Method and application of IFN-δ8 in inhibiting porcine coronavirus infection in vitro
By using interferon IFN-δ8 to inhibit porcine coronavirus infection in cell culture, the problem of lack of effective anti-porcine coronavirus drugs in the existing technology was solved, and the infection amount and virus titer of porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus were significantly reduced.
Patent Information
- Application Number
- CN202410038357.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-11
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-01-11
AI Technical Summary
There is currently a lack of effective drugs against porcine coronavirus infections, especially specific drugs for porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus, which leads to serious viral infections, especially serious harm to piglets, with high morbidity and mortality rates.
Interferon IFN-δ8 is used in the preparation of drugs to inhibit porcine coronavirus infection. By adding IFN-δ8 during the cell culture process, the RNA content, protein expression and virus titer of porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus are significantly inhibited.
IFN-δ8 significantly reduced the infection level, RNA content, protein expression and viral titer of three porcine coronaviruses, providing an effective antiviral drug solution and reducing the severity of viral infection.
Smart Images

Figure CN117838837B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method and application of IFN-δ8 for inhibiting porcine coronavirus infection in vitro, belonging to the technical fields of cell biology and virology. Background Art
[0002] IFN-δ8 is a novel porcine type I interferon (Gene accession GQ415081). Studies have shown that IFN-δ8 has antiviral effects against porcine reproductive and respiratory syndrome virus (PRRSV), a member of the Arteriviridae family. This virus causes reproductive failure in sows and respiratory distress in pigs of all ages. Coronaviruses, such as porcine epidemic diarrhea virus (PEDV), porcine delta coronavirus, and porcine acute diarrhea syndrome coronavirus, are enteroviruses that cause diarrhea in piglets and pose a serious threat to their survival. Currently, no interferon-based antiviral biologicals have been reported to target these viruses.
[0003] Porcine Epidemic Diarrhea Virus (PEDV) is an acute, highly contagious enteric virus characterized by acute diarrhea, vomiting, and dehydration. It is the most devastating diarrheal virus in the swine industry today, aside from African swine fever virus. It primarily affects piglets under 10 days old, with morbidity reaching 100% and a mortality rate of 80%, with rates reaching as high as 100%. Porcine deltacoronavirus (PDCoV) primarily causes vomiting, diarrhea, dehydration, and even death in newborn piglets. It can infect pigs of all ages, but is most devastating in newborn piglets, with a mortality rate of approximately 50%. Swine Acute Diarrhea Syndrome Coronavirus (SADS-CoV) first appeared in Guangdong in early 2017. Clinical manifestations include acute diarrhea and vomiting in infected piglets. Infected piglets under 7 days old experience rapid weight loss, severe dehydration, and subsequent death, with a mortality rate as high as 90%.
[0004] All three coronaviruses belong to the Coronaviridae family and are enveloped, single-stranded, positive-sense RNA viruses. PEDV primarily infects IPEC-J2 cells in vitro, while PDCoV and SADS-CoV primarily infect porcine testicular ST cells in vitro. Currently, there are no clinically effective drugs against these three coronaviruses, hindering their effective prevention and control. Therefore, developing antiviral drugs targeting these three coronaviruses to reduce morbidity and mortality in pigs is a top priority. Summary of the Invention
[0005] In view of the deficiencies of the prior art, the present invention provides a method and application of IFN-δ8 in inhibiting porcine coronavirus infection in vitro.
[0006] In order to achieve the above object, the technical solution adopted by the present invention is:
[0007] Application of interferon IFN-δ8 in the preparation of drugs for inhibiting porcine coronavirus infection.
[0008] The interferon IFN-δ8 is used in the preparation of a drug for inhibiting the viral RNA content of porcine coronavirus infection.
[0009] The interferon IFN-δ8 is used in the preparation of a drug for inhibiting the abundance of viral proteins infected by porcine coronavirus.
[0010] The interferon IFN-δ8 is used in the preparation of a drug for inhibiting the viral titer of porcine coronavirus infection.
[0011] Furthermore, the porcine coronavirus includes porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus.
[0012] Furthermore, the effective concentration of interferon IFN-δ8 in the application is 0.03-3 mg / mL.
