A pH- and thermo-responsive iron nanogel and its preparation method and application

Abstract

The present invention discloses a pH- and thermoresponsive iron nanogel and its preparation method and application. The iron nanogel is composed of Fe3O4 nanoparticles surface-modified with compound 2, compound 3, RNA or protein, polyethyleneimine-polyethylene glycol, and dopamine. Compound 2 is a small molecule compound containing ortho-dihydroxybenzene groups and having a protected boronic acid group structure at the end. Compound 3 is a small molecule structure in which phenyl diisothiocyanate-modified glycine has an exposed carboxyl group at the end that can react with amino groups. The iron nanogel in the present invention not only has good magnetic thermal properties but also has the ability to encapsulate drugs. Under the condition that certain acid and heat coexist, the iron nanogel can be controllably disassembled to release bioactive drugs, activate the body's immune system, and inhibit the growth of tumor cells by means of mild hyperthermia to achieve the effect of combined therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedical engineering materials, and particularly relates to a pH- and thermoresponsive iron nanogel and its preparation method and application. Background Art

[0002] Gene therapy has always been one of the fastest-developing fields in clinical practice. It involves introducing exogenous genes into target cells to regulate the expression of target genes or proteins, either upregulating or downregulating, in order to correct or compensate for diseases caused by defective and abnormal genes. The strategies of gene therapy are very diverse and have shown great promise in the treatment of genetic and acquired diseases. It is regarded as the treatment method most likely to cure major diseases such as cancer at the root. Currently, in clinical applications for delivering RNA, the main methods are to modify the RNA itself or use liposomes, with limited application of other materials. This has led to poor stability and low targeting of many RNA drugs entering clinical trials, resulting in a high dosing frequency and ultimately serious immune-related toxicity events.

[0003] Hydrogels, as non-viral gene therapy vectors with advantages such as low immunogenicity, low cost, and easy scalability, are polymers with hydrophilic groups that can be swollen by water but are insoluble in water and have a three-dimensional network structure crosslinked by physical or chemical means.

[0004] In recent years, environmentally sensitive polymer hydrogel materials that can sense tiny external stimuli have received extensive attention. It has been found through research that changes in the environment such as pH value, temperature, solvent composition, salt concentration, light field, force field, and electric field can cause hydrogels to respond to these changes and undergo phase transitions accompanied by a series of property changes. In the field of drug release, mostly the microenvironmental characteristics of the target site are utilized for enzyme response, or the high levels of reactive oxygen species (ROS) in tumor cells are utilized for release. However, in order to achieve controlled release and further achieve a reasonable distribution of nanoparticles to reduce side effects, generating magnetothermal / photothermal effects through an external magnetic field / light field as a controllable physical stimulation method can also be used in controlled release.

[0005] Hyperthermia is an emerging cancer treatment method. By means of physical energy heating, it raises the temperature of the lesion area or the whole body. It kills tumor cells by changing the structure of tumor cells and affecting cell metabolism, and can even mobilize the body's immune response to achieve the effect of systemic treatment. Compared with other traditional treatment methods, hyperthermia has many advantages such as non-invasive, non-radiative, and easy to tolerate. The hyperthermia methods that have been studied more include photothermal therapy and magnetic induction hyperthermia. The concept of magnetic induction hyperthermia was first proposed by Gilchrist et al. in 1957. Compared with photothermal therapy, it has the advantages of not being limited by the light penetration depth, no photo-bleaching and photo-toxicity, little influence of biological tissues on the magnetic field strength, and being able to precisely control the local temperature in a remotely controlled manner, and has good targeting, so it has great application potential. However, at present, the magnetic heat conversion efficiency of magnetic hyperthermia media is relatively low, the drug dose required for treatment is large, and the biological safety is relatively low, so its application is restricted to a certain extent. Summary of the Invention

[0006] Object of the Invention: Aiming at the deficiencies of the prior art, the present invention provides a pH- and heat-responsive iron nanogel. The iron nanogel prepared by the present invention not only has good magnetic heat performance but also has the ability to encapsulate drugs. Under the condition that certain acid and heat exist simultaneously, the assembly can be controllably disassembled to release bioactive RNA or protein drugs, activate the body's immune system, and inhibit the growth of tumor cells by means of mild hyperthermia to achieve the effect of combined treatment.

[0007] Another object of the present invention is to provide a preparation method and application of the pH- and heat-responsive iron nanogel.

[0008] Technical Means: In order to achieve the above object, the present invention relates to a pH- and heat-responsive iron nanogel, wherein the iron nanogel is composed of Fe3O4 nanoparticles surface-modified with Compound 2, Compound 3, RNA or protein, polyethyleneimine-polyethylene glycol, and dopamine. Compound 2 is a small molecule compound containing o-dihydroxybenzene groups and having a protected boronic acid group structure at the end. Compound 3 is a small molecule structure in which phenyl diisothiocyanate-modified glycine has a naked carboxyl group at the end and can react with amino groups.

