Application of OsSCL30 gene in regulating rice plant height or heading date

Abstract

The present invention provides the use of the OsSCL30 gene for regulating rice plant height or heading period. The present invention discovered that the OsSCL30 gene is related to rice plant height or heading period. Mutating the OsSCL30 gene, resulting in a frameshift mutation or premature termination codon, reduces rice plant height and shortens the heading period under both long-day and short-day conditions. Therefore, the OsSCL30 gene can serve as an effective target for rice genetic breeding, enabling the development of rice with an earlier heading period or dwarfing traits.

Description

Technical Field

[0001] The present invention relates to the technical field of biological gene engineering, and in particular to application of the OsSCL30 gene in regulating rice plant height or heading period. Background Art

[0002] Rice is one of the world's most important staple foods and a model plant for studying plant functional genetics. However, with urbanization, environmental changes, and the continuous reduction of arable land, increasing rice yields remains urgent.

[0003] Rice growth, development, adaptability, and yield are influenced by multiple factors. Heading date (flowering time) and plant height are important agronomic traits of rice. Heading date is a key factor in rice's seasonal adaptability, while plant height is a major factor influencing grain yield and quality. Heading date is crucial for rice reproduction, yield, and regional adaptability, which are intricately regulated by various environmental and endogenous signals. Rice is a facultative short-day plant, promoting flowering under short-day conditions and inhibiting flowering under long-day conditions. Endogenous genetic makeup determines the length of the basic vegetative phase and sensitivity to exogenous factors, fundamentally determining differences in photoperiodic responses among rice varieties and leading to wide variations in heading date. Plant height influences rice morphogenesis, apical dominance, harvest index, and yield. Tall rice varieties have poor fertility tolerance and are prone to lodging, resulting in low yields. Consequently, moderately dwarf rice varieties are cultivated. Semi-dwarf rice varieties exhibit excellent traits such as fertilizer tolerance, lodging resistance, high leaf density, and a high harvest index. Therefore, dwarfing traits are conducive to the development of superior rice varieties with improved lodging resistance and increased yield. Summary of the Invention

[0004] The present invention provides the use of the OsSCL30 gene in regulating rice plant height or heading period.

[0005] The specific technical solutions are as follows:

[0006] One of the objectives of the present invention is to provide an application of the OsSCL30 gene as a target in screening products for regulating rice plant height or rice heading period.

[0007] A second object of the present invention is to provide the use of a mutant of the OsSCL30 gene or a biological material containing the mutant in the following 1)-4):

[0008] 1) Negatively regulate rice plant height;

[0009] 2) Negatively regulate rice heading period;

[0010] 3) Used for rice variety improvement;

[0011] 4) Used for preparing transgenic rice.

[0012] Preferably, the polynucleotide sequence of the OsSCL30 gene includes the sequence shown in SEQ ID NO.1.

[0013] Preferably, the biological material is selected from one or more of recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

[0014] Preferably, the mutant is obtained by mutating the OsSCL30 gene to inhibit or block the expression of the OsSCL30 gene. More preferably, the polynucleotide sequence of the mutant comprises the sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0015] A third object of the present invention is to provide a method for reducing rice plant height or advancing the heading period of rice, comprising: using genetic engineering methods to inhibit or block the expression of the OsSCL30 gene in rice, thereby obtaining rice with reduced plant height or rice with an advanced heading period; the polynucleotide sequence of the OsSCL30 gene comprises the sequence shown in SEQ ID NO. 1.

[0016] Preferably, the method includes designing a CRISPR / Cas9-based sgRNA sequence targeting the OsSCL30 gene, ligating a DNA fragment encoding the sgRNA sequence into a CRISPR / Cas9-based vector, and transforming rice to produce rice with reduced plant height or early heading. More preferably, the sgRNA target sequences are SEQ ID No. 2 and SEQ ID No. 3.

[0017] A fourth object of the present invention is to provide the use of rice obtained by the method described above in plant breeding. Preferably, the breeding method includes transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0018] A fifth object of the present invention is to provide a molecular marker related to the OsSCL30 gene, wherein the primer sequences of the molecular marker are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0019] A sixth object of the present invention is to provide the molecular markers described above for use in any of the following:

[0020] (1) Used for identification of rice plant height or heading period;

[0021] (2) Used for early prediction of rice plant height or heading date;

[0022] (3) used for genotyping of the rice OsSCL30 gene;

[0023] (4) Used for identification of rice germplasm resources or molecular marker-assisted breeding.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention discovered that the OsSCL30 gene is a dominant nuclear gene expressed in all rice tissues, particularly in leaves before heading, and expressed in both leaves and grains during the heading stage. Inhibiting or blocking OsSCL30 expression leads to earlier heading and reduced plant height in rice, demonstrating that OsSCL30 negatively regulates heading date and plant height. This invention provides a theoretical basis and guiding significance for molecular design breeding. The resulting rice germplasm resources provide germplasm resources for crop improvement and have certain application value in rice adaptation and genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the positive detection and screening of the scl30 gene-edited line in Example 1 of the present invention. Wherein, A: positive detection of the scl30 gene-edited line. P: positive control; N: Nipponbare; scl30 T0: scl30 gene-edited line T0 plant; M2000: 2000 DNA marker. B: SSCP detection of target one and target two of the scl30 gene-edited line. ck1: undenatured Nipponbare band; ck2: denatured Nipponbare band; scl30 target one: denatured scl30 target one band; scl30 target two: denatured scl30 target two band. C: mutation site information of the gene-edited lines scl30-1 and scl30-2, where the numbers indicate the relative position of the ATG start, arrows indicate base insertions, hollow arrows indicate base deletions, and inverted T symbols indicate premature stop codons.

[0027] Figure 2 Comparison of heading period and plant height between Nipponbare Nip and the gene-edited lines scl30-1 and scl30-2 in Example 1 of the present invention. AB: Comparison of heading phenotype and heading period between Nipponbare and the gene-edited lines scl30-1 and scl30-2. Arrows indicate panicles. CD: Comparison of plant type and plant height between Nipponbare and the gene-edited lines scl30-1 and scl30-2. Nip is Nipponbare, scl30-1 and scl30-2 are two gene-edited lines of OsSCL30, and scale bar = 10 cm. Values ​​(mean ± SD, n = 10) followed by the same letter are not significantly different (P < 0.05; LSD test).

[0028] Figure 3Comparison of the heading period of Nipponbare Nip and the gene-edited lines scl30-1 and scl30-2 under long-day and short-day conditions in Example 1 of the present invention. AB: Comparison of heading phenotype and heading time of Nipponbare and the gene-edited lines scl30-1 and scl30-2 under long-day conditions. CD: Comparison of heading phenotype and heading time of Nipponbare and the gene-edited lines scl30-1 and scl30-2 under short-day conditions. Nip is Nipponbare, scl30-1 and scl30-2 are two gene-edited lines of OsSCL30, arrows indicate panicles, scale bar = 10 cm. Values ​​(mean ± standard deviation, n = 10) followed by the same letter are not significantly different (P < 0.05; LSD test).

