A mouse model capable of inducing helper T cell 17 knockout and its construction method

Abstract

The present invention belongs to the field of biotechnology, and in particular to a method for constructing a mouse model that can induce helper T cell 17 elimination and verification of its elimination effect. The method utilizes the characteristic that Rorc molecules are key molecules that promote the normal differentiation of Th17 cells, and by inserting diphtheria toxin receptor and red fluorescent protein tdTomato into the Rorc molecule gene expression frame, a Rorc‑T2A‑tdTomato‑P2A‑DTR (abbreviation: Rorc‑DTR) gene-modified mouse model is constructed, which can realize the expression of red fluorescent protein and diphtheria toxin receptor driven by endogenous Rorc gene in mice. Using this model, the inventor can trace mouse Th17 cells by tdTomato fluorescent labeling, and Th17 cells can be killed by giving mouse diphtheria toxin at a specific time point or time period, causing Th17 cell defects, and the role of Th17 cells in specific physiological and pathological processes is studied.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for constructing a mouse model capable of inducing helper T cell 17 elimination and verification of its elimination effect. Background Art

[0002] Helper T cells 17 (Th17 cells), also known as inflammatory Th cells, are a subset of T cells that can secrete interleukin 17 (IL-17) and belong to the helper CD4 + T cell subsets, mainly composed of naive CD4 + T cells ( CD4 + Th17 cells are induced to differentiate and form under the action of cytokines such as IL-6, TGF-β, IL21, and IL-1β. Th17 cells are mainly involved in host immune defense, inflammation, and immune regulation. In recent years, in the treatment of various autoimmune diseases such as inflammatory bowel disease (IBDs), systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and psoriasis, it has been found that Th17 cells play an important role in participating in the body's immune response, and promote the secretion or expression of various other inflammatory factors or chemokines through the autocrine pro-inflammatory cytokine IL-17, thereby promoting abnormal immune regulation of the body.

[0003] Specific elimination of a certain type of cell in vivo is an effective method to study the function of the cell in vivo. In order to better study the important role of Th17 cells in the immune system, researchers have developed a variety of Th17 cell-deficient mouse models, such as the Rorc gene knockout model obtained by knocking out the retinoic acid-related orphan nuclear receptor (Rorc) gene. The loss of the Rorc gene can hinder the homeostasis and differentiation process of Th cells.

[0004] Retinoic acid-related orphan nuclear receptor (Rorc), also known as RORγt, or RORγ2, is a member of the nuclear receptor superfamily and is expressed on differentiated and mature Th17 cells. As a key transcription factor for Th17 cell differentiation, Rorc has the function of promoting Th17 cell differentiation and regulating function. The loss of the Rorc gene seriously affects the normal function of Th17 cells. However, in addition to the Rorc gene, another ROR family transcription factor, RORα, is also upregulated during Th17 cell differentiation, thereby guiding the expression of IL17. This compensatory effect makes it impossible to conduct in-depth research on the function of Th17 cells.

[0005] Diphtheria toxin (DT) is an exotoxin produced by diphtheria bacteria infected with β-rod-shaped phages. It consists of two subunits, A and B, connected by disulfide bonds. DT binds to its receptor, heparin-binding epidermal growth factor precursor (DTR) through the B subunit, and then enters the cell through cell adhesion and endocytosis. The ADP-ribosyltransferase activity of the A subunit inhibits the function of translation elongation factor 2 (EF2), thereby terminating protein translation and leading to cell apoptosis. Because human DTR has a higher affinity for DT, while mouse DTR has a lower affinity for DT, human cells are more sensitive to DT than mouse cells. By inserting human DTR into a specific site in the mouse genome, the sensitivity of specific cells expressing the DTR to DT can be increased. Summary of the invention

[0006] In order to further study the function of Th17 cells, the present invention uses gene editing technology to insert a human DTR expression fragment at the stop codon of the RORc gene, and eliminates DTR-expressing Th17 cells by administering DT, thereby achieving inducible elimination of Th17 cells.