[0013] A method for inhibiting porcine epidemic diarrhea virus infection in vitro using interferon IFN-δ8, comprising the following steps:
[0014] (1) IPEC-J2 cells were cultured at a rate of 2.5×10 5 Cells were plated at a concentration of 1 / mL in a 12-well cell culture plate, 500 μL of DMEM medium was added to each well, and the plates were cultured in a 37°C, 5% CO2 incubator for 24 h. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer.
[0015] (2) Add 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 to the cell culture wells and continue culturing at 37°C for 12 h. Discard the medium in the 12-well cell culture plate, wash the cells three times with PBS buffer, and replace with new DMEM medium.
[0016] (3) The PEDV strain was inoculated into a 12-well cell culture plate at a virus infection multiplicity of infection (MOI) of 0.01, and trypsin was added at a final concentration of 8.5 μg / mL. The cells were cultured in a 37°C, 5% CO2 incubator for 12 h.
[0017] A method for inhibiting porcine delta coronavirus or porcine acute diarrhea syndrome coronavirus infection in vitro using interferon IFN-δ8, comprising the following steps:
[0018] (1) ST cells were cultured at a rate of 2.5×10 5 Cells were plated at a concentration of 1 / mL in a 12-well cell culture plate, 500 μL of DMEM medium was added to each well, and the plates were cultured in a 37°C, 5% CO2 incubator for 24 h. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer.
[0019] (2) Add 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 to the cell culture wells and continue culturing at 37°C for 12 h. Discard the medium in the 12-well cell culture plate, wash the cells three times with PBS buffer, and replace with new DMEM medium.
[0020] (3) PDCoV or SADS-CoV strains were inoculated into 12-well cell culture plates at a multiplicity of infection (MOI) of 0.01, and trypsin was added at a final concentration of 4 μg / mL. The plates were cultured in a 37°C, 5% CO2 incubator for 12 h.
[0021] The DMEM culture medium contains 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin.
[0022] Beneficial effects of the present invention:
[0023] The present invention utilizes a combination of cell biology and virology techniques to discover that IFN-δ8 inhibits infection with three porcine coronaviruses in vitro. The cytotoxicity of the three porcine coronaviruses was first tested, and the inhibitory effect of non-cytotoxic IFN-δ8 on the three porcine coronaviruses in vitro was assessed using fluorescent quantitative PCR (RT-qPCR), Western blotting, and viral titer. It was found that IFN-δ8 significantly inhibited RNA content, protein expression, and viral titer during infection with the three porcine coronaviruses in vitro.
[0024] The present invention uses the inhibitor IFN-δ8, which can significantly inhibit the in vitro infection of three porcine coronaviruses. When IFN-δ8 was added at a concentration of 3 mg / mL during the infection of IPEC-J2 cells with PEDV, the RNA content, protein expression, and viral titer of PEDV in the treatment group with IFN-δ8 were significantly reduced compared to the treatment group without IFN-δ8. Similarly, when 3 mg / mL IFN-δ8 was added during the infection of ST cells with PDCoV and SADS-CoV, the RNA content, protein expression, and viral titer of PDCoV and SADS-CoV in the treatment group with IFN-δ8 were significantly reduced compared to the treatment group without IFN-δ8. Therefore, it can be predicted that IFN-δ8 can be used to prepare antiviral drugs against the three porcine coronavirus infections. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 :Western blot identification of recombinant protein IFN-δ8;
[0026] Figure 2 :Purity identification diagram of recombinant protein IFN-δ8;
[0027] Figure 3 : Bar graph of IFN-δ8 cytotoxicity to IPEC-J2 cells;
[0028] Figure 4 : Histogram of PEDV virus copy number in IPEC-J2 cells infected with PEDV;
[0029] Figure 5 :Western blot and bar graph of PEDV virus protein expression in IPEC-J2 cells infected with PEDV;
[0030] Figure 6 : Bar graph of PEDV virus titers in IPEC-J2 cells infected with PEDV;
[0031] Figure 7 : Histogram of IFN-δ8 cytotoxicity to ST cells;
[0032] Figure 8 : Histogram of PDCoV virus copy number in ST cells infected with PDCoV;
[0033] Figure 9 :Western blot and histogram of PDCoV viral protein expression in ST cells infected with PDCoV;
[0034] Figure 10 : Histogram of PDCoV virus titers in ST cells infected with PDCoV;
[0035] Figure 11 : Histogram of SADS-CoV virus copy number in ST cells infected with SADS-CoV;
[0036] Figure 12 :Western blot and bar graph of SADS-CoV viral protein expression in ST cells infected with SADS-CoV;
[0037] Figure 13 : Bar graph of SADS-CoV virus titers in ST cells infected with SADS-CoV. DETAILED DESCRIPTION
[0038] The specific embodiments of the present invention are further described in detail below with reference to the examples.