[0029] Figure 4 This is the positive detection and screening of the functional complementation lines C1-1, C1-2, C2-1 and C2-2 in Example 2 of the present invention. A: Schematic diagram of the structure of OsSCL30 isoforms. The numbers below each isoform represent the length of the nucleotide transcript. Filled rectangles represent exons, thin lines represent introns, and unfilled rectangles represent 5 ’ - and 3 ’ -UTR. Vertical arrow and " * " indicates the start codon and stop codon, respectively. BC: Positive detection of complementation lines C1 and C2. P: Positive control; N: Negative control; C1 and C2: functional complementation lines of OsSCL30; M5000: 5000 DNA marker. D: Relative expression of OsSCL30 in complementation lines C1-1, C1-2, C2-1, and C2-2, using qRT-PCR to detect its expression level using OsActin as an internal control. Data are expressed as mean ± SD, with three replicates per group.

[0030] Figure 5 Comparison of heading period and plant height between Nipponbare Nip, gene-edited line scl30-1, and functional complementation lines C1-1, C1-2, C2-1, and C2-2 in Example 2 of the present invention. AB: Comparison of heading phenotype and heading period between Nipponbare, gene-edited line scl30-1, and complementation lines. Arrows indicate panicles. CD: Comparison of plant type and plant height between Nipponbare, gene-edited line scl30-1, and complementation lines. Nip is Nipponbare, scl30-1 is the gene-edited line of OsSCL30, C1-1, C1-2, C2-1, and C2-2 are functional complementation lines of OsSCL30. Scale bar = 10 cm. Values ​​(mean ± SD, n = 10) followed by the same letter are not significantly different (P < 0.05; LSD test).

[0031] Figure 6This is a comparison of the traits of the gene-edited lines scl30-1, Nipponbare Nip, and F1 in Example 3 of the present invention. AB: Plants at maturity and heading of the gene-edited lines scl30-1, Nipponbare, and F1, arrows indicate panicles, and the scale is 10 cm. CD: Comparison of plant height and heading period of the gene-edited lines scl30-1, Nipponbare, and F1. E: Molecular marker of the scl30-1 gene-edited line, M is the maternal gene-edited line scl30-1, F is the paternal Nipponbare, and F1 is the first generation of hybridization of the gene-edited lines scl30-1 and Nipponbare. Values ​​(mean ± standard deviation, n = 10) followed by the same letters are not significantly different (P < 0.05; LSD test).

[0032] Figure 7 This is the expression pattern of OsSCL30 in Example 4 of the present invention. Wherein, A: expression pattern of OsSCL30 in various tissues of rice plants. The sampling sites and periods include roots, stems, stem tips, internodes, leaves before heading (leaf 1), leaves during heading (leaf 2), spikelets before flowering, spikelets during flowering, and spikelets on days 1, 3, 5, 7, 11, 17, and 21 after flowering (corresponding to spikelets 1 to 9). OsActin was used as an internal reference control, and its expression level was detected by qRT-PCR. The data are presented as mean ± standard deviation, with three replicates for each group of data. BQ: OsSCL30 promoter GUS expression is localized in internodes (B), stem apex (C), leaves before heading (D), leaves at heading (E), roots (F), pistils (G), stamens (H), caryopsis (IM) at 1, 3, 5, 7, and 11 days after fertilization (DPF), spikelets before anthesis (N), and spikelets at 1, 3, and 5 days after fertilization (OQ). Images represent horizontal and vertical orientations of caryopsis. Scale bars in Figures B, Q are 1 mm. DETAILED DESCRIPTION

[0033] This study reveals for the first time that the rice gene OsSCL30 (LOC_Os12g38430) regulates heading date and plant height in rice. In this study, multiple gene-edited lines were generated using CRISPR / Cas9 technology within the Nipponbare background. These lines all exhibited a trend toward earlier heading date and reduced plant height. Crossing the gene-edited line scl30-1 with Nipponbare yielded the F1 generation. The F1 generation showed significant differences in heading date and plant height compared to the gene-edited line scl30-1, but not to Nipponbare, indicating that OsSCL30 is a dominant nuclear gene. Gene functional complementation analysis revealed that the complemented lines exhibited delayed heading date and increased plant height. These results suggest that OsSCL30 negatively regulates heading date and plant height. Analysis of OsSCL30 expression using qRT-PCR and GUS staining revealed that the gene is expressed in various rice tissues, with particularly high expression in leaves before heading and in leaves and grains during the heading period.

[0034] This study identified the OsSCL30 gene as being involved in regulating important agronomic traits such as heading date and plant height, providing a theoretical basis and guiding significance for molecular design breeding. The created rice germplasm resources provide germplasm resources for crop improvement and have certain application value in rice adaptation and genetic breeding.

[0035] The first aspect of the present invention protects the use of the OsSCL30 gene as a target in screening products for regulating rice plant height or rice heading period.

[0036] Research in the present invention shows that the OsSCL30 gene is related to rice plant height or heading period. By mutating the gene and inhibiting or blocking the expression of the OsSCL30 gene, rice plant height is reduced and the heading period is shortened under both long-day and short-day conditions. Therefore, the OsSCL30 gene can be used as an effective target for rice genetic breeding to construct rice with an early heading period or dwarf rice.

[0037] The second aspect of the present invention is to protect the use of a mutant of the OsSCL30 gene or a biological material containing the mutant in the following 1)-4):

[0038] 1) Negatively regulate rice plant height; 2) Negatively regulate rice heading period; 3) Used for rice variety improvement; 4) Used for preparing transgenic rice.

[0039] In the present invention, the polynucleotide sequence of the OsSCL30 gene includes the sequence shown in SEQ ID NO.1.

[0040] In the present invention, the mutant refers to a mutation of the OsSCL30 gene to inhibit or block its expression. As an alternative, preferred approach, the OsSCL30 gene is mutated using gene editing technology. Mutations can be made using existing gene editing methods, such as ZFN, TALEN, or CRISPR gene editing technologies. Any method capable of adding, substituting, or deleting one or more bases in the nucleotide sequence can be employed.

[0041] In the present invention, the biological material is selected from one or more of recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

[0042] In the present invention, the polynucleotide sequence of the mutant includes the sequence shown in SEQ ID NO.4 or SEQ ID NO.5.

[0043] ATGAGGAGGTACAGCCCACCATATCGCAGTCCCCCTAGGAGGGGCTATGGTGGCAGAGGAAGAAGTCCCCCTAGGAGGGGATATGGAGGACGGAGGGAGCAGGGTTCTGGAAGTCTCTTGGTCCGCAACATCCCATTAAGCTGCAGAGGGGAGGATCTTCGAGTTCCTTTTGAAAGGTTTGGTCCTGTTCGGGATGTTTACCTGCCAAAGGATTATTACAGCGGGGAACCACGGGGATTTGCATTTGTGGAGTTCGTTGACCCTTATGATGCCTCTGAGGCTCAATATCACATGAATCGCCAGGTGTTTTTCGGCCGGGAGATAACTGTTGTTCTTGCTGCTGAGTCGCGGAAAAGGCCAGAGGAAATGCGCAGTAGAGCTAGAGTCAGGGGTTACTCTGGAAACGAAGGGCGCCGCTCTTCATATTATGGGAGGTCTCGTTCCCGTTCTCGCTCTCCCCACTATCGAGGTCGTCCACGGTCAAGGTCATACTCTCCTGCTCCAAGACGGCGAGATGACTACTCAGCTTCCCCACCGAGAAAGGATACGCACCCCACAAAATCTCCTAGGCGTCAGCCAAAAGAACATGATGAAGAGAAGAAGCGGAGATCCTACTCTCCTGCCAGTAGAGATGGCGACCCTCGCGATGCTGATAACGGTTATGAGAAGAGGTCGCCCCCACCTGAGCGATGGATCCCCTCCACACCGGAGGTCTCCTAGGCACTCCTCAGGGTCGCCTCCAGGATCCCGCTCTAGGTCCGCCGATGTTTCCCCTGCCCGCAGCGACTGA(SEQ ID No.4)

