9b This is the fluorescence detection result of 3b(JmZ) plasmid in reaction procedure 2.

[0219] Fig.10a This is the fluorescence detection result of the wild-type cell line genomic DNA in reaction procedure 1. Fig.10b This is the fluorescence detection result of genomic DNA of wild-type cell line in reaction procedure 2.

[0220] Example 7

[0221] The wild-type cell line genomic DNA was used to prepare the B1S plasmid into samples with different mutation concentrations (0.05%, 0.1%, 0.2%, 0.3%, 0.5%) for sensitivity detection. The first stem pairing sequence of the B1-S probe (red) and the JMs probe (red) - the first anti-interference sequence and the second anti-interference sequence - the second stem pairing sequence were paired with each other. The B1S plasmids of different concentrations were detected using B1-S and JMs probes with equal molar concentrations, and two replicates were set up. The wild-type cell line genomic DNA was also detected as a control.

[0222] Sample information: 1 μL of B1S plasmid samples with different mutation concentrations (0.05%, 0.1%, 0.2%, 0.3%, 0.5%) was loaded, and 1 μL of wild-type cell line genomic DNA was loaded.

[0223] The system settings are as follows:

[0224] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mixture (10μM each) 1 Probe mixture (5μM each) 1 Sample 1 BsrBI restriction enzyme 0.5 Total volume Total added up to 25

[0225] The sample layout is as follows:

[0226]

[0227]

[0228] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification. The specific settings are as follows:

[0229]

[0230] Test results: B1-S was tested using different concentration gradients. The results showed that the B1S plasmid only had a signal in the B1-S channel, while the wild-type cell line genomic DNA had no signal in all channels, which was in line with expectations. It was also detected under a 0.05% B1S plasmid concentration. The test results are as follows:

[0231] Copy number concentration test results

[0232]

[0233]

[0234] Fig.11a The fluorescence detection result of the concentration of 0.05% in well A1 is shown in the figure. Fig.11b The fluorescence detection result diagram of the concentration of 0.05% in well B1;

[0235] Fig.12a The fluorescence detection result of the concentration of 0.1% in C1 well is shown in the figure. Figure 12bThe fluorescence detection result diagram of the D1 well at a concentration of 0.1%;

[0236] Fig.13a The fluorescence detection result of the concentration of 0.2% in well A2 is shown in the figure. Fig.13b The fluorescence detection result diagram of the concentration of 0.2% in well B2;

[0237] Fig.14a The fluorescence detection result of the concentration of 0.3% in C2 well is shown in the figure. Fig.14b The fluorescence detection result diagram of the D2 well at a concentration of 0.3%;

[0238] Fig.15a The fluorescence detection result of the concentration of 0.5% in well A3 is shown in the figure. Fig.15b The fluorescence detection result diagram of the concentration of 0.5% in well B3;

[0239] Fig.16 This is the fluorescence detection result of wild-type cell line genomic DNA in C3 well.

[0240] The present application has at least the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver fresh samples in time in the flow cytometry detection method; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect FLT3-ITD site mutations, and can detect diverse tandem mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability when using multiple probes compared to fluorescent quantitative PCR detection. Since each probe uses a different fluorescent marker and a probe with a stem-loop structure, the fluorescence interference between the probes is relatively small and the sensitivity is relatively high.

[0241] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. It should be noted that "in one embodiment", "for example", "for example", etc. in this application are intended to illustrate the present application, rather than to limit the present application. The above-described embodiments only express several implementation methods of the present application, and the description is relatively specific and detailed, but it cannot be understood as a limitation on the scope of the patent application. It should be pointed out that for a person of ordinary skill in the art, without departing from the concept of the present application, several variations and improvements can also be made, which all belong to the scope of protection of the present application. Therefore, the scope of protection of the patent in this application shall be subject to the attached claims.

Claims

1. A beacon probe combination, characterized in that: It comprises a plurality of beacon probes, wherein the beacon probes are a first stem pairing sequence-a first anti-interference sequence-a target pairing sequence-a second anti-interference sequence-a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe, wherein the first anti-interference sequence of one beacon probe is paired with the second anti-interference sequence of another beacon probe, so that the beacon probe cannot be restored to the stem-loop structure during renaturation; after the second anti-interference sequence of one beacon probe is paired with the second anti-interference sequence of another beacon probe, the fluorescent marker and the quenching marker on the paired side of each beacon probe are brought close to quench the fluorescence.