[0009] Among them, the iron nanogel is based on water-phase Fe3O4 nanoparticles with compound 2 and dopamine on the surface after ligand exchange. The pinacol protection is removed in methylboronic acid solution to expose the surface boronic acid groups. In a slightly alkaline environment, the boronic acid groups at the ends of compound 2 connected to the nanoparticle surface form borate ester bonds with RNA or protein to obtain an assembly. Then, polyethyleneimine-polyethylene glycol encapsulation is added. Finally, the acid and heat-responsive small molecule compound 3, p-phenylene diisothiocyanate-glycine, is subjected to a chemical reaction, and after purification, a pH- and heat-responsive Fe3O4 nanogel capable of loading RNA is obtained.

[0010] Among them, the compound 2 is one or more of phenylboronic acid and dopamine-phenylboronic acid; the compound 3 is one or more of p-phenylene diisothiocyanate-modified glycine.

[0011] Preferably, the structures of the compound 2 and the compound 3 are respectively shown as follows:

[0012]

[0013] Among them, the RNA or protein is functional RNA or protein, preferably RNA or protein that can reduce the expression of PDL1.

[0014] Preferably, the sequence of the RNA that reduces the expression of PDL1 is: UGGCAGUGUCUUAGCUGGUUGU (sense strand) and AACCAGCUAAGACACUGCCAUU (antisense strand).

[0015] The preparation method of the pH- and heat-responsive iron nanogel of the present invention includes the following steps:

[0016] (1) Using iron(III) acetylacetonate as a precursor, Fe3O4 nanoparticles coated with oleylamine and oleic acid are prepared by a thermal decomposition method;

[0017] (2) The Fe3O4 nanoparticles obtained in the above step are subjected to a ligand exchange reaction with compound 2 and dopamine to obtain monodisperse water-phase Fe3O4 nanoparticles;

[0018] (3) The monodisperse water-phase Fe3O4 nanoparticles are mixed with RNA or protein to obtain an Fe3O4 nanomedicine-loaded assembly;

[0019] (4) The Fe3O4 nanomedicine-loaded assembly is mixed with PEI-PEG to obtain an unblocked iron assembly;

[0020] (5) The unblocked iron assembly is mixed with compound 3 to obtain a pH- and heat-responsive Fe3O4 nanogel.

[0021] Among them, the diameter of the Fe3O4 nanoparticles coated with oleylamine and oleic acid in step (1) is 10 - 12 nm.

[0022] Among them, the ligand exchange reaction in step (2) is as follows: The Fe3O4 nanoparticles coated with oleylamine and oleic acid are dispersed in a good solvent, and a mixed solution of compound 2 and dopamine is added. After the reaction, it is cooled and centrifuged, and deionized water is added to obtain monodisperse aqueous-phase Fe3O4 nanoparticles; the good solvent is chloroform or / and tetrahydrofuran.

[0023] Among them, in step (3), the aqueous-phase Fe3O4 nanoparticles and the RNA or protein solution are uniformly mixed in a certain proportion to obtain the Fe3O4 nanomedicine assembly.

[0024] Among them, in step (4), the Fe3O4 nanomedicine assembly and PEI-PEG are mixed in a certain proportion, and the proportion is 1:1 - 1:4 to obtain the unblocked iron assembly.

[0025] Among them, compound 3 is dissolved in a good solvent, activated by 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide or 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, and then added to the aqueous-phase unblocked iron assembly. After the mixed reaction, it is purified to obtain the pH and thermoresponsive Fe3O4 nanogel.

[0026] Among them, the good solvent for compound 3 is N,N-dimethylformamide or / and dimethyl sulfoxide.

[0027] Application of the pH and thermoresponsive iron nanogel described in the present invention in the preparation of RNA delivery drugs or reagents.

[0028] Application of the pH and thermoresponsive iron nanogel described in the present invention in the preparation of tumor treatment drugs or reagents.

[0029] Based on the aqueous-phase Fe3O4 nanoparticles obtained after ligand exchange, the present invention forms a loose iron assembly through cross-linking of small molecule ligands on the surface of the aqueous-phase Fe3O4 nanoparticles under the action of protein / RNA. And after polymer encapsulation, glycine-modified p-phenylene diisothiocyanate is added to obtain the responsive nanogel. The nanogel of the present invention is a pH and thermo-dual-responsive Fe3O4 nanogel assembly with good magnetic hyperthermia effect, dual responsiveness, gene drug encapsulation and controlled release ability, and mainly introduces small molecules with pH and thermo-dual responsiveness to make the Fe3O4 nanoparticle assembly into a nanogel with dual-responsive characteristics.