[0039] Example 1 Preparation of recombinant protein IFN-δ8
[0040] First, the IFN-δ8 gene (sequence shown in SEQ ID NO. 1) was ligated with pcDNA3.1 at 16°C overnight using T4-DNA ligase to construct the pcDNA3.1-IFN-δ8 expression vector. The plasmid was then extracted using an endotoxin-free plasmid extraction kit (Congwei Century, catalog number CW2107). The HEK-293F cell density was adjusted to 5 × 10 5 pcDNA3.1-IFN-δ8 was transfected into HEK293F cells using PEI (Yisheng Biotechnology, Cat. No. 40815ES03) and cultured in a suspension cell incubator at 37°C, 5% CO2, and 120 rpm for 4 days. The supernatant was then collected by centrifugation and the recombinant IFN-δ8 protein was purified using a nickel column and molecular sieves. The recombinant IFN-δ8 protein was identified by Western blot and the purity of the recombinant IFN-δ8 was determined by SDS-PAGE. Figure 1 As shown in the figure, a black band appeared at the expected size of 18 kD, indicating that the 6×His tag of IFN-δ8 can react with the 6×His monoclonal antibody, proving that the recombinant protein IFN-δ8 can be expressed correctly. Figure 2 As shown in the figure, when the loading amount of purified recombinant IFN-δ8 was 1 μg, there were only two bands on the electrophoresis graph, both of which were recombinant IFN-δ8. The appearance of the two bands was due to the inconsistent glycosylation modification of the protein by the baculovirus expression system. No other miscellaneous bands were seen, indicating that the purified recombinant protein IFN-δ8 was of high purity.
[0041] ATGTACAGAATGCAGCTGTTGTCTTGCATCGCTCTGTCTCTGGCACTGGTGACAAACA
[0042] GTCAGAACCTGAGCGGCATCGAGAACCGGAAAACCTTCATGATACTGAGACAGATGA
[0043] AGAGAATCCATAGCCACCTGTGTCTGAAAGATCGGACTGACTTCCAGTTCCCTTGGAA
[0044] ACGCGGCAATACCACTCAGAACAAGATGACACAGGGCAGCTGTTACCATCCACTGAT
[0045] GCTCCAGCAGATCATCAACCTGTTCAACACTGAGAACTCTAGGGCTGCTTGGAACAA
[0046] CGCTCTTCTCGATCAGTTGCTGAGCAGGCTGGACCACGGTTTGGAACAGTTGGAGCA
[0047] GATGGAAGATGATAACCTGGCATGTGCCTACTTGGGCTCTGTGGTGCGGAAATACTTC
[0048] CAGCGGATTCACCACTATCTGAAGAAGAAAGAGTACAGCAGCTGCGCTTGGGAAGTC
[0049] GTGAGAGTGGAGATTGTCGGTGTTTGAGCCTGATCCATCACCACCATCACCACTGA(SEQ IDNO.1)
[0050] Example 2: Experiment on the inhibition of PEDV infection by IFN-δ8 in vitro
[0051] 1. Identification of IFN-δ8 toxicity to IPEC-J2 cells
[0052] IPEC-J2 cells were cultured at a rate of 0.5 × 10 5 Cells were plated at a concentration of 100 μL / mL in a 96-well cell culture plate. 100 μL of DMEM medium (Beijing Solebao Technology Co., Ltd., Catalog No. 12100) containing 10% (v / v) heat-inactivated fetal bovine serum (Sangon, Catalog No. E600001-0500), 100 U / mL penicillin, and 100 μg / mL streptomycin was added to each well and cultured in a 37°C, 5% CO2 incubator for 24 h. The original cell culture medium was removed and replaced with DMEM medium containing different concentrations of IFN-δ8 (0, 0.0003, 0.003, 0.03, 0.3, and 3 mg / mL) for 24 h at 37°C. The cells were then washed three times with PBS buffer and CCK-8 reagent was added according to the manufacturer's instructions. The cells were cultured in a 37°C, 5% CO2 incubator for 2 h. Cytotoxicity was assessed using a microplate reader. Statistical analysis was performed using GraphPadPrism 8.0 software with unpaired, two-tailed Student's t test; ns indicates no significant difference.