[0044] ATGAGGAGGTACAGCCCACCATATCGCAGTCCCCCTAGGAGGGGCTATGGTGGCAGAGGAAGAAGTCCCCCTAGGAGGGGATATGGAGGACGGAGGGAGCAGGGTTCTGGAAGTCTCTTGGTCCGCAACATCCCATTAAGCTGCAGAGGGGAGGATCTTCGAGTTCCTTTTGAAAGGTTTGGTCCTGTTCGGGATGTTTACCTGCCAAAGGATTATTACAGCGGGGAACCACGGGGATTTGCATTTGTGGAGTTCGTTGACCCTTATGATGCCTCTGAGGCTCAATATCACATGAATCGCCAGGTGTTTTTCGGCCGGGAGATAACTGTTGTTCTTGCTGCTGAGTCGCGGAAAAGGCCAGAGGAAATGCGCAGTAGAGCTAGAGTCAGGGGTTACTCTGGAAACGAAGGGCGCCGCTCTTCATATTATGGGAGGTCTCGTTCCCGTTCTCGCTCTCCCCACTATCGAGGTCGTCCACGGTCAAGGTCATACTCTCCTGCTCCAAGAGGCGAGATGACTACTCAGCTTCCCCACCGAGAAAGGATACGCACCCCACAAAATCTCCTAGGCGTCAGCCAAAAGAACATGATGAAGAGAAGAAGCGGAGATCCTACTCTCCTGCCAGTAGAGATGGCGACCCTCGCGATGCTGATAACGGTTATGAGAAGAGGTCGCCCCCACCTGACAAGCGATGGATCCCCTCCACACCGGAGGTCTCCTAGGCACTCCTCAGGGTCGCCTCCAGGATCCCGCTCTAGGTCCGCCGATGTTTCCCCTGCCCGCAGCGACTGA(SEQ ID No.5)

[0045] The mutated OsSCL30 gene of the present invention has a good regulatory effect on heading date (flowering time). Rice is a typical short-day plant, heading (flowering) earlier under short-day conditions and later under long-day conditions. Compared with the unmutated wild type, the gene-edited rice lines scl30-1 and scl30-2 headed approximately 5 to 6 days earlier under long-day conditions; the OsSCL30 gene mutants (gene-edited lines scl30-1 and scl30-2) headed approximately 4 to 5 days earlier under short-day conditions. Overall, it was shown that inhibiting or blocking the expression of the OsSCL30 gene can advance the heading date of rice under both long-day and short-day conditions.

[0046] The mutated OsSCL30 gene of this invention effectively regulates rice plant height, resulting in dwarfed rice plants with excellent characteristics such as fertilizer tolerance, lodging resistance, high leaf density, and a high harvest index. Compared to the unmutated wild type, the gene-edited rice lines scl30-1 and scl30-2 showed a 7.36-10.40% reduction in plant height. Inhibiting or blocking OsSCL30 gene expression can shorten rice plant height.

[0047] A third aspect of the present invention provides a method for reducing rice plant height or advancing the heading period of rice, comprising: using genetic engineering methods to inhibit or block the expression of the OsSCL30 gene in rice, thereby obtaining rice with reduced plant height or rice with an advanced heading period; the polynucleotide sequence of the OsSCL30 gene comprises the sequence shown in SEQ ID NO. 1.

[0048] The present invention includes: targeting the OsSCL30 gene, designing a CRISPR / Cas9-based sgRNA sequence, connecting a DNA fragment encoding the sgRNA sequence to a vector carrying CRISPR / Cas, and transforming rice to obtain rice with reduced plant height or rice with an early heading period.

[0049] More preferably, the target sequence of sgRNA is SEQ ID No. 2 and SEQ ID No. 3.

[0050] AGACGGCGAGATGACTACTC(SEQ ID No.2)

[0051] GACAGCGATGGATCCCCTCC(SEQ ID No.3)

[0052] The fourth aspect of the present invention protects the use of rice obtained by the method of the third invention in plant breeding.

[0053] In the present invention, the breeding methods include transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

[0054] The fifth aspect of the present invention protects a molecular marker related to the OsSCL30 gene, wherein the primer sequences of the molecular marker are shown in SEQ ID NO. 6 and SEQ ID NO. 7.

[0055] TTATGTTCTTCACAGGAGGTCG(SEQ ID NO.6)

[0056] CCCATTTCGTTGGTTCAAAGTT(SEQ ID NO.7)

[0057] The sixth aspect of the present invention protects the use of the molecular marker described in the fifth aspect in any of the following:

[0058] (1) Used for identification of rice plant height or heading period;

[0059] (2) Used for early prediction of rice plant height or heading date;

[0060] (3) used for genotyping of the rice OsSCL30 gene;

[0061] (4) Used for identification of rice germplasm resources or molecular marker-assisted breeding.

[0062] The present invention will be further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto.

[0063] N6D solid medium: 2.83g / L KNO3, 0.166g / L CaCl2·2H2O, 0.185g / L MgSO4·7H2O, 0.4g / L K2HPO4, 0.463g / L (NH4)2SO4, 0.8mg / L KI, 1.6mg / L H3BO3, 4.4mg / L MnSO4·4H2O, 1.5mg / L ZnSO4·7H2O, 27.8mg / L FeSO4·7H2O, 37.3mg / L Na2·EDTA·2H2O, 0.1g / L inositol, 2mg / L glycine, 0.5mg / L VB3, 0.5mg / mL VB6, 1mg / L VB1, 0.3g / L hydrolyzed casein, 2.878g / L proline, 30g / L sucrose, 0.1mg / L 2,4-D and 7 g / L agar, pH = 5.8.

[0064] LB solid medium: 10 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, 50 mg / L kanamycin, 50 mg / L rifampicin and 15 g / L agar, pH = 7.

[0065] LB liquid medium: 10 g / L NaCl, 10 g / L tryptone and 5 g / L yeast extract, pH=7.

[0066] AB solid medium: 3 g / L K2HPO4, 1 g / L NaH2PO4, 1 g / L NH4Cl, 0.3 g / L MgSO4·7H2O, 0.15 g / L KCl, 12 mg / L CaCl2·2H2O, 2.5 mg / L FeSO4·7H2O, 5 g / L glucose, 15 g / L agar, 50 mg / L kanamycin, and 50 mg / L rifampicin.

[0067] AAM medium: 0.3 g / L KCl, 15 mg / L CaCl2·2H2O, 25 mg / L MgSO4·7H2O, 15 mg / LNaH2PO4, 0.75 mg / L KI, 3 mg / L H3BO3, 10 mg / L MnSO4·4H2O, 2 mg / L ZnSO4·7H2O, 0.25 mg / LNaMoO4·2H2O, 0.025 mg / L CuSO4·5H2O, 0.025 mg / L CoCl2·6H2O, 27.8 mg / L FeSO4·7H2O, 37.3 mg / L Na2·EDTA·2H2O, 0.1 g / mL inositol, 7.5 mg / L glycine, 1 mg / L VB3, 1 mg / L VB6, 10 mg / LVB1, 0.9 g / L glutamine, 0.177 g / L arginine, 0.3 g / L aspartic acid, 0.5 g / L hydrolyzed casein, 18 g / L glucose and 20 g / L sucrose, pH = 5.2.