[0030] Specifically, a dual-responsive Fe3O4 nanogel of the present invention, wherein the aqueous-phase Fe3O4 nanoparticles are based on the oil-phase Fe3O4 nanoparticles and are obtained by ligand exchange reaction to obtain aqueous-phase Fe3O4 nanoparticles surface-modified with compound 2 and dopamine. Compound 2 is a small molecule compound containing a phenylboronic acid structure, and its terminal can form a borate ester bond with the ortho-dihydroxy group of proteins or RNA. This bond is dynamically reversible and is pH-dependent in an aqueous medium. Subsequently, the polymer PEI-PEG is used to modify its surface by electrostatic adsorption, such as increasing the surface charge density, improving the dispersibility, and facilitating gene delivery. Then, activated compound 3 is added to crosslink the amino groups on PEI through an amide reaction. The crosslinked structure is similar to the structure formed by coupling phenyl isothiocyanate (PITC) with the α-amino group of peptides or proteins under alkaline conditions in the Edman reaction. It can break the bond and form a ring under acid-heat conditions to generate phenylhydantoin, and the crosslinked structure can also effectively prevent the leakage of protein / gene drugs.

[0031] The present invention designs a pH- and heat-responsive iron nanogel, which combines the acidic environment of tumors and externally applied magnetic field-controlled heat generation to achieve spatially and temporally controlled release of RNA under dual endogenous and exogenous conditions. The heat-responsive release of RNA is based on the principle of temperature phase change. In the present invention, it is achieved through small molecules in the Edman reaction, which is a new method for exogenous controlled release of RNA. The present invention can release under acid-heat conditions through the Edman reaction. Among them, specific compound 2 is used to bind iron and RNA, and compound 3 plays an acid-responsive role. And the process of loading compound 3 in the present invention is a two-phase reaction (N,N-dimethylformamide-water).

[0032] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0033] The pH- and heat-responsive iron nanogel prepared by the present invention not only has good magnetothermal properties but also has the ability to encapsulate drugs. Under the condition that a certain amount of acid and heat coexist, the iron nanogel can be controllably disassembled to release bioactive drugs, activate the body's immune system, and inhibit the growth of tumor cells through mild hyperthermia to achieve the effect of combined treatment.

[0034] Compared with traditional liposomes, the materials prepared by the present invention are cheaper and easier to store. Compared with photothermal therapy, the materials prepared by the present invention are not limited by light penetration depth, have no photo-bleaching and photo-toxicity, the biological tissue has little influence on the magnetic field strength, and can accurately control the local temperature in a remotely controlled manner, with good targeting and other advantages. And this preparation can combine magnetothermal therapy and gene therapy to achieve the effect of 1 + 1 > 2. Description of the Drawings

[0035] Figure 1 1H NMR spectrum of the compound 2 synthesized in Example 1.

[0036] Figure 2 1H NMR spectrum of the PEI-PEG synthesized in Example 2.

[0037] Figure 3 1H NMR spectrum of the compound 3 synthesized in Example 3.

[0038] Figure 4 Transmission electron microscopy image of the monodisperse Fe3O4 nanoparticles synthesized in Example 4.

[0039] Figure 5 Transmission electron microscopy image of the pH- and thermo-responsive Fe3O4 nanogels synthesized in Example 6.

[0040] Figure 6 Dynamic light scattering particle size distribution and zeta potential graphs of the nanoparticles synthesized in Examples 5 and 6.

[0041] Figure 7 Dynamic light scattering particle size distribution graphs of the pH- and thermo-responsive Fe3O4 nanogels in PBS and water media for different days in Example 7.

[0042] Figure 8 Agarose gel electrophoresis image of the pH- and thermo-responsive Fe3O4 nanogels incubated with different concentrations of nuclease in Example 7.

[0043] Figure 9 Temperature-time change curve graph of the pH- and thermo-responsive Fe3O4 nanogels under different current-applied magnetic fields in Example 8.

[0044] Figure 10 Temperature-time change curve graphs of different concentrations of the pH- and thermo-responsive Fe3O4 nanogels under an applied magnetic field in Example 8.

[0045] Figure 11 Thermal cycling curve graph of the pH- and thermo-responsive Fe3O4 nanogels in Example 8.

[0046] Figure 12 Transmission electron microscopy image of the pH- and thermo-responsive Fe3O4 nanogels after acid heat treatment in Example 9.

[0047] Figure 13 Drug release efficiency graphs of the pH- and thermo-responsive Fe3O4 nanogels and the unblocked iron assemblies under the influence of heat in Example 9.

[0048] Figure 14Drug release efficiency diagrams of pH- and thermo-responsive Fe3O4 nanogels and unblocked iron assemblies under the influence of pH in Example 9.

[0049] Figure 15 Drug release efficiency of pH- and thermo-responsive Fe3O4 nanogels with different crosslinking degrees under the influence of pH and heat in Example 9.

[0050] Figure 16 Dynamic light scattering particle size distribution diagrams of pH- and thermo-responsive Fe3O4 nanogels and unblocked iron assemblies in acidic medium and culture medium for different days in Example 9.

[0051] Figure 17 Agarose gel electrophoresis diagrams of pH- and thermo-responsive Fe3O4 nanogels incubated with heparin under different treatments in Example 9.

[0052] Figure 18 Confocal microscopy diagrams of 4T1 cells uptake of pH- and thermo-responsive Fe3O4 nanogels in Example 10.

[0053] Figure 19 Fluorescence microscopy diagrams of live / dead staining of 4T1 cells after different treatments in Example 11.

[0054] Figure 20 Quantification diagrams of PDL1 mRNA of 4T1 cells after different treatments in Example 11.