[0053] The results are as follows Figure 3 As shown, compared with the cell activity of the control group without IFN-δ8 (0 mg / mL) (cell activity is 100%), the treatment groups with 0.0003, 0.003, 0.03, 0.3, and 3 mg / mL IFN-δ8 had no significant effect on cell activity (ns), that is, no cytotoxicity, and can be used in subsequent examples.
[0054] 2. Effect of IFN-δ8 on PEDV RNA Content in IPEC-J2 Cells Infected with PEDV
[0055] IPEC-J2 cells were cultured at a rate of 2.5 × 10 5 Cells were plated at a concentration of 100 μg / mL in a 12-well cell culture plate. 500 μL of DMEM medium was added to each well and the cells were cultured in a 37°C, 5% CO2 incubator for 24 hours. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and cultured at 37°C for another 12 hours. Uninfected PEDV-infected IPEC-J2 cells without IFN-δ8 were used as a control. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. Fresh DMEM medium was replaced, and PEDV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added to a final concentration of 8.5 μg / mL, and the cells were cultured in a 37°C, 5% CO2 incubator for 12 hours. The cells were collected, the supernatant discarded, and the cells were washed three times with PBS; 1 mL of trizol lysis buffer was added and allowed to stand for about 1 min. The cells in the wells were blown off with a pipette and collected into an RNase-free centrifuge tube. RNA was extracted, and complementary DNA (cDNA) was generated using a reverse transcription kit (Dalian TaKaRa Company, Catalog No. RR036A) as a template for RT-qPCR; the PEDV nucleocapsid protein (N) RNA content was measured by absolute RT-qPCR to represent the viral RNA content in infected cells; the primers and reaction system are shown in Tables 1 and 2, respectively; among them, the staining method fluorescence quantitative premix used AceQ Universal SYBRqPCR Master Mix (Nanjing Novozymes Biotechnology Co., Ltd., Catalog No. Q511-03); the reaction program used the Fast program provided with the ABI fluorescence quantitative PCR instrument (Applied Biosystems, USA).
[0056] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p<0.001 indicates a highly significant difference. Figure 4 As shown in the figure, compared with the control group without IFN-δ8 (0 mg / mL), the PEDV RNA content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (reduced by >99%), indicating that IFN-δ8 can significantly reduce the PEDV RNA content in IPEC-J2 cells infected with IFN-δ8.
[0057] Table 1 Primer sequences for absolute fluorescence quantitative PCR
[0058]
[0059] Table 2 Absolute fluorescence quantitative PCR reaction system
[0060]
[0061] 3. Effect of IFN-δ8 on PEDV protein content in IPEC-J2 cells infected with PEDV
[0062] To verify whether IFN-δ8 can reduce the expression of PEDV protein in IPEC-J2 cells infected with PEDV, Western blot was performed to detect the PEDVN protein content after IFN-δ8 treatment.