2. The beacon probe assembly according to claim 1, characterized in that: In a pairing of the first anti-interference sequence of one of the beacon probes and the second anti-interference sequence of another of the beacon probes, the two beacon probes are labeled with different fluorescent labels.

3. The beacon probe assembly according to claim 1, characterized in that: After the target pairing sequence in the beacon probe is paired with the template chain, the target pairing sequence in the middle of the beacon probe is hydrolyzed under the activity of 5`-3` exonuclease to release the stem pairing sequence-anti-interference sequence at the opposite ends of the target pairing sequence, wherein at least one sequence of the released stem pairing sequence-anti-interference sequence is paired and bound to each other, and the fluorescent marker and quenching marker on the paired side of each beacon probe are brought close to quench the fluorescence.

4. The beacon probe assembly according to claim 1, characterized in that: The length of the first anti-interference sequence and / or the second anti-interference sequence is 4-10 bp.

5. The beacon probe assembly according to claim 1, characterized in that: The first anti-interference sequence of each beacon probe can be paired with the second anti-interference sequence of another beacon probe so that the fluorescent label and the quenching label on the pairing side are brought closer to each other to quench the fluorescence; the length of the first anti-interference sequence and / or the second anti-interference sequence is 6bp, and the first anti-interference sequence and / or the second anti-interference sequence includes at least one of the following sequences: CTAGCT, AGTTCC, CACGAT, TCGAAG, GTAGAG, GTTTCG, TGACAC, AGTCAA, AGCTAG, GGAACT, ATCGTG, CTTCGA, CTCTAC, CGAAAC, TTGACT, GTGTCA.

6. The beacon probe assembly according to claim 1, characterized in that: The molar concentrations of paired beacon probes were equal.

7. A PCR amplification reagent, characterized in that: Comprising the beacon probe combination as described in any one of claims 1 to 6.

8. A kit for detecting gene mutations, characterized in that: Comprising the beacon probe combination as described in any one of claims 1 to 6.

9. A PCR amplification reagent for detecting FLT3-ITD gene mutation, characterized in that: include: A forward primer, a reverse primer and a plurality of beacon probe combinations as described in any one of claims 1 to 6, wherein the plurality of beacon probe sequences are different, and the forward primer, the reverse primer and the plurality of beacon probe sequences are used for droplet digital PCR amplification using the FLT3-ITD gene as a template, and each of the probe sequences is labeled with a different fluorescent marker.

10. The PCR amplification reagent according to claim 9, characterized in that The sequence of the forward primer is: 5`-tgcagaactgcctattccta-3`; The sequence of the reverse primer is: 5`-ctggattgagactcctgtt-3`.

11. The PCR amplification reagent according to claim 10, characterized in that: The plurality of probe sequences include at least one of JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S, wherein: The sequence of JMB-1 is: 5`-cggcgcCTAGCTtctgaagCAATTTAGGTATGAAAGCCAAGTCAAgcgccg-3`; The sequence of JMB-2 is: 5`-cggcgcAGTTCCAGCCAGCTACAGATGGTACAGGTAGCTAGgcgccg-3`; The sequence of JMs is: 5`-cggcgcCACGATCAGGTGACCGGCTCCTCAGATACGAAACgcgccg-3`; The sequence of JmZ is: 5`-cggcgcTCGAAGAGATAATGAGTACTTCTACGTTGATGGAACTgcgccg-3`; The sequence of HR1 is: 5`-cggcgcGTAGAGCAAATGGGAGTTTCCAAGAGAAAATcttcgagcgccg-3`; The sequence of B1-S is: 5`-cggcgcGTTTCGGAAAATTTAGAGTTTGgtaagaatgATCGTGgcgccg-3`; The sequence of NBL is: 5`-cggcgcTGACACgtctttgcagGGAAGGTACTAGGATCCTCTACgcgccg-3`; The sequence of B2-S is: 5`-cggcgcTTGACTAGGATCAGGTGCTTTTGGAAAAGGTGTCAgcgccg-3`.

12. A kit for detecting FLT3-ITD gene mutation, characterized in that: Comprising a PCR amplification reagent as described in any one of claims 9 to 11.

13. The kit according to claim 12, characterized in that The sample of the kit is selected from plasma specimens or paraffin specimens; the kit also includes controls, which include positive controls and negative controls, wherein the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard.

14. The kit according to claim 12, characterized in that The PCR was an asymmetric PCR method.

15. The kit according to claim 12, characterized in that The kit also includes PerfectaMultiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix includes dNTPs, Taq enzyme and PCR buffer.

Images