[0055] Figure 21 Temperature-time change curve diagrams of tumor sites of different groups of mice during magnetic heat treatment after drug administration in Example 12;

[0056] Figure 22 Tumor volume-time change curve diagrams of different groups of mice within 14 days after drug administration in Example 12;

[0057] Figure 23 Body weight-time change curve diagrams of different groups of mice within 14 days after drug administration in Example 12. Specific implementation examples

[0058] The present invention will be further described below in conjunction with the accompanying drawings and examples.

[0059] Materials, reagents, etc. used in the following examples can be obtained from commercial sources without special instructions.

[0060] Example 1

[0061] Synthesis of dopamine-phenylboronic acid: 4-Carboxy-3-fluorophenylboronic acid (183.93 mg, 1 mmol) and pinacol (118.17, 1 mmol) were dissolved in 15 mL of tetrahydrofuran, stirred overnight at room temperature, and then the solvent was removed by rotary evaporation. Methanol was added for recrystallization to obtain a white solid, which was the product (Compound 1).

[0062] Subsequently, Compound 1 (400 mg, 1.5 mmol), dopamine hydrochloride (189 mg, 1 mmol), and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (247 mg, 1 mmol) were dissolved in 20 mL of methanol. After ultrasonic dissolution, the reaction was carried out overnight under the protection of an inert gas. After removing the solvent by rotary evaporation, it was dissolved in 3 mL of dichloromethane, and then developed on a silica gel plate with dichloromethane-methanol (volume ratio 8:1). The corresponding band was scraped and collected, and rinsed with a dichloromethane-methanol (volume ratio 9:1) mixed solution and collected. After removing the solvent by rotary evaporation, Compound 2 was obtained. The results are as Figure 1 shown, and the NMR data are as follows: 1 H NMR (400 MHz, Methanol-d4) δ 8.82 (dd, J = 4.3, 1.7 Hz, 2H), 8.40–8.35 (m, 1H), 7.76 (ddd, J = 8.5, 6.8, 1.5 Hz, 3H), 7.66–7.54 (m, 3H), 3.87 (d, J = 5.4 Hz, 2H), 1.43–1.20 (m, 12H). It indicates that the Boc-protected dopamine-phenylboronic acid small molecule ligand was successfully synthesized.

[0063]

[0064] Example 2

[0065] Synthesis of the polymer (polyethyleneimine modified with polyethylene glycol) PEI-PEG: First, the alcohol in chloroform was removed by two-phase extraction, and then anhydrous chloroform was obtained by redistillation in a round-bottom flask containing calcium chloride. 1 g of polyethylene glycol PEG (Mw ∼ 2000) and 97.2 mg of N,N-carbonyldiimidazole (CDI) were dissolved in 10 mL of anhydrous and alcohol-free chloroform and stirred for 3 - 4 h. Then the reaction solution was dropped into 50 mL of anhydrous ether drop by drop. At this time, a white precipitate was formed. After high-speed centrifugation, the precipitate was taken and washed 3 times with anhydrous ether, and then dried under vacuum to obtain activated PEG. All the activated PEG was mixed with 700 mg of polyethyleneimine PEI (Mw ∼ 1800) and stirred for 3 h. Repeat the above operation, drop the reaction solution into 50 mL of anhydrous ether drop by drop, a precipitate was formed. After high-speed centrifugation, the precipitate was taken and washed 3 times with anhydrous ether, and dried under vacuum to obtain PEI-PEG. The results are as Figure 2 shown. The NMR data are as follows: 1HNMR (400 MHz, Deuterium Oxide) δ3.62 (s, 7H) is the characteristic peak of methylene of polyethylene glycol, and 2.59 (s, 1H) is the characteristic peak of methylene of polyethyleneimine, which indicates the successful synthesis of PEI-PEG polymer.

[0066] Example 3

[0067] Synthesis of responsive small molecule glycine-modified p-phenylene diisothiocyanate (PDITC-Gly): Weigh 0.200g (1.02mmol) of p-phenylene diisothiocyanate and dissolve it in 6.0mL of tetrahydrofuran solution, add it to a 25mL volumetric flask, weigh 0.152g (2.04mmol) of glycine and dissolve it in 2.0mL of (1mol / L) sodium hydroxide solution. At room temperature, add the glycine solution to the p-phenylene diisothiocyanate solution and stir it at room temperature overnight under nitrogen protection. After stirring at room temperature overnight, when the entire reaction system is milky white, remove the solvent by rotary evaporation to obtain a white solid. After suspending with 2M hydrochloric acid, extract with ethyl acetate three times, pour off the ethyl acetate layer, and obtain an insoluble white solid in the water layer. Since there is a lot of precipitation on the wall of the volumetric flask in this step, in order to prevent product loss, the extraction operation is directly performed in the volumetric flask. After transferring to the filtration device, remove water with a water pump and put it into a vacuum drying oven to dry overnight to obtain compound 3. The results are as follows Figure 3 The NMR data are as follows: 1 HNMR (400MHz, DMSO-d6) δ12.55 (s, 2H), 9.84 (s, 2H), 7.8 (s, 2H), 7.4 (s, 4H), 4.21 (s, 4H). This indicates that the pH and heat dual-responsive small molecule ligand was successfully synthesized.