[0068] 2N6-AS solid medium: 2.83g / L KNO3, 0.166g / L CaCl2·2H2O, 0.185g / L MgSO4·7H2O, 0.4g / L K2HPO4, 0.463g / L (NH4)2SO4, 0.8mg / L KI, 1.6mg / L H3BO3, 4.4mg / L MnSO4·4H2O, 1.5mg / L ZnSO4·7H2O, 27.8mg / L FeSO4·7H2O, 37.3mg / L Na2·EDTA·2H2O, 0.1g / L inositol, 2mg / L glycine, 0.5mg / L VB3, 0.5mg / mL VB6, 1mg / L VB1, 0.1mg / L 2,4-D, 0.3 g / L hydrolyzed casein, 10 g / L glucose, 30 g / L sucrose, 7 g / L agar and 0.02 mg / L AS, pH = 5.2.

[0069] N6DS solid medium: Add 300 mg / L timentin and 50 mg / L hygromycin to N6D solid medium.

[0070] REIII solid medium: 1.65g / L NH4NO3, 1.9g / L KNO3, 0.44g / L CaCl2·2H2O, 0.37g / LMgSO4·7H2O, 0.17g / L KH2PO4, 0.223g / L MnSO4·4H2O, 8.6mg / L ZnSO4·7H2O, 0.025mg / LCuSO4·5H2O, 0.025mg / L CoCl2·6H2O, 0.83mg / L KI, 6.2mg / L H3BO3, 0.25mg / L NaMoO4·2H2O, FeSO4·7H2O, 37.3mg / L Na2·EDTA·2H2O, 0.1g / L inositol, 2mg / L glycine, 0.5mg / L VB3, 0.5mg / L VB6, 0.1 mg / L VB1, 30 g / L sucrose, 7 g agar, 2 mg / L kinetin and 0.2 mg / L naphthaleneacetic acid, pH = 5.8.

[0071] HF solid medium: based on REIII solid medium, except for the addition of kinetin and naphthaleneacetic acid.

[0072] Example 1 Construction of OsSCL30 gene editing vector, genetic transformation and acquisition of editing lines

[0073] In this example, a gene knockout vector was constructed using CCRISPR / Cas9 technology to obtain the OsSCL30 gene editing vector, which was then transformed into rice to obtain a gene-edited line. The steps included:

[0074] 1.1 Construction of OsSCL30 gene editing vector

[0075] To explore the specific function of the OsSCL30 gene (SEQ ID No. 1), the full-length coding region of OsSCL30 was sequenced and screened. Two target sites were designed at 505 bp and 685 bp of the coding region: AGACGGCGAGATGACTACTC (SEQ ID No. 2) and GACAGCGATGGATCCCCTCC (SEQ ID No. 3). A gene knockout vector was constructed using CCRISPR / Cas9 technology. Specific primers for OsSCL30 vector construction were designed and named OsSCL30-gRT1, OsSCL30-OsU3T1, OsSCL30-gRT2, and OsSCL30-OsU6aT2. Other primers were UF, gRNA-R, Pps-R, Pgs-2, Pps-2, and Pgs-L, respectively.

[0076] The primer sequences are:

[0077] OsSCL30-gRT1: GAGTAGTCATCTCGCCGTCTgttttagagctagaaat (SEQ ID NO.11)

[0078] OsSCL30-OsU3T1: AGACGGCGAGATGACTACTCTgccacggatcatctgc (SEQ ID NO.12)

[0079] OsSCL30-gRT2: GAGGGGATCCATCGCTGTCgttttagagctagaaat (SEQ ID NO.13)

[0080] OsSCL30-OsU6aT2: GACAGCGATGGATCCCCTCCggcagccaagccagca (SEQ ID NO. 14)

[0081] UF: CTCCGTTTTACCTGTGGAATCG(SEQ ID NO.15)

[0082] gRNA-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO.16)

[0083] Pps-R:TTCAGAGGTCTCTACCGACTAGTATGGAATCGGGCAGCAAAGG(SEQ ID NO.17)

[0084] Pgs-2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC (SEQ ID NO.18)

[0085] Pps-2: TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG (SEQ ID NO.19)

[0086] Pgs-L: AGCGTGGGTCTCGCTCGACGCGTATCCATCCACTCCAAGCTC (SEQ ID NO. 20)

[0087] CRISPR / Cas9 vector construction steps (using pYLCRISPR / Cas9Pubi-H and pYLsgRNA-OsU3 as an example):

[0088] 1) Amplification of target primer adapter and gRNA expression cassette:

[0089] PCR reaction system 1: template 1 μL pYLsgRNA-OsU3 plasmid, primers 0.5 μL UF and 0.5 μL OsSCL30-OsU3T1, 10 μL Primer STAR Max DNA Polymerase, and add ddH2O to make up the volume to 20 μL.

[0090] PCR reaction system 2: template 1 μL pYLsgRNA-OsU3, primers 0.5 μL OsSCL30-gRT1 and 0.5 μL gRNA-R, 10 μL Primer STAR Max DNA Polymerase, and add ddH2O to make up the volume to 20 μL.

[0091] PCR reaction program: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 5 min.

[0092] The PCR amplified products were purified and recovered and stored at 4°C.

[0093] 2) Connection between target primer adapter and gRNA expression cassette:

[0094] PCR reaction system: 1 μL template product from step 1), 0.5 μL UF and 0.5 μL gRNA-R primers, 10 μL Primer STAR Max DNA Polymerase, and add ddH2O to make up the volume to 20 μL.

[0095] The PCR reaction procedure and gel recovery were the same as step 1).

[0096] 3) sgRNA expression cassette plus BsaI restriction site:

[0097] PCR reaction system: 1 μL template product from step 2), 1 μL Pps-2 and 1 μL Pgs-2 primers, 10 μL Primer STAR Max DNA Polymerase, and add ddH2O to make up the volume to 20 μL.

[0098] The PCR reaction procedure and gel recovery were the same as step 1).

[0099] 4) Connect the target sgRNA expression cassette to the pYLCRISPR / Cas9 vector:

[0100] Reaction system: 5 μL of the product from step 3), 1 μL of pYLCRISPR / Cas9Pubi-H plasmid, 1 μL of BsaI-HF enzyme, 1.5 μL of CutMaster buffer, and 6.5 μL of ddHO. Incubate the system in a PCR instrument at 37°C for 15 minutes, then quickly place on ice. Add 1 μL of T4 ligase and 1.5 μL of T4 buffer, mix well, and perform enzyme digestion and ligation.

[0101] PCR reaction program: 37°C for 5 min, 10°C for 15 min, 20°C for 25 min, 35 cycles; 37°C for 5 min. The enzyme-linked products were stored at 4°C until use.

[0102] 5) Transformation of gene editing vectors into E. coli, verification and preservation of positive clones:

[0103] The enzyme-linked product was transformed into DH5α competent medium. The specific method is as follows:

[0104] Take 100 μL of competent E. coli and melt it on ice, add 10 μL of ligation product, mix it by pipetting, and let it stand on ice for 30 minutes; heat shock it in a 42°C water bath for 90 seconds, and quickly place it on ice for 2 minutes; add 600 μL of liquid culture medium in a clean workbench and resuscitate it at 37°C / 200rpm for 1 hour; after resuscitation, centrifuge it at 5000rpm for 5 minutes, remove 600 μL of supernatant, mix the remaining bacterial liquid, and evenly spread it on a solid culture medium containing 50 mg / L kanamycin; place it in a 37°C incubator and culture it upside down overnight; pick a single clone and culture it in a liquid culture medium containing 50 mg / L kanamycin, use bacterial liquid PCR to verify the transformation results, sequence the positive single clone, and obtain a positive E. coli monoclonal clone.