[0063] IPEC-J2 cells were cultured at a rate of 2.5 × 10 5 The cells were plated at a concentration of 1 μg / mL in a 12-well cell culture plate and incubated at 37°C, 5% CO₂ incubator for 24 hours. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and incubated at 37°C for another 12 hours. Uninfected IPEC-J2 cells without IFN-δ8 were used as a control. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. Fresh DMEM medium was replaced, and PEDV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added at a final concentration of 8.5 μg / mL, and the cells were incubated at 37°C, 5% CO₂ incubator for 12 hours. The cells were harvested, the supernatant discarded, and the cells were washed three times with PBS. The cells were then lysed by adding 200 μL of 1x SDS loading buffer. Gel preparation, electrophoresis, membrane transfer, and blocking procedures were performed according to the second edition of the Genetic Engineering Experiment Guide. PEDV-N mAb (this monoclonal antibody was screened and stored in our laboratory) was used as the primary antibody, and HRP-labeled goat anti-mouse antibody (Jackson, 115-035-166) was used as the secondary antibody. After incubation with an ultrasensitive ECL chemiluminescence kit (Suzhou Xinsaimei Biotechnology Co., Ltd., cat. no. P10300), images were taken using a chemiluminescence colorimeter (ImageQuant 800).
[0064] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p < 0.001 indicates a highly significant statistical difference. Figure 5As shown, GAPDH was used as an internal reference, and the same GAPDH content was used to represent the same number of cells. In the same number of cells, compared with the control group without IFN-δ8 (0 mg / mL), the PEDV N protein content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (by about 90%), indicating that IFN-δ8 can significantly reduce the expression of PEDV N protein in IPEC-J2 infection.
[0065] 4. Effect of IFN-δ8 on PEDV virus titer in IPEC-J2 cells infected with PEDV
[0066] To further confirm that IFN-δ8 inhibits the infection of IPEC-J2 cells with PEDV, IPEC-J2 cells were plated at a concentration of 0.5 × 10 5 The cells were plated at a density of 100 μL / mL in a 96-well cell culture plate, each well containing 100 μL of DMEM medium, and cultured overnight in a 37°C, 5% CO2 incubator; the supernatant of IPEC-J2 cells infected 12 hours before the cell sample in Example 2-3 was diluted 10-fold, serially diluted 10 times, and inoculated into IPEC-J2 cells in a 96-well cell culture plate, 100 μL was inoculated per well, and 8 replicates were performed for each dilution. The supernatant of IPEC-J2 cells infected with PEDV that was not treated with IFN-δ8 was used as a control; the 96-well cell culture plate was placed in a 37°C, 5% CO2 incubator and cultured; the cell growth status was observed every 24 hours, and the number of cytopathic wells was recorded for 5-7 days until the number of cytopathic wells no longer increased; the TCID of the virus was calculated using the Spearman-Karber method. 50 The experimental data were expressed as group mean and standard deviation (SD), and statistical analysis was performed using GraphPadPrism 8.0 software with unpaired, two-tailed Student t-test; ***p<0.001, indicating extremely significant statistical differences.
[0067] The results are as follows Figure 6 As shown, compared with the control group without IFN-δ8 (0 mg / mL), the PEDV virus titer in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (the virus titer was reduced by >3 log 10 TCID 50 / mL, i.e. 1000 times), indicating that IFN-δ8 can significantly reduce the PEDV virus titer of IPEC-J2 cells infected with PEDV, which once again confirms that IFN-δ8 can significantly reduce the PEDV infection amount of IPEC-J2 cells infected with PEDV.
[0068] Example 3 IFN-δ8 inhibits PDCoV infection in vitro
[0069] 1. Identification of IFN-δ8 toxicity to ST cells
[0070] ST cells were cultured at a rate of 0.5 × 10 5 Cells were plated at a concentration of 100 μL / mL in a 96-well cell culture plate, and 100 μL of 15% DMEM medium was added to each well. The cells were cultured in a 37°C, 5% CO2 incubator for 24 hours. The original cell culture medium was removed and replaced with DMEM culture medium containing different concentrations of IFN-δ8 (0, 0.0003, 0.003, 0.03, 0.3, 3 mg / mL). After incubation at 37°C for 24 hours, the cells were washed three times with PBS buffer. CCK-8 reagent was added according to the operating instructions and cultured in a 37°C, 5% CO2 incubator for 2 hours. Cytotoxicity was identified using an enzyme-labeled instrument. Statistical analysis was performed using GraphPad Prism 8.0 software with an unpaired, two-tailed Student t-test; ns indicates no significant difference. The results are shown in Figure 2. Figure 7 As shown, compared with the cell activity of the control group without IFN-δ8 (0 mg / mL) (cell activity is 100%), the treatment groups with 0.0003, 0.003, 0.03, 0.3, and 3 mg / mL IFN-δ8 had no significant effect on cell activity (ns), that is, no cytotoxicity, and can be used in subsequent examples.