[0068]

[0069] Example 4

[0070] Synthesis of Fe3O4 nanoparticles coated with oleylamine and oleic acid: ferric acetylacetonate (1.4 g) was dissolved in a mixture of oleylamine (12 mL) and oleic acid (8 mL), heated to 120°C, accompanied by the introduction of inert gas argon, and kept warm for 1 hour, then quickly heated to 220°C and kept warm for 30 minutes; then, the temperature was raised to 300°C at a rate of 2°C / min, kept warm for 30 minutes, then quickly cooled to 120°C and kept warm for 90 minutes, and finally cooled to room temperature, and the nanoparticles were precipitated with ethanol, centrifuged at 8000 rpm for 5 minutes, the supernatant was discarded, and the precipitate was re-dissolved in n-hexane to obtain Fe3O4 nanoparticles coated with oleylamine and oleic acid. The prepared Fe3O4 nanoparticles coated with oleylamine and oleic acid were characterized by transmission electron microscopy for morphology and size, such as Figure 4As shown, it indicates the successful synthesis of monodisperse aqueous Fe3O4 nanoparticles.

[0071] Example 5

[0072] Synthesis of dopamine-phenylboronic acid modified Fe3O4 nanoparticles: After washing the Fe3O4 nanoparticles synthesized in Example 4 above with ethanol precipitation 3 times, the mass of the Fe3O4 nanoparticles used was obtained by weighing the difference in the weight of the centrifuge tube before and after. 15 mg each of dopamine and compound 2 were dissolved in 6 mL of N,N-dimethylformamide, added to a three-necked flask, and then heated under reflux with condensation. When the temperature of the liquid in the flask reached 50 °C, 10 mg of Fe3O4 (dissolved in 4 mL of tetrahydrofuran) nanoparticles were added with a syringe. After refluxing with condensation for 4 hours, heating was stopped, and after cooling to room temperature, the solvent was removed by magnetic separation. Subsequently, free small molecules were removed by washing, and it was redissolved in 2 mL of deionized water. 2 mL of a methylboronic acid solution with a pH of 6 (6 mg / mL) was added to this solution and shaken for 3 hours to remove the pinacol protection and expose the surface boric acid groups. Then, it was redissolved in deionized water by magnetic separation to obtain dopamine-phenylboronic acid modified Fe3O4 nanoparticles.

[0073] Example 6

[0074] Synthesis of Fe3O4 nanogels

[0075] After determining the Fe concentration in the solution by ICP-MS, 1 mL of the dopamine-phenylboronic acid modified Fe3O4 nanoparticle solution with an Fe concentration of 1 mg / mL prepared in Example 5 was taken, and 200 μL of a protein / RNA mixed aqueous solution (10 mg / ml, the RNA was double-stranded RNA with a concentration of 10 μg / mL, the sequence was: UGGCAGUGUCUUAGCUGGUUGU (sense strand) and AACCAGCUAAGACACUGCCAUU (antisense strand), and the protein was bovine serum albumin with a concentration of 9.99 mg / mL) was added. After vortexing and mixing evenly, it was left standing at room temperature for 20 minutes to obtain iron assemblies (IONAs). 2 mL of a PEI-PEG solution with a concentration of 1 mg / mL was added and vortexed and mixed evenly, and then left standing for 20 minutes to obtain unblocked iron assemblies (UNPs). 1 mg of compound 3 and 2.7 mg of 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) were added to 1 mL of N,N-dimethylformamide and mixed and stirred for half an hour, then 2 μL of N,N-diisopropylethylamine was added and mixed evenly. 50 μL was taken and mixed with the above unblocked iron assemblies. After reacting overnight, impurities were removed and concentrated through a 30000 Da ultrafiltration centrifugal tube to obtain blocked iron nanogels (LNGs). The size and morphology of the obtained pH- and thermo-responsive Fe3O4 nanogels were characterized by transmission electron microscopy, and the results are as Figure 5 shown, proving its successful assembly and preparation.

[0076] The obtained monodisperse aqueous Fe3O4 nanoparticles (Example 4), Fe3O4 nanoassemblies (IONAs), PEI-PEG modified unblocked iron assemblies (UNPs), and Fe3O4 nanogels (LNGs) were characterized by particle size and potential analysis using a dynamic light scattering instrument. The results are as follows: Figure 6 As shown, the hydrated particle size of monodisperse aqueous Fe3O4 nanoparticles is about 35nm, and the potential is about 17.1mV due to the surface modification of dopamine and dopamine phenylboronic acid. The hydrated particle size of Fe3O4 nanoassemblies is about 149nm, and the potential is about -4.18mV because the biomacromolecules are negatively charged. The hydrated particle size of the unblocked iron assembly modified by PEI-PEG is about 128nm, and the potential is about 14.4mV, which is due to the positive charge of PEI-PEG. The hydrated particle size of Fe3O4 nanogel is about 128nm, and the potential is about 23.2mV.