[0105] After extracting the plasmid from the positive E. coli monoclonal clone, transform it into EHA105 competent cells. The specific method is as follows:

[0106] Take 100 μL of Agrobacterium competent cell and place it on ice to melt, add 10 μL of plasmid, pipette to mix, place it on ice for 5 minutes, and then immediately place it in liquid nitrogen for quick freezing for 5 minutes, then place it in a 37°C water bath for 5 minutes, and finally place it on ice for 5 minutes; add 600 μL of liquid culture medium to the clean bench and activate Agrobacterium on a shaker at 28°C for 2 hours; after activation, centrifuge at 5000 rpm for 5 minutes; aspirate 600 μL of supernatant, mix the remaining bacterial liquid, and evenly spread it on a solid culture medium with 50 mg / L kanamycin and 50 mg / L rifampicin, and invert it to culture in a 28°C incubator; pick a single clone and culture it in a liquid culture medium with 50 mg / L kanamycin and 50 mg / L rifampicin for positive verification to obtain a positive Agrobacterium single clone.

[0107] 1.2 Genetic transformation of gene editing vectors into rice

[0108] 1.2.1 Callus induction

[0109] 1) Hull the rice grains, select clean and plump seeds, place them in a conical flask, disinfect them with 70% ethanol for 1 minute, discard the ethanol, and rinse them with ddH2O 1-2 times; add 50 mL of 25% NaClO and disinfect it for 20 minutes; discard the 25% NaClO, and rinse them with ddH2O 5-6 times.

[0110] 2) Place the seeds on sterile filter paper to absorb surface moisture and let it sit for 20 minutes until the surface of the seeds is slightly dry.

[0111] 3) Place rice seeds on N6D solid culture medium, 25-30 seeds per dish, at 28°C with continuous light for 6-9 days to induce callus formation.

[0112] 1.2.2 Agrobacterium preparation and activation

[0113] Streak the Agrobacterium tumefaciens culture medium containing the OsSCL30 gene editing vector onto LB solid medium and culture at 28°C for 3 days. Pick 5 to 7 monoclonal colonies and resuspend them in 500 μL LB liquid medium. Pipette 50 to 100 μL of the suspension and evenly spread it onto AB solid medium. Culture at 28°C for 72 hours.

[0114] The activated Agrobacterium containing the promoter vector was washed off the AB solid medium using AAM medium, and the bacterial solution was fully suspended and added to 20 mL of AAM liquid medium. The bacterial concentration was adjusted to OD680 = 0.09-0.10, and 20 μL of 100 mM acetosyringone (AS) was added. The culture was incubated at 28°C, 50-60 rpm, and the culture was performed for 1 h to obtain the activated Agrobacterium.

[0115] 1.2.3 Callus infection

[0116] Pick out the callus tissue with good growth status in step 1.2.1 and place it in a sterile flask. Pour the Agrobacterium activated in step 1.2.2 into each flask and shake the flask gently for 5 minutes. Remove the bacterial solution and place the callus tissue in a culture dish covered with sterile filter paper to obtain the infected callus tissue.

[0117] 1.2.4 Co-culture

[0118] Place a piece of filter paper on 2N6-AS solid medium and evenly soak the filter paper with 1 mL AAM + 20 μL 100 mM AS solution; place the infected callus obtained in step 1.2.3 on the filter paper respectively and co-cultivate at 25°C in the dark for 3 days.

[0119] 1.2.5 Screening

[0120] Collect the co-cultured callus obtained in step 1.2.4 into a sterile Erlenmeyer flask, rinse with ddH2O 5-7 times, and rinse with ddH2O containing 300 mg / L timentin 2-3 times, each time letting it stand for 5 minutes; remove the ddH2O, place the callus on sterile filter paper to fully absorb the moisture, and then place it on N6DS solid medium and incubate at 28°C for 2 weeks to obtain resistant callus.

[0121] 1.2.6 Induced differentiation

[0122] The resistant callus obtained in step 1.2.5 was transferred to REIII solid medium and incubated at 32°C under light for about 2 weeks to differentiate into seedlings.

[0123] 1.2.7 Root induction

[0124] The differentiated seedlings obtained in step 1.2.6 were transferred to HF solid medium. When the seedlings grew to about the height of a bottle cap, ddH2O was added to harden the seedlings. Transplantation and positive testing were performed to obtain OsSCL30 gene-edited transgenic rice, which was named gene-edited line scl30 T0.

[0125] 1.3 Identification of the gene-edited line scl30 T0

[0126] When the rice grows to 4 to 5 leaves, take young leaves to extract DNA, and first use PCR to identify whether the rice contains the Cas9 gene. Rice with the Cas9 gene is considered positive rice.

[0127] The primers used for PCR identification are:

[0128] Forward primer Cas9-F1: TATCCCTCACCAGATCCACC (SEQ ID NO. 21)

[0129] Reverse primer Cas9-R1: AGCACCCTTGTCAACAACCT (SEQ ID NO. 22)

[0130] The PCR reaction system is as follows: 2 μL of the plant DNA sample to be tested, 0.5 μL of primers Cas9-F1 and 0.5 μL of Cas9-R1, 10 μL of Primer STAR Max DNA Polymerase, and the volume is made up to 20 μL with ddH2O.

[0131] The PCR reaction program was as follows: pre-denaturation at 98°C for 5 min; 30 cycles of 98°C for 30 s, 55°C for 30 s, and 72°C for 30 s; final extension at 72°C for 5 min, and storage at 4°C.

[0132] The PCR products were subjected to agarose gel electrophoresis to confirm whether the target band appeared. Plants with Cas9 target bands were positive plants.

[0133] Positive plants were screened for scl30 T0 gene-edited transgenic rice, and the results are shown in Figure 1 .

[0134] Figure 1 The figure is an agarose gel electrophoresis diagram of the PCR product of the transgenic rice DNA extracted in this example. P is the positive control; N is Nipponbare; scl30 T0 is the T0 plant of the scl30 gene-edited line; and M2000 is the 2000 DNA marker.

[0135] from Figure 1 It can be seen that a total of 20 positive plants were obtained by scl30 T0 gene editing and transgenic.

[0136] 1.4 Cultivation of the gene-edited line scl30 T0 to obtain T1 transgenic rice

[0137] The scl30 T0 gene-edited transgenic rice obtained in step 1.3 was planted for generations to obtain T1 transgenic rice. The rice gene-edited plants were then subjected to single-strand conformation polymorphism (SSCP) detection and sequencing analysis. The results are shown in Figure 1 B and 1C.

[0138] The specific method for detecting single-strand conformation polymorphism (SSCP) in rice gene-edited plants is as follows:

[0139] Reagent configuration:

[0140] 10× TBE: 108 g Tris, 55 g boric acid, 40 mL 0.5 mol / L EDTA (pH 8.0), dilute to 1 L, autoclave, and store at 4°C.