[0007] The first aspect of the present invention discloses an inducible helper T cell 17 knockout mouse model, in which a diphtheria toxin receptor expression fragment is constructed into a retinoic acid-related orphan nuclear receptor gene for expression, thereby achieving expression of the diphtheria toxin receptor in T cells.

[0008] The second aspect of the present invention discloses a method for constructing the above-mentioned inducible T helper cell 17 knockout mouse model, and the construction method specifically comprises the following steps:

[0009] a. gRNA target site screening: Screening for a gRNA target site with low off-target risk, wherein the sequence information of the gRNA target site is shown in SEQ ID NO: 1;

[0010] The gRNA target sequence determines the efficiency and potential off-target activity of inducing Cas9 to cut the target gene. The selection and design of efficient and specific target sequences are the prerequisites for the successful construction of the Rorc-DTR mouse model. According to the recombination scheme, the potential gRNA sites near the insertion site are analyzed by software, and the sites with low off-target risks are preferentially selected as the gRNA target sites (SEQ ID NO: 1) for subsequent mouse fertilized egg injection experiments.

[0011] b. Construction of homologous recombination vector, determination of gRNA site and insertion site information, and construction of homologous recombination vector;

[0012] Ⅰ. Construction of gene knock-in fragments: T2A peptide, red fluorescent protein, P2A peptide and diphtheria toxin receptor are synthesized by gene, and their sequence information is shown in SEQ ID NO: 3-5, and they are connected in sequence from left to right to construct a gene knock-in fragment;

[0013] II. Construction of recombinant left arm and recombinant right arm: Using the mouse genome as a template, PCR amplification was performed to obtain the sequence of the recombinant left arm as shown in SEQ ID NO: 2, and the sequence of the recombinant right arm as shown in SEQ ID NO: 7;

[0014] III. Construction of PBR322-Rorc-DTR recombinant vector: Connect the recombinant left arm, gene knock-in fragment and recombinant right arm into the PBR322 vector to obtain the PBR322-Rorc-DTR recombinant vector;

[0015] c. Construction of Rorc-DTR knock-in mice:

[0016] The fertilized eggs of mature mice were taken, the PBR322-Rorc-DTR recombinant vector, Cas9 mRNA and gRNA were mixed, and the fertilized eggs were microinjected. After a short period of incubation in an incubator, the injected fertilized eggs were transplanted into the oviduct of the recipient mother mouse to obtain the F0 generation of gene-modified mice;

[0017] The successfully constructed F0 generation mice were selected to mate with wild-type mice to obtain F1 generation mice, and the recombinant positive mice were identified.

[0018] The primer pairs were used to perform PCR identification of the recombinant left arm and the recombinant right arm in the F0 generation mice and the F1 generation mice.

[0019] The primer pair includes an identification primer pair for the left arm of the recombination: primer P1, whose sequence is shown in SEQ ID NO:8, and primer P2, whose sequence is shown in SEQ ID NO:9; and an identification primer pair for the right arm of the recombination: primer P3, whose sequence is shown in SEQ ID NO:10, and primer P4, whose sequence is shown in SEQ ID NO:11.

[0020] Primer name Sequence information (5'→3') P1 GCCGGGAGCAAGAGAAACAAGAAT(SEQ ID NO:8) P2 CACCCGAGCTGCCTGAGAAGACA(SEQ ID NO:9) P3 AGGCAACTTAAGGGGCTGGTGAG(SEQ ID NO:10) P4 GGCGCTTTCCCCTGTATTTATGAG(SEQ ID NO:11)