[0077] Example 7

[0078] Stability evaluation of Fe3O4 nanogel: Dynamic light scattering was used to characterize the particle size of the obtained nanogel in water and PBS with a pH of 7.4 for different days to investigate the particle size stability. Figure 7 As shown in the figure, it was found that it can maintain a relatively stable particle size in both PBS and water. Then, agarose gel electrophoresis was used to examine the stability of the drug against nucleases. Sodium dodecyl sulfate (SDS) is a strong anionic substance, and its addition can compete RNA from the action of PEI-PEG. After adding different concentrations of nuclease and incubating for 1 hour, it can be seen that Figure 8 The bands shown are: 1. RNA 2. IONAs + RNase (5 μg / ml) 3. LNGs 4. LNGs + RNase (5 ug / ml) 5. LNGs + RNase (10 μg / ml) 6. LNGs + RNase (20 μg / ml). The bands remain intact, indicating that the preparation has an effect of resisting nucleases and will not lose activity due to nucleases present in the cell environment.

[0079] Example 8

[0080] Evaluation of magnetocaloric capacity of Fe3O4 nanogel: After determining the Fe concentration in the solution by ICP-MS, the 3mg / ml Fe3O4 nanogel (LNGs) solution prepared in Example 6 was taken and tested by a near-infrared thermal imager to evaluate its heat generation and heating capacity at different current intensities for 5 minutes under the action of a magnetic field with a frequency of 1478kHz. Figure 9The drug shown can reach 45°C in 5 minutes under the action of a magnetic field with a current of 10 A. Then, Fe3O4 nanogels (LNGs) with different concentrations were treated for 5 min under the action of a magnetic field with a frequency of 1478 kHz and a magnetic field strength of 27.67 kA / m. The results are as Figure 10 shown. It was found that when the concentration was 3 mg / ml, the temperature could rise to 45°C in 5 min, meeting the requirements of subsequent experiments. Subsequently, the preparation was heated and cooled by turning the external magnetic field on and off, and this was repeated three times continuously. It was found that its heating ability remained unchanged, as Figure 11 shown, indicating its thermal stability.

[0081] Example 9

[0082] Evaluation of the response ability of Fe3O4 nanogels

[0083] The method prepared in Example 6 was adopted, where RNA was replaced with FAM-labeled RNA (non-functional FAM-siRNA, purchased from Tsingke Biological).

[0084] 1. The prepared Fe3O4 nanogels (LNGs) were treated for 30 min under the conditions of an aqueous solution with pH 5.5 and 45°C, and their morphology was characterized by transmission electron microscopy. The results are as Figure 12 shown. The preparation dissociated, indicating that the iron nanogel was controllably disintegrated.

[0085] 2. Release rate experiment:

[0086] 2.1 Thermal response ability: First, the drug release efficiency of the prepared pH- and thermo-responsive Fe3O4 nanogels (LNGs) and unblocked iron assemblies (UNPs) under the influence of heat was evaluated. The preparation was placed in a dialysis bag activated at high temperature (molecular weight selected as 30 kDa), and the experiment was carried out in a centrifuge tube containing 20 mL of PBS medium with pH 7.4 at a rotation speed of 200 rpm. The release medium temperatures were 37°C and 45°C respectively. At fixed time points, 1 ml of the release medium was taken out and 1 ml of the release medium (PBS with pH 7.4) was added to ensure that the volume of the release medium remained unchanged. The emission intensity at 535 nm after excitation at 515 nm of the taken-out medium was measured, and the concentration was calculated according to the standard curve, and further the release percentage could be calculated. The results are as Figure 13 shown. It can be seen that heat has no effect on the nanogel itself, but for the unblocked iron assembly, it promotes its release.

[0087] 2.2 pH response ability: Next, the drug release efficiency of the prepared pH- and thermo-responsive Fe3O4 nanogels (LNGs) and unblocked iron assemblies (UNPs) under the influence of pH was evaluated. The experiment was the same as above, and the release medium temperature was 37°C. The difference was that the medium was changed to PBS with pH 6.8 to explore the influence of pH on the drug release behavior. The results are asFigure 14 As shown, pH only affects the unblocked iron assemblies and has no obvious effect on the nanogels.

[0088] 2.3 Acid and heat response ability: Subsequently, the drug release efficiency of the prepared pH- and thermo-responsive Fe3O4 nanogels (LNGs) with different crosslinking degrees under the influence of pH and heat was evaluated. The experiment was conducted as above, with the release medium temperature at 45 °C and the medium being PBS at pH 5.5. Nanogels with different crosslinking degrees were evaluated, as Figure 15 shown. The crosslinking degree increased from A to C. A was 40:1, B was 20:1, and C was 10:1 (the ratio of PEI-PEG to compound 3). The results were as Figure 15 shown. The nanogels did not respond under acidic conditions but responded and released under acid-heat conditions, and the lower the crosslinking degree, the higher the release rate.