[0141] 40% acrylamide stock solution: 39.2 g acrylamide, 0.8 g methylene bisacrylamide, dilute to 100 mL, filter and store in the dark at 4°C.

[0142] 10% ammonium persulfate: Dissolve 1g ammonium persulfate in 10mL distilled water and store at 4℃.

[0143] 2× loading buffer: 9.5 g formamide, 0.4 mL 0.5 mol / L EDTA, 5 mg xylene cyanol FF, 5 mg bromophenol blue, dissolve in water, dilute to 10 mL, and store at 4°C.

[0144] Silver staining solution: 1 g silver nitrate, dilute to 1 L with ddH2O.

[0145] Color developing solution: 15g sodium hydroxide, 0.2g sodium bicarbonate, dilute to 1L with ddH2O. After complete dissolution, add 4mL formaldehyde and mix well.

[0146] Experimental steps:

[0147] 1) Amplification product: PCR amplifies specific target DNA.

[0148] 2) Preparation of PAGE:

[0149] Prepare the glue solution of appropriate concentration according to the table below, mix well, and slowly inject it between the glass plates. Immediately insert the spotting comb, place it horizontally, and polymerize it at room temperature for 1 hour. Remove the spotting comb, add 1×TBE buffer to the electrophoresis tank, and repeatedly rinse the spotting wells with 1×TBE buffer.

[0150]

[0151] 3) Treatment of amplified products: Take 2 μL of PCR amplified product and add it to 8 μL of loading buffer. Mix thoroughly. Denature at 100°C for 10 minutes, then immediately chill in an ice bath for 2 minutes. 3 μL of the product is then loaded onto the sample.

[0152] 4) Electrophoresis: Electrophoresis was performed at room temperature at 1-5 V / cm.

[0153] 5) Gel stripping: After electrophoresis, recycle the electrophoresis buffer, remove the electrophoresis gel glass, use a plastic wedge to pry open the glass plate, and cut off the upper left corner of the gel as a marker for the spotting order.

[0154] 6) Silver Staining: Wash the gel twice with ddH2O, discard the water, add 200 mL of silver stain solution, and shake on a shaker at room temperature at 60-70 rpm for 15 minutes. Discard the silver stain solution, wash once with ddH2O, discard the water, add 200 mL of color development solution, and shake on a shaker at room temperature at 60-70 rpm for 3-8 minutes until the desired bands appear. Discard the color development solution, wash once with ddH2O, discard the water, and photograph.

[0155] Finally, two homozygous gene-edited lines were screened:

[0156] The gene-edited line scl30-1 has a two-base CA deletion at base 687 from the ATG start, resulting in a premature stop codon at base 720 from the ATG start. The polynucleotide sequence of the gene-edited line scl30-1 is shown in SEQ ID NO. 4.

[0157] The gene-edited line scl30-2 has a C deletion at the 508th base from the ATG and an A insertion at the 688th base from the ATG, resulting in a frameshift mutation. The polynucleotide sequence of the gene-edited line scl30-2 is shown in SEQ ID NO. 5.

[0158] The mutation site information of the homozygous gene-edited lines scl30-1 and scl30-2 is available at Figure 1 C.

[0159] 1.5 Phenotypic analysis of the homozygous gene-edited lines scl30-1 and scl30-2

[0160] The heading phenotypes and heading dates of the gene-edited lines scl30-1 and scl30-2 obtained in step 1.4 were compared. Figure 3 A and B. Nipponbare was used as the control group.

[0161] from Figure 3 As shown in Figure A, under long-day conditions, the heading period of the gene-edited lines scl30-1 and scl30-2 was advanced by 5 to 6 days compared with Nipponbare.

[0162] from Figure 3 As shown in Figure B, under short-day conditions, the heading period of the gene-edited lines scl30-1 and scl30-2 was advanced by 4 to 5 days compared with Nipponbare.

[0163] The plant type and plant height of the gene-edited lines scl30-1 and scl30-2 obtained in step 1.4 were compared. Figure 3 C and D. Nipponbare was used as the control group.

[0164] from Figure 3 As shown in Figure D, the plant height of the gene-edited lines scl30-1 and scl30-2 decreased by 7.36% to 10.40% compared with Nipponbare.

[0165] Therefore, compared with Nipponbare, the heading date of the gene-edited lines scl30-1 and scl30-2 was advanced and the plant height was reduced, indicating that the gene OsSCL30 affected the heading date and plant height of rice.

[0166] 1.6 Investigation of the heading date of homozygous gene-edited lines scl30-1 and scl30-2 under long- and short-day conditions

[0167] Nipponbare (abbreviated as Nip), gene-edited line scl30-1 (abbreviated as scl30-1), and gene-edited line scl30-2 (abbreviated as scl30-2) were treated under artificially controlled long-day and short-day conditions, respectively. The long-day condition was 14 h light and 10 h dark, and the short-day condition was 10 h light and 14 h dark. The results are shown in Figure 4 .

[0168] from Figure 4 As shown in Figures A and B, compared with Nipponbare, under long-day conditions, the gene-edited lines scl30-1 and scl30-2 headed approximately 5 to 6 days earlier.

[0169] from Figure 4 As shown in Figures C and D, compared with Nipponbare, under short-day conditions, the gene-edited lines scl30-1 and scl30-2 headed approximately 4 to 5 days earlier.

[0170] Therefore, under long-day and short-day conditions, the gene-edited lines scl30-1 and scl30-2 both showed the trait of early heading date.

[0171] Example 2 Construction of complementation vector, genetic transformation and acquisition of complementation strain

[0172] In this example, in order to verify the effect of changes in the expression level of the OsSCL30 gene, a functional complementation line was constructed based on the gene editing line scl30-1 obtained in Example 1, and the full-length coding regions of isoform 1 (SEQ ID No. 8) and isoform 2 (SEQ ID No. 9) of the OsSCL30 gene were cleaved. Figure 4 A) The clones were amplified, inserted into the backbone vector pCAMBIA1301, and transformed into the gene-edited line scl30-1 via Agrobacterium-mediated transformation to obtain complementation lines C1 and C2, respectively.

[0173] 2.1 Construction of complementation vector and genetic transformation

[0174] Based on the gene editing line scl30-1 of Example 1, a functional complementation line was constructed, and the full-length coding regions of isoform 1 (SEQ ID No. 8) and isoform 2 (SEQ ID No. 9) of the OsSCL30 gene were cloned ( Figure 4A) Specific primers, OsSCL30-CDS-F and OsSCL30-CDS-Flag-R, were designed for amplification using Nipponbare cDNA as a template. The purified DNA fragments were ligated into the pCAMBIA1301 vector digested with Nco I and BstE II using T4 ligase. After sequencing and alignment, the pCaMV 35S::OsSCL30-Flag vector, containing a Flag tag fused to the CaMV 35S promoter, was obtained. The vectors were then transformed into the gene-edited line scl30-1 via Agrobacterium-mediated transformation, yielding complementation lines C1 and C2, respectively.