[0021] The third aspect of the present invention discloses the use of the above-mentioned inducible microglia knockout mouse model in evaluating the function of helper T cells 17. Specifically, it includes the use in screening drugs for preventing and / or treating inflammation.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] The present invention provides a method for constructing a mouse model that can induce helper T cell 17 elimination and verification of its elimination effect. The method utilizes the property that Rorc molecules are key molecules that promote the normal differentiation of Th17 cells. By inserting diphtheria toxin receptor and red fluorescent protein tdTomato into the Rorc molecule gene expression frame, a Rorc-T2A-tdTomato-P2A-DTR (abbreviated as: Rorc-DTR) gene-modified mouse model is constructed, which can realize the expression of red fluorescent protein and diphtheria toxin receptor driven by endogenous Rorc gene in mice. Using this model, mouse Th17 cells can be traced by tdTomato fluorescent labeling, and Th17 cells can be killed by giving mice diphtheria toxin at a specific time point or time period, causing Th17 cell defects, and the role of Th17 cells in specific physiological and pathological processes is studied. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : The structure of mouse Rorc gene and the structure of Rorc gene after Rorc-DTR gene modification.

[0025] Figure 2 :Schematic diagram of the construction strategy of the Rorc-DTR mouse model and the identification results. A is a schematic diagram of the construction strategy of the Rorc-DTR mouse; P1, P2, P3, and P4 are schematic diagrams of the positions of the recombination PCR identification primers; B is an electrophoresis diagram of homologous recombination identification of F0 generation mice; the numbers are the mouse numbers, wt is the wild-type control; M is a 1kb DNA marker.

[0026] Figure 3 :Electrophoresis diagram of homologous recombination identification in F1 generation mice; numbers are mouse numbers, wt is wild-type control; M is 1kbDNA marker.

[0027] Figure 4 :Detection of tdTomato fluorescence expression in Th17 cells of Rorc-DTR mice.

[0028] Figure 5 :Detection of the inducible elimination effect of Th17 cells in Rorc-DTR mice. DETAILED DESCRIPTION

[0029] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0030] Embodiment 1

[0031] Construction of Rorc-DTR mouse model

[0032] In order to avoid disrupting the expression of endogenous Rorc in mice and thus causing Th17 cell functional defects under normal conditions, the inventors designed a strategy for constructing a Rorc-DTR mouse model by inserting the T2A-tdTomato-P2A-DTR element after the stop codon of the mouse Rorc gene. Figure 1 shown.

[0033] 1) gRNA target site selection

[0034] The gRNA target sequence determines the efficiency and potential off-target activity of inducing Cas9 to cut the target gene. Efficient and specific target sequence selection and design are the prerequisites for the successful construction of the Rorc-DTR mouse model.

[0035] According to the recombination scheme, the potential gRNA sites near the insertion site were analyzed by software, and the sites with low off-target risks were preferentially selected as the gRNA target sites (SEQ ID NO: 1) for subsequent mouse fertilized egg injection experiments.

[0036] 2) Construction of homologous recombination vector

[0037] According to the obtained gRNA site and insertion site information, a homologous recombination vector was constructed. The vector structure is as shown in the strategy Figure 2 As shown in A, the structures from left to right are: recombinant left arm, 2A peptide, red fluorescent protein (tdTomato), 2A peptide and diphtheria toxin receptor sequence, recombinant right arm, and the sequences are SEQ ID NO: 2-7. The recombinant left arm and the recombinant right arm were obtained by PCR amplification using the mouse genome as a template, and the remaining fragments were obtained by whole gene synthesis. During the construction process, the recombinant left arm, the gene knock-in fragment (2A-tdTomato-2A-DTR) and the recombinant right arm were first obtained by PCR, and the three DNA fragments were connected to the PBR322 vector using the In-Fusion method to obtain the final PBR322-Rorc-DTR recombinant vector. After the vector was verified to be correct by enzyme digestion and sequencing, subsequent mouse preparation was carried out.