[0089] The above experiments show that the Fe3O4 nanogels (LNGs) prepared in the present invention can make the nanogels respond only under the two conditions of acid and heat. This is mainly due to the role provided by compound 3, while the unblocked iron assemblies will also respond to a single factor of heat or acid.

[0090] 3. Stability in different media: The particle sizes of the Fe3O4 nanogels (LNGs) and unblocked iron assemblies (UNPs) prepared in Example 6 were characterized by a dynamic light scattering instrument at different days in PBS medium at pH 6.8 and RPMI 1640 culture medium to investigate the particle size stability. The results were as Figure 16 shown. It was found that the unblocked iron assemblies were unstable in PBS at pH 6.8, indicating that they responded to the single acidic factor dominated by PEI-PEG. However, the Fe3O4 nanogels could maintain excellent stability in these media, which means that it would not degrade in a single acidic environment and could adapt to subsequent cell experiments.

[0091] 4. Heparin competition experiment: Heparin is a negatively charged polysaccharide that can compete with genes for binding to polymers. If the binding strength of the nanogels themselves decreases, RNA is released and the band migrates. Nanogels treated differently were characterized by agarose gel electrophoresis. The experimental results were as Figure 17 shown. When heparin was incubated after the nanogels were treated with acid or heat alone, no free RNA bands appeared, but when heparin was incubated after the Fe3O4 nanogels were treated with both acid and heat, RNA bands appeared, indicating that they could respond and release.

[0092] Example 10

[0093] Intracellular uptake and responsive release of Fe3O4 nanogels

[0094] The method prepared in Example 6 was adopted, where RNA was replaced by FAM-labeled RNA (non-functional FAM-siRNA, purchased from Tsingke Biological).

[0095] 4T1 cells were cultured in a confocal dish. When the cell density reached 80%, Fe3O4 nanogels (LNGs prepared according to Example 6, with RNA replaced by FAM-labeled RNA) were administered, so that the final concentration of Fe was 3 mg / mL and the final concentration of RNA was 2 μg / mL. After 4 h of administration, an external magnetic field was applied to heat for 10 min to raise the temperature to 45 °C, and Hoechst nuclear staining and confocal imaging were performed after 2 h. As Figure 18 shown, the untreated group showed an aggregated state, while the green fluorescence in the treated group was diffusely distributed, proving that the FAM-labeled RNA was released in the intracellular environment and dispersed in the cytoplasm to play a role.

[0096] Example 11

[0097] Evaluation of the effect of Fe3O4 nanogels

[0098] 1. Live / dead staining: 4T1 cells were cultured in 6-well plates. When the cell density reached 80%, PBS, iron assemblies (IONAs), unblocked iron assemblies (UNPs), and Fe3O4 nanogels (LNGs) were administered respectively (the final concentration of Fe in each well was 3 mg / mL and the final concentration of functional RNA was 2 μg / mL). After different treatments (incubation at 37 °C and incubation in a water bath at 45 °C for 10 min), Calcein-AM / PI was used for live / dead staining. The results are as Figure 19 shown, the Fe3O4 nanogels had the strongest toxicity after treatment.

[0099] 2. mRNA determination: 4T1 cells were cultured in 6-well plates. When the cell density reached 80%, drugs were administered respectively, and the PDL1 mRNA levels in 4T1 cells after different treatments were determined by real-time fluorescence quantitative PCR. The following drugs had a final concentration of Fe of 3 mg / mL and a final concentration of functional RNA of 2 μg / mL in each well. Group 1 was the non-drug administration group, Group 2 was Fe3O4 nanogels (LNGs), Group 3 was Fe3O4 nanogels (LNGs)

[0100] heated at 45 °C for 10 min, Group 4 was unblocked iron assemblies (UNPs), and Group 5 was unblocked iron assemblies (UNPs) heated at 45 °C for 10 min. The results are as Figure 20 shown, the drugs after encapsulation showed obvious responsive behaviors.

[0101] Example 12

[0102] Evaluation of the tumor inhibitory effect of pH- and thermo-responsive Fe3O4 nanogels on tumor-bearing mice

[0103] Female BALB / c mice weighing 20 - 25 g were selected and subcutaneously injected with 4T1 tumor cells at a dose of 2×10 6 to establish a breast cancer tumor mouse model. When the tumor grew to about 100 mm 3 , the mice were grouped for drug administration (n = 5). Intratumoral injection of 40 μL of Fe3O4 nanogels with an Fe concentration of 6 mg / ml loaded with 2 nmol of RNA that can reduce PDL1 expression (LNGs prepared according to the method of Example 6) was performed. In the control group, an equal volume of phosphate buffered saline (PBS buffer) was injected intratumorally. Then the mice were placed in a high-frequency (1478 kHz) magnetic induction heating device and treated under an alternating magnetic field with an output power of 10 A for 10 min. The temperature-time change curve of the tumor site during the heating process was recorded, and it was found that the temperature of magnetic hyperthermia reached 45.4 °C. Subsequently, the tumor volume and body weight of the mice were recorded.