[0071] 2. Effect of IFN-δ8 on PDCoV RNA Content in ST Cells Infected
[0072] ST cells were cultured at a rate of 2.5 × 10 5Cells were plated at a concentration of 100 μL / mL in a 12-well cell culture plate. 500 μL of DMEM medium was added to each well and the cells were cultured in a 37°C, 5% CO2 incubator for 24 hours. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and cultured at 37°C for another 12 hours. ST cells not infected with PDCoV but not treated with IFN-δ8 were used as a control. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. Fresh DMEM medium was replaced, and PDCoV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added at a final concentration of 4 μg / mL and the cells were cultured in a 37°C, 5% CO2 incubator for 12 hours. The cells were collected, the cell supernatant was discarded, and the cells were washed three times with PBS; 1 mL of trizol lysis solution was added, and after standing for about 1 minute, the cells in the well were blown off with a pipette and collected into an RNase-free centrifuge tube, RNA was extracted, and complementary DNA (cDNA) was generated using a reverse transcription kit as an RT-qPCR template; absolute RT-qPCR was used to measure the PDCoV nucleocapsid protein (N) RNA content to represent the viral RNA content of infected cells; the primers and reaction system are shown in Tables 3 and 2, respectively; the staining method fluorescence quantitative premix was the same as in Example 2, and the reaction procedure used the Fast program provided with the ABI fluorescence quantitative PCR instrument.
[0073] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p<0.001 indicates a highly significant difference. Figure 8 As shown in the figure, compared with the control group without IFN-δ8 (0 mg / mL), the PDCoV RNA content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (reduced by >99%), indicating that IFN-δ8 can significantly reduce the PDCoV RNA content in ST cells infected with IFN-δ8.
[0074] Table 3 Absolute fluorescence quantitative PCR primer sequences
[0075]
[0076] 3. Effect of IFN-δ8 on PDCoV protein content in ST cells infected with PDCoV
[0077] To verify whether IFN-δ8 can reduce the expression of PDCoV protein in ST cells infected with IFN-δ8, Western blot was performed to detect the PDCoV N protein content after IFN-δ8 treatment.
[0078] ST cells were cultured at a rate of 2.5 × 10 5 The cells were plated at a concentration of 1 μg / mL in a 12-well cell culture plate and incubated at 37°C, 5% CO2 for 24 hours. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and incubated at 37°C for another 12 hours. ST cells not infected with PDCoV but not treated with IFN-δ8 were used as a control. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. The DMEM medium was replaced with fresh DMEM medium. PDCoV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added at a final concentration of 4 μg / mL and incubated at 37°C, 5% CO2 for 12 hours. The cells were harvested, the supernatant discarded, and the cells were washed three times with PBS. 200 μL of 1xSDS loading buffer was added to lyse the cells. The second edition of the "Genetic Engineering Experiment Guide" was used for gel preparation, electrophoresis, membrane transfer, blocking and other experimental operations. PDCoV-N mAb was used as the primary antibody (this monoclonal antibody was screened and preserved by our laboratory), and HRP-labeled goat anti-mouse antibody was used as the secondary antibody. After incubation with an ultrasensitive ECL chemiluminescence kit, the samples were photographed using a chemiluminescence colorimeter.
[0079] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p < 0.001 indicates a highly significant statistical difference. Figure 9 As shown, β-tubulin was used as an internal reference, and the same β-tubulin content was used to represent the same number of cells. In the same number of cells, compared with the control group without IFN-δ8 (0 mg / mL), the PDCoV N protein content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (by about 90%), indicating that IFN-δ8 can significantly reduce the expression of PDCoV N protein in ST cells infected with IFN-δ8.