[0038] 3) Construction of Rorc-DTR knock-in mice: Fertilized eggs of C57BL / 6 mice were taken, and the PBR322-Rorc-DTR recombinant vector, Cas9 mRNA and gRNA were mixed according to the method in the Mouse Embryo Operation Experiment Manual (Third Edition), and then microinjected into the fertilized eggs. After a short period of incubation in the incubator, the injected fertilized eggs were transplanted into the oviduct of the recipient mother mouse to obtain gene-modified mice F0 generation mice. After the F0 generation mice were born, their tails were cut and the genome was extracted. The identification primer pairs for the left arm of homologous recombination (primers P1 and P2) and the identification primer pairs for the right arm (primers P3 and P4) were used to identify whether correct homologous recombination occurred. The primer positions are shown in the figure below. Figure 2 As shown in P1-P4 in A, the sequence information is as follows:

[0039] Primer name Sequence information (5'→3') P1 GCCGGGAGCAAGAGAAACAAGAAT(SEQ ID NO:8) P2 CACCCGAGCTGCCTGAGAAGACA(SEQ ID NO:9) P3 AGGCAACTTAAGGGGCTGGTGAG(SEQ ID NO:10) P4 GGCGCTTTCCCCTGTATTTATGAG(SEQ ID NO:11)

[0040] The PCR reaction system of primer pairs P1 / P2 and P3 / P4 is the same, as follows:

[0041] PCR reaction composition Volume (μl) <![CDATA[ddH 2 The]]> 31 PCRBuffer 10 2.5 mM dNTP 4 Primer 1 (20 pmol / μl) 1 Primer 2 (20 pmol / μl) 1 DNA Polymerase 2 Genomic DNA 1 total 50

[0042] The PCR reaction procedures for primer pairs P1 / P2 and P3 / P4 are the same, as follows:

[0043]

[0044] A total of 23 F0 mice were born. The left and right arms of the 23 mice were identified for homologous recombination. The identification results showed that mice No. 2, No. 22, and No. 23 were positive mice with homologous recombination in both homologous arms. The identification results are as follows: Figure 2 As shown in B (left arm) and 2C (right arm), in F0 generation mice with correct homologous recombination, homologous recombination in the left arm can amplify a band of 5.8kb, while the left arm identification of negative mice can only amplify a band of 7.2kb; homologous recombination in the right arm can amplify a band of 4.2kb, while the right arm of negative mice can only amplify a band of 7.6kb.

[0045] After adulthood, F0 mice No. 2, No. 22, and No. 23 were mated with wild-type C57BL / 6 mice to obtain 17 F1 mice. After the F1 mice were born, their tails were cut and the genome was extracted. The same conditions as for identifying F0 mice were used to perform PCR identification for the left arm (primers P1 and P2) and right arm (primers P3 and P4) of homologous recombination to confirm whether the obtained F1 mice were Rorc-DTR gene knock-in mice with correct homologous recombination. The identification results of positive mice were as follows: Figure 3 shown. Figure 3 A in the middle is the result of homologous recombination identification of the left arm of F1 positive mice No. 3, 7, 8, 16, and 17; Figure 3Middle B is the result of homologous recombination identification of the right arm of F1 positive mice No. 3, 7, 8, 16, and 17.

[0046] Embodiment 2

[0047] Detection of tdTomato fluorescence expression in Th17 cells of Rorc-DTR gene knock-in mice

[0048] During the construction of Rorc-DTR mice, DTR and tdTomato were co-expressed in the form of 2A connection according to the design strategy. Therefore, when mouse Th17 cells express DTR, the expression of tdTomato fluorescence should be detected at the same time. The inventors used flow cytometry to detect CD3 + CD4 + The expression of tdTomato fluorescence in T cells was detected. Figure 4 As shown, CD3 + CD4 + The proportion of Rorγt-positive cells in T cells was about 7.77%; CD3 + CD4 + The proportion of Rorγt-positive cells in T cells was about 7.49%, which was close to that of wild-type cells. + CD4 + tdTomato fluorescence can be detected in Rorγt-positive cells within T cells, with a fluorescence ratio of 77.8%; while tdTomato fluorescence is almost undetectable in Rorγt-positive cells of wild-type C57BL / 6 mice.