[0175] The sequences of the isoforms of the OsSCL30 gene are as follows:

[0176] CCCTAGGAGGGGCTATGGTGGCAGAGGAAGAAGTCCCCCTAGGAGGGGATATGGAGGACGGAGGGAGCAGGGTTCTGGAAGTCTCTTGGTCCGCAACATCCCATTAAGCTGCAGAGGGGAGGATCTTCGAGTTCCTTTTGAAAGGTTTGGTCCTGTTCGGGATGTTTACCTGCCAAAGGATTATTACAGCGGGGAACCACGGGGATTTGCATTTGTGGAGTTCGTTGACCCTTATGATGCCTCTGAGGCTCAATATCACATGAATCGCCAGGTGTTTTTCGGCCGGGAGATAACTGTTGTTCTTGCTGCTGAGTCGCGGAAAAGGCCAGAGGAAATGCGCAGTAGAGCTAGAGTCAGGGGTTACTCTGGAAACGAAGGGCGCCGCTCTTCATATTATGGGAGGTCTCGTTCCCGTTCTCGCTCTCCCCACTATCGAGGTCGTCCACGGTCAAGGTCATACTCTCCTGCTCCAAGACGGCGAGATGACTACTCAGCTTCCCCACCGAGAAAGGATACGCACCCCACAAAATCTCCTAGGCGTCAGCCAAAAGAACATGATGAAGAGAAGAAGCGGAGATCCTACTCTCCTGCCAGTAGAGATGGCGACCCTCGCGATGCTGATAACGGTTATGAGAAGAGGTCGCCCCCACCTGACAGCGATGGATCCCCTCCACACCGGAGGTCTCCTAGGCACTCCTCAGGGTCGCCTCCAGGATCCCGCTCTAGGTCCGCCGATGTTTCCCCTGCCCGCAGCGACGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTGA(SEQ ID No.8)

[0177] CCCTAGGAGGGGCTATGGTGGCAGAGGAAGAAGTCCCCCTAGGAGGGGATATGGAGGACGGAGGGAGCAGGGTTCTGGAAGTCTCTTGGTCCGCAACATCCCATTAAGCTGCAGAGGGGAGGATCTTCGAGTTCCTTTTGAAAGGTTTGGTCCTGTTCGGGATGTTTACCTGCCAAAGGATTATTACAGCGGGGAACCACGGGGATTTGCATTTGTGGAGTTCGTTGACCCTTATGATGCCTCTGAGGCTCAATATCACATGAATCGCCAGGTGTTTTTCGGCCGGGAGATAACTGTTGTTCTTGCTGCTGAGTCGCGGAAAAGGCCAGAGGAAATGCGCAGTAGAGCTAGAGTCAGGAGGTCTCGTTCCCGTTCTCGCTCTCCCCACTATCGAGGTCGTCCACGGTCAAGGTCATACTCTCCTGCTCCAAGACGGCGAGATGACTACTCAGCTTCCCCACCGAGAAAGGATACGCACCCCACAAAATCTCCTAGGCGTCAGCCAAAAGAACATGATGAAGAGAAGAAGCGGAGATCCTACTCTCCTGCCAGTAGAGATGGCGACCCTCGCGATGCTGATAACGGTTATGAGAAGAGGTCGCCCCCACCTGACAGCGATGGATCCCCTCCACACCGGAGGTCTCCTAGGCACTCCTCAGGGTCGCCTCCAGGATCCCGCTCTAGGTCCGCCGATGTTTCCCCTGCCCGCAGCGACGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTGA(SEQ ID No.9)

[0178] OsSCL30-CDS-F:catgccatggATGAGGAGGTACAGCCCACCAT(SEQ ID No.23)

[0179] OsSCL30-CDS-Flag-R: actgggtcaccTCACTTGTCATCGTCATCCTTGTAGTCGATGTCATGATCTTTAATCACCGTCATGGTCTTTGTAGTCGTCGCTGCGGGCAGG (SEQ ID No. 24)

[0180] Agrobacterium-mediated transformation was the same as steps 1.2.1-1.2.7 in Example 1.

[0181] At the same time, Nipponbare and the gene-edited rice line scl30-1 were used as control groups.

[0182] 2.2 Results inspection:

[0183] Positive plants of C1 and C2 complementary lines of transgenic rice were screened, and then further generations were planted. The relative expression levels of the obtained T1 transgenic rice were analyzed.

[0184] 2.2.1 Positive Detection Analysis

[0185] The positive results of transgenic rice of C1 and C2 complementation lines are shown in Figure 4 B and C.

[0186] Figure 4 Figures B and C show positive results for complementation lines C1 and C2. P is a positive control; N is a negative control; C1 and C2 are functional complementation lines for OsSCL30; and M5000 is a 5000 DNA marker.

[0187] Two complementary lines were screened for each: C1-1, C1-2, C2-1 and C2-2.

[0188] 2.2.2 Relative expression analysis

[0189] The relative expression of OsSCL30 gene in complementation lines C1-1, C1-2, C2-1 and C2-2 was determined by qRT-PCR with OsActin as internal reference. The relative expression analysis is shown in Figure 4 Middle D.

[0190] from Figure 2 As shown in Figure D, the relative expression level of the OsSCL30 gene in the complementation line C1-1 was the highest.

[0191] 2.2.3 Phenotypic analysis

[0192] The heading phenotype and heading date of Nipponbare, gene-edited line scl30-1, C1 complementation line and C2 complementation line were compared. Figure 5 .

[0193] The results are shown in the comparison of heading period between Nipponbare, gene-edited line scl30-1 and complementation lines C1 and C2. Figure 5 Middle B.

[0194] from Figure 5 As shown in Figure B, compared with the gene-edited line scl30-1, the heading period of the complemented line C1 was delayed by 9 to 11 days, and the heading period of the complemented line C2 was delayed by 8 to 9 days.

[0195] Comparison of plant heights of Nipponbare, gene-edited line scl30-1, and complementation lines C1 and C2. Figure 5 Middle D.

[0196] from Figure 5 As shown in Figure D, compared with the gene-edited line scl30-1, the plant height of the complementation line C1 increased by 13.32-20.74%; compared with the gene-edited line scl30-1, the plant height of the complementation line C2 increased by 8.51-10.55%.

[0197] Therefore, compared with the gene-edited line scl30-1, the complementary line C1 showed significant differences in heading date and plant height, complementing the phenotype of the gene-edited line scl30-1 to a certain extent. Compared with the gene-edited line scl30-1, the complementary line C2 also showed significant differences in heading date and plant height, complementing the phenotype of the gene-edited line scl30-1 to a certain extent. Furthermore, compared with Nipponbare, the complementary lines C1 and C2 showed delayed heading date and increased plant height.

[0198] Overall, both complementation lines C1 and C2 complemented the phenotype of the gene-edited line scl30-1 to some extent, and the phenotypes of complementation lines C1 and C2 were relatively consistent, corresponding to the relatively consistent functions of the two OsSCL30 isoforms. This further demonstrates that the OsSCL30 gene affects rice heading date and plant height. Furthermore, compared with complementation line C2, complementation line C1 exhibited an earlier heading date and increased plant height, suggesting that differences in the functions or expression levels of the two OsSCL30 isoforms may contribute to some phenotypic differences in plants, and that the two isoforms may have distinct functions in traits such as heading date and plant height.

[0199] Example 3 Functional Verification

[0200] In this Example 3, the gene-edited rice line scl30-1 obtained in Example 1 was used as the female parent for hybridization with Nipponbare to obtain the F1 generation, which was then examined.