[0080] 4. Effect of IFN-δ8 on PDCoV virus titer in ST cells infected with PDCoV
[0081] To further confirm that IFN-δ8 inhibits the infection of ST cells with PDCoV, ST cells were cultured at a concentration of 0.5×10 5The cells were plated at a concentration of 100 μL / mL in a 96-well cell culture plate, each well containing 100 μL of DMEM medium, and cultured overnight in a 37°C, 5% CO2 incubator; the ST cell supernatant infected 12 hours before the cell sample in Example 3-3 was diluted 10-fold, serially diluted 10 times, and inoculated into ST cells in a 96-well cell culture plate, 100 μL was inoculated per well, and 8 replicates were made for each dilution. The supernatant of ST cells infected with PDCoV without IFN-δ8 treatment was used as a control; the 96-well cell culture plate was placed in a 37°C, 5% CO2 incubator for culture; the cell growth status was observed every 24 hours, and the number of cytopathic wells was recorded for 5-7 days until the number of cytopathic wells no longer increased; the TCID of the virus was calculated using the Spearman-Karber method. 50 The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p<0.001, indicating extremely significant statistical differences.
[0082] The results are as follows Figure 10 As shown, compared with the control group without IFN-δ8 (0 mg / mL), the PDCoV virus titer of the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (the reduced virus titer was >3 log 10 TCID 50 / mL, i.e. 1000 times), indicating that IFN-δ8 can significantly reduce the titer of PDCoV virus infection in ST cells, which once again confirms that IFN-δ8 can significantly reduce the amount of PDCoV infection in ST cells.
[0083] Example 4 IFN-δ8 inhibits SADS-CoV infection in vitro
[0084] The identification of IFN-δ8 cytotoxicity to ST cells was the same as in Example 3.
[0085] 1. Effect of IFN-δ8 on SADS-CoV RNA Content in ST Cells Infected
[0086] ST cells were cultured at a rate of 2.5 × 10 5The cells were plated at a concentration of 100 μg / mL in a 12-well cell culture plate. 500 μL of DMEM medium was added to each well and the cells were cultured in a 37°C, 5% CO2 incubator for 24 hours. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and cultured at 37°C for another 12 hours. ST cells not infected with SADS-CoV but not treated with IFN-δ8 were used as a control. The medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. Fresh DMEM medium was replaced, and SADS-CoV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added at a final concentration of 4 μg / mL, and the cells were cultured in a 37°C, 5% CO2 incubator for 12 hours. The cells were collected, the cell supernatant was discarded, and the cells were washed three times with PBS; 1 mL of trizol lysis buffer was added, and after standing for about 1 minute, the cells in the well were blown off with a pipette and collected into an RNase-free centrifuge tube, RNA was extracted, and complementary DNA (cDNA) was generated using a reverse transcription kit as an RT-qPCR template; the SADS-CoV nucleocapsid protein (N) RNA content was measured using absolute RT-qPCR to represent the viral RNA content of infected cells; the primers and reaction system are described in Table 4 and Table 2 above, respectively; the staining method fluorescence quantitative premix was the same as in Example 2, and the reaction procedure used the Fast program provided with the ABI fluorescence quantitative PCR instrument.
[0087] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p<0.001 indicates a highly significant difference. Figure 11 As shown in the figure, compared with the control group without IFN-δ8 (0 mg / mL), the SADS-CoV RNA content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (reduced by >99%), indicating that IFN-δ8 can significantly reduce the SADS-CoV RNA content in ST cells infected with IFN-δ8.
[0088] Table 4 Absolute fluorescence quantitative PCR primer sequences
[0089]
[0090] 2. Effect of IFN-δ8 on SADS-CoV protein content in ST cells infected with
[0091] To verify whether IFN-δ8 can reduce the expression of SADS-CoV protein in ST cells infected with IFN-δ8, the SADS-CoV N protein content after IFN-δ8 treatment was detected by Western blot.