[0049] Embodiment 3

[0050] Detection of the Th17 cell deficiency effect induced by diphtheria toxin in Rorc-DTR gene knock-in mice

[0051] In order to verify whether Th17 cells expressing DTR can be eliminated by diphtheria toxin, the inventors administered diphtheria toxin to wild-type mice and Rorc-DTR mice by intraperitoneal injection on day 0 of the experiment at a dose of 0.015 mg / kg; 24 hours after administration of diphtheria toxin, the content of Th17 cells in the brain was detected. Figure 5 Flow cytometry results showed that wild-type mice thymus CD3 + CD4 + The proportion of Rorc-positive cells in T cells was about 5.29%, while the thymic CD3 + CD4 + Rorc in T cells +tdTomato + The cell ratio dropped to about 0.41%. From this result, it can be seen that diphtheria toxin can induce killing of Th17 cells in Rorc-DTR gene knock-in mice, resulting in Th17 cell deficiency.

[0052] In summary, the inventors provided a method for constructing an inducible Th17 cell-deficient mouse model, and constructed a Rorc-DTR mouse model based on homologous recombination mediated by the CRISPR / Cas9 system using the screened highly active gRNA target sites; the inventors verified the tdTomato fluorescence expression of Th17 cells in the model, and the Th17 cell deficiency caused by the inducible killing of Th17 cells by diphtheria toxin. This model can be applied to the study of Th17 cell function under specific physiological and pathological conditions.

[0053] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for constructing a mouse model capable of inducing helper T cell 17 deletion, characterized in that: The diphtheria toxin receptor expression fragment is constructed and expressed in the retinoic acid-related orphan nuclear receptor gene to achieve the expression of the diphtheria toxin receptor in T cells; The construction method specifically comprises the following steps: a. gRNA target site screening: Screening for a gRNA target site with low off-target risk, wherein the sequence information of the gRNA target site is shown in SEQ ID NO: 1; b. Construction of homologous recombination vector, determination of gRNA site and insertion site information, and construction of homologous recombination vector; Ⅰ. Construction of gene knock-in fragments: T2A peptide, red fluorescent protein, P2A peptide and diphtheria toxin receptor are synthesized by gene, and their sequence information is shown in SEQ ID NO: 3-5, and they are connected in sequence from left to right to construct a gene knock-in fragment; II. Construction of recombinant left arm and recombinant right arm: Using the mouse genome as a template, PCR amplification was performed to obtain the sequence of the recombinant left arm as shown in SEQ ID NO: 2, and the sequence of the recombinant right arm as shown in SEQ ID NO: 7; III. Construction of PBR322-Rorc-DTR recombinant vector: Connect the recombinant left arm, gene knock-in fragment and recombinant right arm into the PBR322 vector to obtain the PBR322-Rorc-DTR recombinant vector; c. Construction of Rorc-DTR knock-in mice: The fertilized eggs of mature mice were taken, the PBR322-Rorc-DTR recombinant vector, Cas9 mRNA and gRNA were mixed, and the fertilized eggs were microinjected. After a short period of incubation in an incubator, the injected fertilized eggs were transplanted into the oviduct of the recipient mother mouse to obtain the F0 generation of gene-modified mice; The successfully constructed F0 generation mice were selected to mate with wild-type mice to obtain F1 generation mice, and the recombinant positive mice were identified.

2. The construction method according to claim 1, characterized in that: The primer pairs were used to perform PCR identification of the recombinant left arm and the recombinant right arm in the F0 generation mice and the F1 generation mice.

3. The construction method according to claim 2, characterized in that: The primer pair includes an identification primer pair for the left arm of recombination: primer P1, whose sequence is shown in SEQ ID NO: 8, and primer P2, whose sequence is shown in SEQ ID NO: 9; and an identification primer pair for the right arm of recombination: primer P3, whose sequence is shown in SEQ ID NO: 10, and primer P4, whose sequence is shown in SEQ ID NO:

11.

4. Use of the inducible T helper cell 17 knockout mouse model obtained by the construction method as described in claim 1 in evaluating the function of T helper cell 17.

5. Use of the inducible T helper cell 17 knockout mouse model obtained by the construction method as described in claim 1 in screening drugs for preventing and / or treating inflammation.

Images