[0201] 3.1 Obtaining F1 Generation

[0202] The gene-edited line scl30-1 was used as the female parent and Nipponbare was used as the male parent. The cells were grown under a light-period of 14 h / 28°C, dark-period of 10 h / 25°C, and a light intensity of 900 μmol·m -2 ·s-1 Hybridization was performed by cultivating the rice panicles at 70% humidity. Use scissors to remove the spikelets from the upper and lower branches of the female gene-edited line scl30-1 rice panicle, retaining 20 to 30 spikelets on the middle branches that would flower on the same day or the next. Remove the tassels using the lemma-cutting method. Use scissors to diagonally cut off one-third to one-quarter of the upper lemma of the floret. Use tweezers to reach into the palea and gently remove six anthers. Place the emasculated rice panicle in a paper bag and tie it with a playing card. Collect pollen from the rice panicles of the male parent, Nipponbare, and immediately take them to the female gene-edited line scl30-1 plant. Use a brush to dip a little pollen and gently apply it to the stigma. After pollination, continue to cover the female gene-edited line scl30-1 rice panicle with the paper bag. Ten days after pollination, remove the paper bag from the hybrid panicle. If the ovary in the pollinated floret has expanded, it indicates fertilization, indicating a successful hybridization and the production of F1 seeds. The F1 generation was planted under natural long-day conditions in Hangzhou.

[0203] At the same time, Nipponbare and the gene-edited line scl30-1 were used as controls.

[0204] 3.2 Phenotypic analysis of the F1 generation

[0205] 3.2.1 Investigation of plant height and heading period

[0206] The gene-edited rice lines scl30-1, Nipponbare, and F1 generation were photographed at maturity and heading, and the plant height and heading date were counted.

[0207] The actual results of the photos taken during the maturity and heading period are shown in Figure 6 A and B.

[0208] The comparison results of plant height and heading date are shown in Figure 6 Middle C and D.

[0209] from Figure 6 As shown in Figure C, the plant height of the F1 generation is 10.54 cm higher than that of the gene-edited line scl30-1, but there is no significant difference from Nipponbare.

[0210] from Figure 6 As shown in Figure D, the heading date of the F1 generation was 5 to 6 days later than that of the gene-edited line scl30-1, but had no significant difference from that of Nipponbare.

[0211] It was inferred that OsSCL30 was a dominant nuclear gene, and the traits of delayed heading and increased plant height that it controlled were both dominant traits.

[0212] Molecular markers can reflect specific DNA fragments that differ in the genomes of biological individuals or populations. Molecular marker development was performed on the gene-edited line scl30-1. Since the gene-edited line scl30-1 has a 2bp deletion at the target site 2 ( Figure 1C), design specific primers MMF / MMR (SEQ ID No.6 and SEQ ID No.7) for labeling ( Figure 6 Middle (E), which is beneficial for screening progeny of the gene-edited line scl30-1 when used as a planting resource and hybridized with other rice varieties.

[0213] Example 4 Expression of OsSCL30 gene

[0214] In this example, to investigate the spatiotemporal expression characteristics of the OsSCL30 gene, the GUS gene under the control of the OsSCL30 promoter (SEQ ID No. 10) was used as a reporter gene, inserted into the backbone vector pCAMBIA1381Z, and transformed into Nipponbare via Agrobacterium-mediated transformation to obtain a promoter-transgenic strain. The expression patterns of the OsSCL30 gene in different tissues of Nipponbare, including roots, stems, leaves before heading, leaves at heading, and spikelets, were analyzed using qRT-PCR and GUS staining techniques. The following are included:

[0215] 4.1 Construction of promoter vector

[0216] The GUS gene under the control of the OsSCL30 promoter (SEQ ID No. 10) was used as a reporter gene. Specific primers OsSCL30-PF and OsSCL30-PR were designed to amplify the OsSCL30 promoter, using Nipponbare DNA as a template. The purified DNA fragment was ligated with T4 ligase into the pCAMBIA1381Z vector digested with BamHI and HindIII. After sequencing and alignment, the pOsSCL30::GUS vector was obtained.

[0217] The specific primers for amplifying the OsSCL30 promoter are:

[0218] Forward primer OsSCL30-PF: cgcggatccTCTATCCAGGCACAGTTGGATGTT (SEQ ID No. 25)

[0219] Reverse primer OsSCL30-PR: cccaagcttTGTTTTGTCTGAAGCACATAACAGAA (SEQ ID No. 26)

[0220] 4.2 Genetic transformation of promoter vector

[0221] The promoter vector obtained in step 4.1 is transformed into rice by genetic transformation method. The genetic transformation steps are the same as steps 1.2.1-1.2.7 in Example 1.

[0222] 4.3 Study on the spatiotemporal expression characteristics of the OsSCL30 gene

[0223] The expression pattern of the OsSCL30 gene in various tissues was analyzed by qRT-PCR and GUS staining. The sampling sites and periods included roots, stems, stem tips, internodes, leaves before heading (leaf 1), leaves at heading (leaf 2), spikelets before anthesis, spikelets at anthesis, and spikelets on days 1, 3, 5, 7, 11, 17, and 21 after anthesis (corresponding to spikelets 1 to 9).

[0224] Using OsActin as the internal reference, the expression level of OsSCL30 gene in various tissues was detected by qRT-PCR. Figure 7 Middle A. Three replicates were set up for each tissue.

[0225] The results showed that the OsSCL30 gene was expressed in all the tissues tested, and the expression of the OsSCL30 gene was relatively high in leaves, especially in young leaves; the expression was extremely low in roots, stems, and spikelets at all stages ( Figure 7 Middle A).

[0226] GUS staining results are shown in Figure 7 Medium BQ.

[0227] The results showed that the leaves before heading ( Figure 7 D) and stamens ( Figure 7 H) has strong GUS activity, and in the internodes ( Figure 7 B) Leaves at heading stage ( Figure 7 E), pistil ( Figure 7 G), caryopsis on the 1st, 3rd, 5th, 7th and 11th day after fertilization ( Figure 7 IM) and spikelets on the 1st, 3rd, and 5th days after fertilization ( Figure 7 OQ) observed weak GUS activity, while in the shoot apex ( Figure 7 C) Root ( Figure 7 F) and spikelets before anthesis ( Figure 7 In N), almost no GUS activity was detected.

Claims

1. Use of the OsSCL30 gene in screening for products that regulate the heading period of rice. The polynucleotide sequence of the OsSCL30 gene is represented by SEQ ID NO.

1. The regulation is based on CRISPR / Cas9-based sgRNA inhibition or blocking of OsSCL30 gene expression, thereby advancing the heading period of rice.

2. Use of a mutant of the OsSCL30 gene or a biological material containing the mutant for regulating the heading date of rice, wherein the mutant is obtained by mutating the OsSCL30 gene to inhibit or block the expression of the OsSCL30 gene, and the polynucleotide sequence of the OsSCL30 gene is the sequence shown in SEQ ID NO.

1. The regulation refers to inhibiting or blocking the expression of the OsSCL30 gene, thereby causing the rice to exhibit an advanced heading date.

3. The use according to claim 2, characterized in that The biological material is selected from one or more of recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

4. A method for advancing the heading period of rice, characterized in that: include: Genetic engineering methods are used to inhibit or block the expression of the OsSCL30 gene in rice, thereby obtaining rice with an early heading period; the polynucleotide sequence of the OsSCL30 gene is the sequence shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that include: Using the OsSCL30 gene as the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment encoding the sgRNA sequence was ligated into a CRISPR / Cas9-carrying vector and used to transform rice to obtain rice with an early heading period.

6. The method according to claim 5, characterized in that The target sequences of sgRNA are SEQ ID No. 2 and SEQ ID No. 3.

Images