[0092] ST cells were cultured at a rate of 2.5 × 10 5 The cells were plated at a concentration of 1 μg / mL in a 12-well cell culture plate and incubated at 37°C, 5% CO2 for 24 hours. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. 500 μL of DMEM medium containing 3 mg / mL IFN-δ8 was added to the cell culture wells and incubated at 37°C for another 12 hours. ST cells not infected with SADS-CoV but not treated with IFN-δ8 were used as a control. The culture medium in the 12-well cell culture plate was discarded, and the cells were washed three times with PBS buffer. The DMEM medium was replaced with fresh DMEM medium. SADS-CoV was inoculated into the 12-well cell culture plate at a multiplicity of infection (MOI) of 0.01. Trypsin was added at a final concentration of 4 μg / mL, and the cells were incubated at 37°C, 5% CO2 for 12 hours. The cells were harvested, the supernatant discarded, and the cells were washed three times with PBS. 200 μL of 1x SDS loading buffer was added to lyse the cells. The second edition of the "Genetic Engineering Experiment Guide" was used for gel preparation, electrophoresis, membrane transfer, blocking and other experimental operations. SADS-CoV-N mAb was used as the primary antibody (this monoclonal antibody was screened and preserved by our laboratory), and HRP-labeled goat anti-mouse antibody was used as the secondary antibody. After incubation with an ultrasensitive ECL chemiluminescence kit, photos were taken using a chemiluminescence colorimeter.
[0093] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p < 0.001 indicates a highly significant statistical difference. Figure 12 The results showed that, using β-tubulin as an internal reference, the same β-tubulin content represented the same number of cells; compared with the control group without IFN-δ8 (0 mg / mL), the SADS-CoV N protein content in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (by about 90%), indicating that IFN-δ8 can significantly reduce the expression of SADS-CoV N protein in ST-infected cells.
[0094] 3. Effect of IFN-δ8 on the titer of SADS-CoV virus in ST cells infected with
[0095] To further confirm that IFN-δ8 inhibits the infection of ST cells with SADS-CoV, ST cells were cultured at a concentration of 0.5×10 5 The cells were plated in a 96-well cell culture plate at a concentration of 100 μL / mL, each well containing 100 μL of DMEM medium, and cultured overnight in a 37°C, 5% CO2 incubator; the ST cell supernatant infected 12 hours before the cell sample in Example 4-2 was diluted 10-fold, serially diluted 10 times, and inoculated into ST cells in a 96-well cell culture plate, 100 μL per well, and 8 replicates were performed for each dilution. The supernatant of ST cells infected with SADS-CoV without IFN-δ8 treatment was used as a control; the 96-well cell culture plate was placed in a 37°C, 5% CO2 incubator for culture; the cell growth status was observed every 24 hours, and the number of cytopathic wells was recorded for 5-7 days until the number of cytopathic wells no longer increased; the TCID of the virus was calculated using the Spearman-Karber method. 50 The experimental data are expressed as group mean and standard deviation (SD), and statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test; ***p<0.001 indicates a highly significant statistical difference. Figure 13 As shown, compared with the control group without IFN-δ8 (0 mg / mL), the SADS-CoV virus titer in the treatment group with 3 mg / mL IFN-δ8 was significantly reduced (the virus titer was reduced by >3 log 10 TCID 50 / mL, i.e. 1000 times), indicating that IFN-δ8 can significantly reduce the SADS-CoV virus titer in ST cells infected with SADS-CoV, which once again confirms that IFN-δ8 can significantly reduce the SADS-CoV infection amount in ST cells.
Claims
1. Use of interferon IFN-δ8 in the preparation of a drug for inhibiting porcine coronavirus infection, wherein the porcine coronavirus is porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus.
2. The use according to claim 1, characterized in that Application of interferon IFN-δ8 in the preparation of a drug for inhibiting the viral RNA content of porcine coronavirus infection.
3. The use according to claim 1, characterized in that Application of interferon IFN-δ8 in the preparation of a drug for inhibiting the abundance of viral proteins infected by porcine coronavirus.
4. The use according to claim 1, wherein Application of interferon IFN-δ8 in the preparation of a drug for inhibiting the viral titer of porcine coronavirus infection.
5. The use according to any one of claims 1 to 4, characterized in that The effective concentration of interferon IFN-δ8 is 0.03-3 mg / mL.