[0104] As Figure 21 shown is the temperature-time change curve of the tumor site of the mice during the magnetic heat treatment process; Figure 22 is the tumor volume change curve of the mice within 14 days after drug administration; Figure 23 is the body weight change curve of the mice within 14 days after drug administration. Compared with the PBS group, the tumor suppression effect of the Fe3O4 nanogel + magnetic hyperthermia treatment group was more significant. And the Fe3O4 nanogel + magnetic hyperthermia treatment group also had a more significant tumor suppression effect than the treatment group that only received Fe3O4 nanogels. Moreover, during the whole treatment process, the body weight of the mice did not change significantly.

Claims

1. A pH- and heat-responsive iron nanogel for RNA or protein delivery and cancer therapy, characterized in that, The iron nanogels are Fe3O4 nanoparticles surface-modified with Compound 2, Compound 3, RNA or protein, polyethyleneimine-polyethylene glycol, and dopamine; The structures of Compound 2 and Compound 3 are shown as follows: 、 ； The preparation of the pH- and thermoresponsive iron nanogels comprises the following steps: (1) Using iron(III) acetylacetonate as a precursor, Fe3O4 nanoparticles coated with oleylamine and oleic acid are prepared by a thermal decomposition method; (2) The Fe3O4 nanoparticles obtained in the above step are subjected to a ligand exchange reaction with Compound 2 and dopamine to obtain monodisperse aqueous-phase Fe3O4 nanoparticles; (3) The monodisperse aqueous-phase Fe3O4 nanoparticles are mixed with RNA or protein to obtain Fe3O4 nanodrug-loaded assemblies; (4) The Fe3O4 nanodrug-loaded assemblies are mixed with PEI-PEG to obtain unblocked iron assemblies; (5) The unblocked iron assemblies are mixed with Compound 3 to obtain pH- and thermoresponsive Fe3O4 nanogels.

2. The pH- and thermoresponsive iron nanogels for RNA or protein delivery and cancer therapy according to claim 1, wherein, Based on the aqueous-phase Fe3O4 nanoparticles surface-modified with Compound 2 and dopamine obtained after ligand exchange, the iron nanogels deprotect the pinacol-protected groups to expose the surface boric acid groups in a methylboronic acid solution. In a slightly alkaline environment, the boric acid groups at the ends of Compound 2 connected to the nanoparticle surface form borate ester bonds with RNA or protein to obtain an assembly. Then, polyethyleneimine-polyethylene glycol is added for encapsulation, and finally, an acid-thermoresponsive small molecule compound 3 is added for a chemical reaction. After purification, pH- and thermoresponsive Fe3O4 nanogels are obtained.

3. A method for preparing a pH- and thermo-responsive iron nanogel for RNA or protein delivery and tumor treatment according to claim 1, characterized in that, Comprises the following steps: (1) Using iron(III) acetylacetonate as a precursor, Fe3O4 nanoparticles coated with oleylamine and oleic acid are prepared by a thermal decomposition method; (2) The Fe3O4 nanoparticles obtained in the above step are subjected to a ligand exchange reaction with Compound 2 and dopamine to obtain monodisperse aqueous-phase Fe3O4 nanoparticles; (3) The monodisperse aqueous-phase Fe3O4 nanoparticles are mixed with RNA or protein to obtain Fe3O4 nanodrug-loaded assemblies; (4) The Fe3O4 nanodrug-loaded assemblies are mixed with PEI-PEG to obtain unblocked iron assemblies; (5) The unblocked iron assemblies are mixed with Compound 3 to obtain pH- and thermoresponsive Fe3O4 nanogels.

4. The preparation method of the pH- and thermoresponsive iron nanogels for RNA or protein delivery and tumor treatment according to claim 3, characterized in that, In step (1), the diameter of the Fe3O4 nanoparticles coated with oleylamine and oleic acid is 10 - 12 nm.

5. The preparation method of the pH- and heat-responsive iron nanogels for RNA or protein delivery and tumor treatment according to claim 3, characterized in that, In step (2), the ligand exchange reaction is as follows: The Fe3O4 nanoparticles coated with oleylamine and oleic acid are dispersed in a good solvent, and a mixed solution of Compound 2 and dopamine is added. After the reaction, it is cooled and centrifuged, and deionized water is added to obtain monodisperse aqueous-phase Fe3O4 nanoparticles; the good solvent is chloroform or / and tetrahydrofuran.

6. The preparation method of the pH- and thermoresponsive iron nanogels for RNA or protein delivery and tumor treatment according to claim 3, wherein, In step (5), compound 3 is dissolved in a good solvent and activated by 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide or 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, and then added to the unblocked iron assembly in the aqueous phase. After mixing and reacting, it is purified to obtain the pH- and thermoresponsive Fe3O4 nanogel.

7. The preparation method of the pH- and thermoresponsive iron nanogels for RNA or protein delivery and tumor treatment according to claim 3, characterized in that, The good solvent for compound 3 is N,N-dimethylformamide or / and dimethyl sulfoxide.

8. Use of the pH- and thermoresponsive iron nanogel according to claim 1 in the preparation of RNA or protein delivery and tumor therapeutic drugs.

Images